ID: 1002580960

View in Genome Browser
Species Human (GRCh38)
Location 5:180209199-180209221
Sequence GCGCAGCGCCGCGTTGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002580960_1002580970 9 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580970 5:180209231-180209253 GCACTCAGGCAGCGCGGAGCGGG No data
1002580960_1002580976 21 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580976 5:180209243-180209265 CGCGGAGCGGGCGGGGCGCGGGG No data
1002580960_1002580975 20 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580975 5:180209242-180209264 GCGCGGAGCGGGCGGGGCGCGGG No data
1002580960_1002580974 19 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580974 5:180209241-180209263 AGCGCGGAGCGGGCGGGGCGCGG No data
1002580960_1002580977 22 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580977 5:180209244-180209266 GCGGAGCGGGCGGGGCGCGGGGG No data
1002580960_1002580971 12 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580971 5:180209234-180209256 CTCAGGCAGCGCGGAGCGGGCGG No data
1002580960_1002580973 14 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580973 5:180209236-180209258 CAGGCAGCGCGGAGCGGGCGGGG No data
1002580960_1002580978 25 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580978 5:180209247-180209269 GAGCGGGCGGGGCGCGGGGGTGG No data
1002580960_1002580968 3 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580968 5:180209225-180209247 CTCGTGGCACTCAGGCAGCGCGG No data
1002580960_1002580963 -5 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580963 5:180209217-180209239 TGCGCCCCCTCGTGGCACTCAGG No data
1002580960_1002580972 13 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580972 5:180209235-180209257 TCAGGCAGCGCGGAGCGGGCGGG No data
1002580960_1002580969 8 Left 1002580960 5:180209199-180209221 CCCGGAGCAACGCGGCGCTGCGC No data
Right 1002580969 5:180209230-180209252 GGCACTCAGGCAGCGCGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002580960 Original CRISPR GCGCAGCGCCGCGTTGCTCC GGG (reversed) Intergenic