ID: 1002586788

View in Genome Browser
Species Human (GRCh38)
Location 5:180253593-180253615
Sequence AGGGCCAGCAGGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 0, 2: 10, 3: 81, 4: 786}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002586788_1002586795 16 Left 1002586788 5:180253593-180253615 CCTTCCTCACTCCTGCTGGCCCT 0: 1
1: 0
2: 10
3: 81
4: 786
Right 1002586795 5:180253632-180253654 ATGCCCAGCTTCCAGGTGCAGGG 0: 1
1: 0
2: 1
3: 19
4: 263
1002586788_1002586794 15 Left 1002586788 5:180253593-180253615 CCTTCCTCACTCCTGCTGGCCCT 0: 1
1: 0
2: 10
3: 81
4: 786
Right 1002586794 5:180253631-180253653 GATGCCCAGCTTCCAGGTGCAGG 0: 1
1: 0
2: 1
3: 27
4: 251
1002586788_1002586798 23 Left 1002586788 5:180253593-180253615 CCTTCCTCACTCCTGCTGGCCCT 0: 1
1: 0
2: 10
3: 81
4: 786
Right 1002586798 5:180253639-180253661 GCTTCCAGGTGCAGGGCCACAGG 0: 1
1: 0
2: 1
3: 26
4: 263
1002586788_1002586793 9 Left 1002586788 5:180253593-180253615 CCTTCCTCACTCCTGCTGGCCCT 0: 1
1: 0
2: 10
3: 81
4: 786
Right 1002586793 5:180253625-180253647 GAAACTGATGCCCAGCTTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002586788 Original CRISPR AGGGCCAGCAGGAGTGAGGA AGG (reversed) Intronic
900038799 1:439845-439867 AGGAGCAGGAGGAGTAAGGAGGG + Intergenic
900511115 1:3061654-3061676 AGGGCAGGCAGGAGGGAGAAGGG + Intergenic
900594207 1:3473052-3473074 AAGGCAAGGAGGGGTGAGGAGGG - Intronic
900598777 1:3494247-3494269 GGAGCCAGCAGCAGTGGGGAGGG - Intronic
900611768 1:3547254-3547276 AGGCCCCGCAGGAGGGAGGCTGG + Intronic
900767651 1:4515860-4515882 AGAGCCTGGAGGAGTCAGGAAGG + Intergenic
900793733 1:4695184-4695206 AGCTCCTGCAGGAGGGAGGATGG + Intronic
900836760 1:5010825-5010847 ACAGCCAACAGGAGTGAGGCTGG - Intergenic
900943076 1:5813724-5813746 AGGACGAGGAGGAGGGAGGAAGG + Intergenic
901171873 1:7265005-7265027 AGGGCCTGCAGGGGTGGGGAGGG + Intronic
901228801 1:7630638-7630660 TGCGCCAGCAGGAGTCAGGCCGG - Intronic
901291150 1:8125573-8125595 AGGGCCAGGCAGGGTGAGGAGGG - Intergenic
901812624 1:11776527-11776549 AGGGGCAGCAGGAGCAAGGCCGG + Exonic
901938670 1:12645327-12645349 AGAGAGAGCAGGAGAGAGGAAGG - Intronic
902072200 1:13749550-13749572 CGGGCCAGCAGCAGCGAGGGCGG - Intronic
902292863 1:15446689-15446711 AGGGGCAGCACCAGAGAGGAGGG - Intronic
902383195 1:16062201-16062223 AGTGGCAGGAGGAGTGAGCAGGG + Intronic
902407272 1:16191635-16191657 GGGACCAGGAGGAATGAGGAGGG + Intergenic
902410717 1:16210114-16210136 AGGGGCTGCAGGAGGGAGGCTGG - Intronic
902688912 1:18097376-18097398 AGGGAGAGAAGGAGGGAGGAAGG - Intergenic
902692500 1:18118578-18118600 AGGGGCGGAAGGAGTGAGGTGGG + Intronic
902745493 1:18470982-18471004 AAGGCCAGCAGGAGTGTAGAGGG + Intergenic
903048428 1:20582672-20582694 AATCCCAGCAGCAGTGAGGAGGG + Intergenic
904046838 1:27614330-27614352 CGGGCGACCTGGAGTGAGGAAGG + Intronic
904117258 1:28171920-28171942 AGGGCCAGGAAGAGGGAGGGAGG + Intronic
904541792 1:31238683-31238705 GGGGCCAGCAACAGTGGGGATGG - Intronic
905370971 1:37482568-37482590 AGGAAGGGCAGGAGTGAGGAGGG - Intronic
905489441 1:38332098-38332120 AGGGAGAGGAGGAGTGAGGTTGG - Intergenic
905939750 1:41853720-41853742 AGGGAAAGTAGGAGTGAAGAGGG + Intronic
906316025 1:44786847-44786869 GAGGCCAGGAGGAGGGAGGAGGG + Intronic
907237701 1:53062971-53062993 CGGGACAGCTGGAGGGAGGAAGG + Intronic
907270801 1:53289933-53289955 AGGGGAAGCAGGAGTGTGGTGGG - Intronic
907278431 1:53329317-53329339 AGGGACAGGAGGGGTGATGATGG - Intergenic
