ID: 1002581789

View in Genome Browser
Species Human (GRCh38)
Location 5:180213050-180213072
Sequence GTGCGGGTCCTCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002581781_1002581789 -5 Left 1002581781 5:180213032-180213054 CCTGCGGGTGCCTGCCTGGTGCG No data
Right 1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002581789 Original CRISPR GTGCGGGTCCTCAGGGAGGA AGG Intergenic
No off target data available for this crispr