907283082 1:53363360-53363382 TGGGGAAGCAGGAGTGAGGTTGG + Intergenic
907479721 1:54737060-54737082 GGGGCCAGCAGGCCTGAGCAGGG - Intronic
908824027 1:68116222-68116244 AGGGCCAGCATCAGGGAGGGAGG + Intronic
908866815 1:68557060-68557082 AGGGCCAGTGGGTGAGAGGAGGG + Intergenic
909550371 1:76893236-76893258 AGGGTGTGCAGGAGGGAGGAAGG + Intronic
910042808 1:82873946-82873968 AGGCTTAGCAGGAGAGAGGAGGG + Intergenic
911698117 1:100916738-100916760 TGGTGCTGCAGGAGTGAGGATGG - Intronic
912274401 1:108241035-108241057 AGGGTCATCAGGAGTGAGGAGGG + Exonic
912286866 1:108378827-108378849 AGGGTCATCAGGAGTGAGGAGGG - Intronic
912293818 1:108453288-108453310 AGGGTCATCAGGAGTGAGGAGGG - Exonic
912547687 1:110462789-110462811 GGGCACATCAGGAGTGAGGAGGG + Intergenic
913711323 1:121486742-121486764 AGAACCAGCAGCAATGAGGATGG + Intergenic
914342497 1:146772157-146772179 AAGATCAGCAGGATTGAGGAGGG + Intergenic
914381474 1:147120155-147120177 AGAATCATCAGGAGTGAGGAGGG + Intergenic
914940776 1:152021277-152021299 AGGCTCATCCGGAGTGAGGAGGG - Intergenic
915263567 1:154697563-154697585 AGTTCAAGCAGGAGTGGGGAAGG + Exonic
915733220 1:158068616-158068638 AAGGCAAGAAGGAGGGAGGAAGG - Intronic
915941441 1:160120892-160120914 ACGGCCAGCCTGAGGGAGGAAGG - Exonic
916471762 1:165130396-165130418 ATTGCCAACAGTAGTGAGGAAGG + Intergenic
916830986 1:168490983-168491005 AGGGTCGGCGGGAGTGGGGAGGG - Intergenic
917086983 1:171313479-171313501 AATGCCTACAGGAGTGAGGAGGG - Intergenic
917516624 1:175713978-175714000 AGGGCCAGCATGAGGGAGAGAGG - Intronic
917516689 1:175714453-175714475 AGTGCCAGCTGGGGTGAGGGAGG - Intronic
918006178 1:180544024-180544046 AGGGCCTGAGGGGGTGAGGAGGG - Intergenic
918071100 1:181133872-181133894 AGGGGTAGCAGGTGTGAGGCTGG - Intergenic
918079113 1:181192134-181192156 AGGGCTGGCAGGACCGAGGATGG - Intergenic
918409224 1:184241243-184241265 AGGGGCAGCAGCAGTGGAGATGG + Intergenic
919310156 1:195896661-195896683 AAGGCAAGCAGGAGTGAGTTTGG + Intergenic
919879883 1:201894565-201894587 AGGGCAGGCAGGAGTGAGGGTGG + Intergenic
920009895 1:202860126-202860148 AGGACCAGAAGAAGGGAGGAAGG - Intergenic
920209774 1:204319851-204319873 AGGGCGGGCAGGGATGAGGAGGG + Intronic
920316161 1:205076972-205076994 AGGGCCTCCTGGAATGAGGAAGG - Exonic
920435091 1:205942334-205942356 AGGGCCAGGATGAGGGAGGTGGG + Intronic
921378514 1:214499928-214499950 TGTGCCAGCAGGCTTGAGGAGGG + Intronic
921952062 1:220940533-220940555 AGAGGAAGCTGGAGTGAGGAAGG + Intergenic
922622860 1:227004274-227004296 AGGGGCAGAAGGAGAGAAGATGG - Intronic
924064903 1:240210979-240211001 AAGGCCAGCAGGAGGGAAGGAGG - Intronic
924206171 1:241713354-241713376 AGGGACAGAGGGAGGGAGGAAGG + Intronic
924447339 1:244145515-244145537 AGGGACACCTGGAGTGGGGATGG - Intergenic
924695140 1:246391472-246391494 AGGGAGAGAAGGAGAGAGGAGGG + Intronic
1062835876 10:635467-635489 AGGGCCAGCAGGGGCGAGGCCGG + Intronic
1063119422 10:3094221-3094243 AGCCCCAGCAGGAGCGAGGCCGG - Intronic
1063402524 10:5760320-5760342 AGCGCCAACAGCAGTGAGTACGG - Intronic
1063437920 10:6049548-6049570 AGGGAAAGCAGGAGTTAAGAAGG - Intronic
1063498031 10:6528101-6528123 GGGGCAAGCAGGAGGGAAGAGGG - Intronic
1063672740 10:8112469-8112491 ACAGCCAGCAGGAGTAAGGTGGG - Intergenic
1064051491 10:12063677-12063699 AGGGCCAGCTGCATTGAGGTGGG + Intergenic
1065874172 10:29982938-29982960 AAGGGAAGAAGGAGTGAGGAAGG + Intergenic
1066453281 10:35550474-35550496 AGGGACAAAAGGAGTGGGGAGGG - Intronic
1066627129 10:37418362-37418384 AGGGCAGGAGGGAGTGAGGAGGG - Intergenic
1066733838 10:38454348-38454370 AGGGGCAGCAGGAGTAAAGGAGG + Intergenic
1066964307 10:42247399-42247421 AGTGCCAGCAGGAGTGGGATGGG + Intergenic
1067757141 10:49013745-49013767 CCAGCCAGCAGGAGTGAGGGTGG + Intergenic
1067978681 10:51056121-51056143 AGGGGCAGCAGTTGTGATGAAGG + Intronic
1068139933 10:52992842-52992864 AGGGAGAGCTGGAGTGATGATGG + Intergenic
1069589033 10:69630547-69630569 AGGGCCAGCGGGCTTCAGGAGGG + Intronic
1069606386 10:69741407-69741429 AATGGCAGCAGGAGTGGGGAGGG - Intergenic
1069686303 10:70321334-70321356 AGGGCCTGCTGGAGGAAGGAGGG - Intronic
1069787671 10:70998982-70999004 AGGGGGAGCAAGAGAGAGGAAGG - Intergenic
1070459723 10:76652284-76652306 AGCACCAGCAGTAGTGAGGATGG - Intergenic
1070514954 10:77196071-77196093 AGGGCCTGCAGGAGGAAGCAAGG - Intronic
1070696983 10:78570823-78570845 AGGGCCAGGCAGAGTGAGGATGG - Intergenic
1070782353 10:79145077-79145099 AGGGCAGGAAGGAGGGAGGAGGG - Intronic
1070979199 10:80630765-80630787 AGGGTCAGCTGGAGTGAAGGGGG + Intronic
1071122099 10:82290080-82290102 ACTGCCAGCAACAGTGAGGAAGG - Intronic
1071445938 10:85747292-85747314 AAGGCAAGCAGGAGAGAAGAAGG + Intronic
1071569303 10:86687731-86687753 ATTGCCAGCAGTAGTGTGGATGG - Intronic
1071718489 10:88120131-88120153 GGGGGAAGCAGGAGCGAGGAGGG + Intergenic
1071983180 10:91024223-91024245 GGGGCGGGGAGGAGTGAGGATGG - Intergenic
1072368249 10:94736828-94736850 AGGGACAGCATGAGGGTGGAGGG - Intronic
1072659895 10:97357278-97357300 AGCGCCAGCAGGGATGAGAAGGG + Intronic
1073045899 10:100638011-100638033 TGGGCCAGCAGGAGACAGCAAGG + Intergenic
1073055330 10:100696518-100696540 AGGGAGAGAAGGAGGGAGGAAGG + Intergenic
1073085101 10:100883278-100883300 ATGGCCAGAAGGGGTGAGAAGGG + Intergenic
1073852322 10:107635206-107635228 AGGGAAAACAGGGGTGAGGATGG - Intergenic
1074357773 10:112801160-112801182 ATGGCCAGCAGGAGGTGGGAGGG + Intronic
1075529299 10:123214208-123214230 ATGGCCAGGAGTAGTGAGGTGGG - Intergenic
1075618384 10:123907918-123907940 AGGGGAAGCAGGAGGAAGGAAGG + Intronic
1075705449 10:124497584-124497606 AGGGGCTGCAGCTGTGAGGATGG - Intronic
1075746940 10:124734623-124734645 AGGGCCAGCACCAGAGGGGAGGG + Intronic
1076153900 10:128188121-128188143 AGGGACAGCAGAACTGAGCAAGG + Intergenic
1076230139 10:128813438-128813460 AGGGACAGAAGGAGGGAGGGAGG + Intergenic
1076238604 10:128884682-128884704 AGGGCCGGAAGGAGGGAGGATGG - Intergenic
1076522173 10:131088074-131088096 AGGACCAGCAAGAGAGCGGAAGG - Intergenic
1076589199 10:131571617-131571639 GGGGCCCGCAGGAGTGTGCACGG - Intergenic
1076698234 10:132257285-132257307 AGGGGCTGCAGGTGGGAGGATGG - Intronic
1076737941 10:132467084-132467106 AGGGCCAGCTGGGGTGGGGAAGG - Intergenic
1076890278 10:133280017-133280039 CTGGGCAGCAGGGGTGAGGAAGG + Intronic
1077132586 11:980620-980642 AGGGCCAGGAGGAGCGGGGAGGG + Intronic
1077231159 11:1458731-1458753 AGGCCCAGCAGTAGGGAAGAGGG + Intronic
1077323948 11:1955492-1955514 AGAGGGAGGAGGAGTGAGGATGG - Intronic
1077358885 11:2131010-2131032 TGGCCCAGCCAGAGTGAGGAAGG - Intronic
1077412172 11:2408700-2408722 CGGGGCAGGAGGAGGGAGGAGGG + Intronic
1077434611 11:2532798-2532820 CAGGCCTGGAGGAGTGAGGACGG + Intronic
1077924426 11:6666692-6666714 AGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1078004885 11:7525153-7525175 AGGGCCCACAGGAGTTAGGGAGG - Intronic
1078900562 11:15638584-15638606 AGGGCCATCAGGAGTGGGTGTGG - Intergenic
1081760359 11:45572564-45572586 AGGGCCCGGAGGGGTGATGATGG - Intergenic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1081968351 11:47182924-47182946 AGGGCCAGGATGGGTGAGGATGG + Intronic
1083261800 11:61527132-61527154 AGGGCTTGCAGGAGAGAGAAAGG + Intronic
1083367580 11:62150769-62150791 AAGGCCAGCTTGAGTGAGCAGGG + Intronic
1083598485 11:63931803-63931825 AGGGCGGGCAGGAGCCAGGAAGG + Intergenic
1083672404 11:64306591-64306613 AGTGTGAGCAGGAGTGAGCACGG + Intronic
1084197286 11:67530667-67530689 AGAGCCATAAGGAGGGAGGAAGG - Intergenic
1084238203 11:67801665-67801687 TGGTGCAGCAGGAGTGGGGATGG + Intergenic
1084267526 11:68012609-68012631 AGTGGCAGCAATAGTGAGGAGGG + Intronic
1084304251 11:68271579-68271601 AGAGACAGGAGGAGGGAGGAGGG - Intronic
1084980954 11:72828512-72828534 AGGGTCAGCAGGCATGAGGCTGG - Intronic
1085199470 11:74692969-74692991 AGGAGAAACAGGAGTGAGGATGG - Intergenic
1085649417 11:78254012-78254034 AGGGGCTGCAGAGGTGAGGATGG - Intronic
1086858151 11:91891746-91891768 AGAGACAGCAGGAGGGAAGAGGG + Intergenic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1088713952 11:112532313-112532335 AGGCCCAACAGGACTGAGAAGGG - Intergenic
1088890362 11:114039330-114039352 AGGGCCAGGTGGGGTGAGGGAGG - Intergenic
1089281886 11:117380540-117380562 AGAGCCAGCAGGAGGATGGAGGG + Intronic
1089626599 11:119754993-119755015 CAGGCCAGCATGAGGGAGGAGGG + Intergenic
1089887688 11:121844109-121844131 TTGGCCAGCAGGAAGGAGGAAGG + Intergenic
1090098002 11:123762851-123762873 AGGGGGAGCAAGAGAGAGGAAGG + Intergenic
1090203976 11:124874963-124874985 AGGGCCTCCAAGAGTGAGTATGG + Intronic
1090332331 11:125941828-125941850 AGGGACAGCTGGGCTGAGGAGGG - Intergenic
1090382687 11:126338067-126338089 AGTGCCAGCTGGAGTGGGAAGGG + Intronic
1090472854 11:126995850-126995872 AGGGCCAGCAGGAGATGGGGTGG - Intronic
1090636984 11:128695281-128695303 AGGGCCAGGAGCAGAGAGGAGGG + Intronic
1091175004 11:133549883-133549905 AGGGCCAGATGGAGGGAGCAGGG - Intergenic
1091307132 11:134543434-134543456 AGGCCCAGGAGCAGGGAGGATGG - Intergenic
1202806934 11_KI270721v1_random:10687-10709 AGAGGGAGGAGGAGTGAGGATGG - Intergenic
1202816751 11_KI270721v1_random:49680-49702 GGGACCAGGAGGAGGGAGGAAGG - Intergenic
1093152017 12:15633018-15633040 AGGGCAAGGAGGAGAGAGGCAGG + Intronic
1093369912 12:18354340-18354362 GGGGCAAGCTGGAGAGAGGACGG + Intronic
1093397066 12:18695605-18695627 AAGGCCTGTAGGTGTGAGGAGGG - Intronic
1093477806 12:19574251-19574273 GGGGGCAACAGGAGAGAGGATGG + Intronic
1094047208 12:26180107-26180129 AGAACCAGCAGGACTAAGGATGG + Intronic
1094128817 12:27052763-27052785 AGGGCCTGCAGGAGGGTGAAGGG - Intronic
1095818523 12:46451073-46451095 AGGGAGAGCAGGAGAAAGGAAGG - Intergenic
1095948535 12:47767601-47767623 AGGGACAGCAGGAGTAGGGGTGG + Intronic
1096240019 12:49954816-49954838 AGGACCAGGAGGAGTGTGGAGGG - Intronic
1096664559 12:53154541-53154563 AGGAGCAGCAGGAGTGGGGAGGG + Intergenic
1096675702 12:53224713-53224735 AGTGGCAGGAGGAGGGAGGAGGG - Intronic
1096693926 12:53337014-53337036 AAGACAAGCAGGAGTGAGGGTGG + Intronic
1096761001 12:53841949-53841971 ATGGGGAGCAAGAGTGAGGAGGG - Intergenic
1096781501 12:53994804-53994826 AGGGCGAGAAGGAGGGAGGGAGG + Intronic
1096846106 12:54407949-54407971 AGGCCCAGTAGGGGTGGGGAAGG - Intronic
1097054386 12:56241057-56241079 AGAGCCAGCAGGGTTGGGGATGG + Exonic
1098163382 12:67669314-67669336 GGGGACAGCAGGAGTGAGCCAGG - Intergenic
1098785257 12:74745302-74745324 AGGGCCTGCTTGAGGGAGGAGGG - Intergenic
1098813877 12:75131699-75131721 AGGCCCTGTAGGAGTGAAGATGG + Intronic
1100251646 12:92830948-92830970 AGGGCCAGCAGAAGCAGGGAAGG + Intronic
1100292681 12:93232697-93232719 AGTGCCAGAAGGAAGGAGGATGG - Intergenic
1100706333 12:97203892-97203914 AGGGCCATCAGGTGGGAGCAGGG - Intergenic
1101161665 12:101983618-101983640 AAGACCAGCTGTAGTGAGGATGG + Intronic
1101269106 12:103124249-103124271 AGGGACACCAGATGTGAGGATGG - Intergenic
1102556082 12:113727419-113727441 AGGGACAGAAGGAGGGAGGGAGG - Intergenic
1102962135 12:117099610-117099632 AGATCCAGCAGGTGTGCGGAAGG - Intergenic
1103340966 12:120221004-120221026 AGGCCCAGCAGGGGAGGGGAAGG + Intronic
1103891522 12:124242487-124242509 GGGGGCAGCAGGGTTGAGGAGGG + Intronic
1103953748 12:124565875-124565897 ATGGCAAGCAGCAGTGAGGTGGG - Intronic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104463237 12:128971509-128971531 AGGGACAGAAGGAGAGAGGAAGG - Intronic
1104603587 12:130170747-130170769 AGGCCAAGCTGGAGGGAGGAGGG + Intergenic
1104814323 12:131637232-131637254 AGTGCCAGGAGGGGTGGGGAGGG + Intergenic
1104861855 12:131928194-131928216 AGGGAAAGCAGGAGACAGGAGGG + Intergenic
1104862177 12:131929506-131929528 GGGGTCAGCAGGAGTGAGGCTGG + Exonic
1104981009 12:132573123-132573145 AAGGCCAGGAACAGTGAGGAGGG - Intronic
1105614442 13:21999633-21999655 AGGGCCAGCAGGTGAGAAGTTGG + Intergenic
1106073167 13:26433651-26433673 AGGGCCAGGGGGTGGGAGGAGGG + Intergenic
1106304618 13:28498552-28498574 AGGCCCAGTGGGAGCGAGGAAGG + Intergenic
1106322592 13:28656013-28656035 AGAGCTAGGAGGAGGGAGGAGGG + Intergenic
1106423566 13:29604463-29604485 AGGGACAGCAGGAGTTGAGAAGG - Intergenic
1106522047 13:30506638-30506660 AGGGGCAGCTCGAGTGTGGATGG - Intronic
1106624864 13:31410259-31410281 ATGGGCAGCAGGAGAAAGGAAGG - Intergenic
1107069446 13:36254916-36254938 AGGGCCCCCAGGAGGGAGGCAGG - Intronic
1107088642 13:36452102-36452124 AGGGACAGAGGGAGGGAGGAAGG - Intergenic
1107135324 13:36938242-36938264 AGGAGCAGCAGGGGTGGGGAGGG - Intergenic
1107186583 13:37529396-37529418 ACAGCCAGGAGGAGGGAGGAAGG - Intergenic
1107458021 13:40573015-40573037 AGGGCCAGGAGGAGTCATGGAGG - Intronic
1107688415 13:42927442-42927464 AGGGCTAGCAGGAGGAGGGAGGG - Intronic
1109350521 13:61174586-61174608 AGGGCTAAGAGAAGTGAGGAAGG + Intergenic
1110263492 13:73512776-73512798 CGGGGCAGCAGGAGAGAGAATGG - Intergenic
1110268024 13:73560639-73560661 AAGACCAGCATGAGAGAGGAAGG + Intergenic
1111620218 13:90715570-90715592 GGGGCCAGCAGAAGAGAGGGAGG + Intergenic
1112141818 13:96652392-96652414 AGGAACAGAAGTAGTGAGGAAGG - Intronic
1112521235 13:100097237-100097259 AGGGCCTGGAGGAGAGGGGATGG + Intronic
1112781544 13:102905993-102906015 AGAACCATCAGGAGTGGGGATGG + Intergenic
1113405674 13:110037117-110037139 AGGGCCAGCTGCAATGATGATGG - Intergenic
1113518897 13:110924317-110924339 ATGGGCAGCAGGTGTGGGGAGGG - Intergenic
1113961777 13:114130345-114130367 AGGGGCAGCAGCAGTGAGGACGG - Intronic
1114369400 14:22069315-22069337 AGGGCCAGTAAGAGTAAAGAGGG + Intergenic
1114501381 14:23171577-23171599 AAGGCTAGCATGAGTAAGGAAGG - Intronic
1114532691 14:23405456-23405478 AGAGCCAGCTGGAGTGAACAGGG - Intronic
1115735716 14:36327113-36327135 AGGGTCTGCTGGAGGGAGGAGGG - Intergenic
1116808812 14:49519888-49519910 AAGGCCAGAAGGAGGGAGGGAGG + Intergenic
1116811809 14:49546679-49546701 AGGGCCAGGAGGAGAGGCGAAGG - Intergenic
1117648702 14:57879921-57879943 AGGGAGAGAAGGAGTGAGGTGGG + Intronic
1118029614 14:61807607-61807629 AGCCACAGCAGGAGTGAAGAGGG - Intergenic
1118090837 14:62475758-62475780 ATTGGCAGCAGGAGTGGGGAGGG - Intergenic
1118107243 14:62673857-62673879 AGGGGCAGTGGGAGTCAGGAGGG - Intergenic
1118155559 14:63237948-63237970 AGGACCAGCAGGACAGAGCAGGG - Intronic
1118776714 14:68978374-68978396 AGGACCAGCTGGAGTGCGGCTGG - Intronic
1118903451 14:70005473-70005495 AAGTCCAGCAGGAGTGGGCAGGG - Intronic
1119621545 14:76135577-76135599 ACAGGTAGCAGGAGTGAGGATGG + Intergenic
1119722647 14:76901557-76901579 GGGGCCAGGAGGAGGCAGGAGGG + Intergenic
1121087093 14:91154976-91154998 GGGGCCAGCAGGAGCAAGGCAGG - Intronic
1121553084 14:94817012-94817034 AGAGGCAGCAGCAGTGAGGTTGG - Intergenic
1121692664 14:95889141-95889163 AGGGACAGCAGGGGAGGGGAGGG - Intergenic
1121693364 14:95893445-95893467 AGAGCCATAAGGAGTGAGGGCGG - Intergenic
1122577029 14:102749227-102749249 AGCTGCAGGAGGAGTGAGGACGG - Intergenic
1122879207 14:104682476-104682498 AGGGCCAGGAGGCGGGAGGGCGG + Intergenic
1122937686 14:104967527-104967549 AGGGCCAGCAGGAGCAGGGCTGG - Intronic
1123415159 15:20089954-20089976 AGGGAGAGAAGGAGTCAGGAAGG - Intergenic
1123524501 15:21097068-21097090 AGGGAGAGAAGGAGTCAGGAAGG - Intergenic
1123923035 15:25084009-25084031 AGGGCAGGCAGTCGTGAGGAGGG + Intergenic
1124035648 15:26051598-26051620 AGGGAAAGCAGGAGGAAGGAAGG - Intergenic
1124160999 15:27269776-27269798 TGGGTCAGCAGGAGTGGTGATGG + Intronic
1124356256 15:28996910-28996932 AAGACCAGCAGGGGTGAGGACGG + Intronic
1124366158 15:29072805-29072827 AGGGGCAGCAGGACTGGGGGAGG + Intronic
1124635097 15:31360226-31360248 AGGGCCAGCAGGATACAGGGAGG + Intronic
1125550607 15:40541726-40541748 GGGGTGAGCAGGAGTGAGGGAGG - Intronic
1125734886 15:41917974-41917996 AGGGGCAGCAGCAGCCAGGACGG + Intronic
1128670988 15:69574656-69574678 AGGGCCCACAGGAGTGAGCGAGG + Intergenic
1129165622 15:73775506-73775528 AGGGCCAGTGGCAGTGAGGTGGG + Intergenic
1129248033 15:74291871-74291893 AGTGCTGGGAGGAGTGAGGAAGG + Intronic
1129264424 15:74386303-74386325 AGGGCAACAAGGAGGGAGGAAGG + Intergenic
1129288268 15:74542829-74542851 AGGGCCTGCAGGGGAGAGGTGGG + Intronic
1129300206 15:74621061-74621083 AAGGCCGGCAGGAGGGAGGCAGG - Intronic
1129465243 15:75721170-75721192 AGGGGCAGCATGAGTGAGGCAGG + Intergenic
1129889048 15:79059065-79059087 AGGGACAGAAGGAGGGAGGGAGG - Intronic
1129976325 15:79825003-79825025 GGAGCCAGCAGGGGTGAGAAAGG + Intergenic
1129976478 15:79826467-79826489 GGAGCCAGCAGGGGTGAGAAAGG + Intergenic
1130569052 15:85024089-85024111 AGGGCCAGCAGGAGTTAGCCAGG - Intronic
1130684771 15:86027340-86027362 AGGGACAGATGGAGGGAGGAAGG - Intergenic
1130899499 15:88196442-88196464 AGGGGCTGCAGGAGGGAGGCAGG + Intronic
1130923534 15:88368503-88368525 AGGTGCAGCAGGAGTGAACAGGG - Intergenic
1131145647 15:90009832-90009854 AGAGCCAGCTGGAGTGAGAGTGG - Intronic
1131215400 15:90530981-90531003 GGGGTCAGCAGGAGTGGGGCTGG + Intronic
1131249373 15:90820429-90820451 TGGGCCAGCAGGAGTTGGGGAGG + Intergenic
1131261305 15:90889451-90889473 GGGCCCAGCAGGAGCAAGGACGG - Intronic
1131457872 15:92597343-92597365 AGGGAGAGCAGGAGGGAGGTGGG + Intergenic
1131540033 15:93268165-93268187 AGGATGAGCAGGAGTGAGGAAGG + Intergenic
1131804745 15:96109686-96109708 AGGGCCAGCACCAGTGGGTAAGG + Intergenic
1132694694 16:1196654-1196676 TTGGCCAGCAGGTGTGAGGAGGG + Intronic
1132700142 16:1218781-1218803 GGGGCAGGCAGGAGGGAGGATGG + Intronic
1132714476 16:1283948-1283970 ATGGCCTGCAGGAGTGGGGAAGG + Intergenic
1132746496 16:1438445-1438467 AGGCCCCACAGGAGGGAGGAGGG + Intronic
1132850245 16:2021776-2021798 AGAGGCAGCGGGAGGGAGGAGGG - Intergenic
1133109101 16:3535064-3535086 AGGGGCGTCAGCAGTGAGGAAGG + Intronic
1133341332 16:5038350-5038372 TGGGCAAGTAGGTGTGAGGAGGG + Intronic
1133349849 16:5094112-5094134 TGGTGCAGCAGGAGTGGGGACGG + Intronic
1133481197 16:6172324-6172346 AGGGAAAGCAGGAATGAGTAAGG + Intronic
1134661726 16:15989339-15989361 AGGGCCATGAGGTGAGAGGAAGG - Intronic
1135175119 16:20221119-20221141 AGGGCAGGCAGGAGGGAGGAAGG + Intergenic
1135477104 16:22786332-22786354 GCCGCCAGCAAGAGTGAGGATGG - Intergenic
1135637936 16:24094942-24094964 AGGGACAGAAGGAGGGAGGGAGG + Intronic
1135842823 16:25892272-25892294 GGCCCCTGCAGGAGTGAGGAGGG + Intronic
1137351732 16:47719216-47719238 AGGGCCATGTGGAGTGAGGGAGG - Intergenic
1137572284 16:49574736-49574758 AGGGAAAGCAGGAGGGAGCAGGG - Intronic
1138113960 16:54345458-54345480 AGGGCCTGCAGGAGGCAGGCAGG + Intergenic
1138534307 16:57651853-57651875 TGGGCAGGCAGGGGTGAGGATGG + Intronic
1138596829 16:58033527-58033549 TGGGCCACCAGGAGTCAGAAGGG - Intronic
1139270634 16:65679641-65679663 AGGGGGAGCAGTGGTGAGGAGGG - Intergenic
1139507611 16:67407022-67407044 GGGGCCAGCACATGTGAGGAAGG + Intronic
1139943116 16:70620419-70620441 AGCCCCACCAGGTGTGAGGAGGG + Intronic
1139957892 16:70701787-70701809 AGGGACAGCAAGAGGGAGGCTGG - Intronic
1139991487 16:70943167-70943189 AAGATCAGCAGGATTGAGGAGGG - Intronic
1139991752 16:70945231-70945253 AGGGCCAGTAGGACTTCGGATGG + Intronic
1140037796 16:71384271-71384293 AGGGCAAGCGGGAGAGGGGAAGG - Intronic
1140219975 16:73036629-73036651 GGGGCCGGCAGGAGAGAGGGAGG + Intronic
1140357038 16:74315278-74315300 AGGGGCAGCAGGAATGCAGAAGG - Intergenic
1140627981 16:76817831-76817853 AGGGCGGGCAGAAGTGGGGAGGG - Intergenic
1140941088 16:79722681-79722703 AGGGCCAGAAGTAGTGATGGTGG + Intergenic
1141151331 16:81566366-81566388 AGGAACAGCAGCAGTGAGGGAGG - Intronic
1141291900 16:82725738-82725760 AGAGCCAAAAGGAATGAGGATGG - Intronic
1141336263 16:83158287-83158309 AGAGGCAGCAGGGGTGGGGAGGG - Intronic
1141372442 16:83500480-83500502 AGGGGGAGGAGGAGGGAGGAAGG - Intronic
1141461348 16:84180256-84180278 CGGGCCAGCAGGAGCGGGGAGGG + Exonic
1141461723 16:84181851-84181873 ACGGCCAGCAGAGCTGAGGAGGG + Exonic
1141691436 16:85598970-85598992 AGGGGGAGTAGGAGAGAGGAGGG - Intergenic
1141929488 16:87192442-87192464 AGGGCCAGCAGCCGCGATGAGGG + Intronic
1142482849 17:229420-229442 AGGGCCAGCTGGGGTCAGCAAGG + Intronic
1143151045 17:4807696-4807718 AGGACCTGCGGGAGTTAGGATGG + Intronic
1143504560 17:7356533-7356555 AGGGACAGAGGGAGGGAGGATGG - Intronic
1143542598 17:7578537-7578559 AGGAGCAGCAGGAGGGGGGAGGG + Exonic
1144365623 17:14541775-14541797 AGAGGGAGAAGGAGTGAGGAAGG - Intergenic
1146546446 17:33742856-33742878 AGAGCCAGCAGGATTCAGCATGG - Intronic
1146603848 17:34241177-34241199 AGGGCCAGCTGGAGTCAGCGGGG + Intergenic
1147169841 17:38611527-38611549 AGGGGAAGCAGGAGGGAGGGAGG + Intergenic
1147400281 17:40176912-40176934 AGGTCTAGCTGGGGTGAGGAGGG - Intergenic
1147588434 17:41666229-41666251 AGGGGGAGCAGGAGAGAGGAAGG - Intergenic
1147767526 17:42846586-42846608 AGGGTCAGTAGGGGTGGGGAGGG + Intronic
1148052911 17:44777916-44777938 AGGGCCAGGAGAGGTGAGCAGGG - Intronic
1148180675 17:45602404-45602426 AGGGAAAGAAGGAGGGAGGAAGG - Intergenic
1148268228 17:46243520-46243542 AGGGAAAGAAGGAGGGAGGAAGG + Intergenic
1148546905 17:48526171-48526193 AGTGCAAGTAGGAGAGAGGAAGG + Intergenic
1148546935 17:48526354-48526376 AGGGCCAGGAGGAAAGAAGAAGG - Intergenic
1148694461 17:49550541-49550563 AAGGCCCACAGGACTGAGGACGG - Intergenic
1148770385 17:50062882-50062904 AGGGCCATCAGGATTGAGCAGGG + Intronic
1148846668 17:50533751-50533773 AGGGCCAGCAGGCGGTGGGATGG - Intronic
1148864726 17:50622580-50622602 AGCCCCAGCAGGCCTGAGGATGG - Intronic
1149550359 17:57535088-57535110 ACAGCCAGCGGGAGGGAGGAAGG + Intronic
1149729549 17:58931417-58931439 AGGGAGAGAAGGAGGGAGGAAGG + Intronic
1151418658 17:73983459-73983481 AGTGCTACCAGGAGTGGGGATGG + Intergenic
1151436085 17:74098277-74098299 TGGGTCAGCAGGTGTGAGGGAGG - Intergenic
1151522806 17:74642501-74642523 GGTGCCAGCAGGAGAAAGGAAGG - Intergenic
1151749570 17:76028799-76028821 AGGGGCAGTAGGGGTGGGGAGGG + Intergenic
1151756932 17:76080438-76080460 AGGGGCTGCAGGGTTGAGGAGGG + Intronic
1152021196 17:77781220-77781242 GGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152021244 17:77781354-77781376 AGGGCCTGCTGGAGTGGGGGGGG - Intergenic
1152021253 17:77781373-77781395 AGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152021290 17:77781466-77781488 GGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152021305 17:77781503-77781525 GGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152027963 17:77823965-77823987 AGGGACAGCAGGAGTGGGGAAGG + Intergenic
1152161538 17:78671395-78671417 AGAGCCAAGAGGAGAGAGGAGGG + Intergenic
1152169563 17:78735358-78735380 TGGGACAGCAGGAGTGAGCCGGG - Intronic
1152295979 17:79467153-79467175 CGTGCCACCAGGTGTGAGGAGGG - Intronic
1152320447 17:79606080-79606102 AGGGGCAGCAGCAGTGAGAAGGG + Intergenic
1152794718 17:82301371-82301393 AGGGCCAGGAGGGGTGAGCTGGG + Intergenic
1153143150 18:1998072-1998094 AGAGCTGGGAGGAGTGAGGAGGG + Intergenic
1154050674 18:10953826-10953848 AGGGGCAGCAAGAGAGAGGCAGG + Intronic
1154175291 18:12083699-12083721 ATTGCCGGCAGCAGTGAGGAGGG + Intergenic
1155204037 18:23542138-23542160 TGGGACAGTAGGAGTGAGTAGGG - Intronic
1155331906 18:24727461-24727483 AGAGCCTGCAGGTGTGAGAATGG - Intergenic
1155988426 18:32254827-32254849 GGGAGGAGCAGGAGTGAGGATGG - Intronic
1156317533 18:35984550-35984572 AGGGGCTGAAGGAGTGAAGATGG - Intronic
1156449959 18:37261265-37261287 AGGGCCTGGAAGAGTGAGGATGG - Intronic
1156498824 18:37544001-37544023 GGGGGAAGCAGGAGTGAAGAGGG + Intronic
1157391864 18:47309830-47309852 GGGGCCAGGAGGAGGCAGGATGG - Intergenic
1157410707 18:47460624-47460646 AGGGTCAGTAGAAGTGAGCATGG + Intergenic
1157554664 18:48605686-48605708 TGGGACAGCTGCAGTGAGGAAGG - Intronic
1157556557 18:48616472-48616494 CAGGCCACCAGGAGTGGGGATGG + Intronic
1157565769 18:48678325-48678347 TGGGCCAGCAGGGATGGGGAAGG - Intronic
1158406596 18:57165464-57165486 AGGGGCAGCTGGATGGAGGAGGG - Intergenic
1158528198 18:58234311-58234333 AGGGAGAGAAGGAGGGAGGAAGG - Intronic
1158841705 18:61394867-61394889 AGGCCAAGCAGGAGGGTGGATGG - Intronic
1159005149 18:63004529-63004551 TGGGCCAGAGGGAGTGAGGCAGG + Intergenic
1159379813 18:67642345-67642367 AGAGCTAAGAGGAGTGAGGATGG + Intergenic
1159436764 18:68428256-68428278 ATGACCAGCAACAGTGAGGAGGG - Intergenic
1160006931 18:75074884-75074906 CGGGCCAGGAGGAGTGAGGGTGG + Intergenic
1160155800 18:76432928-76432950 AGGGCCAGAAGAAGGGAAGAAGG + Intronic
1160589621 18:79936036-79936058 ATGGCCAGCAGGAAGGAGGCTGG + Intronic
1160698825 19:496852-496874 AGGGGGCGCAGGAGAGAGGAGGG + Intronic
1160699024 19:497416-497438 AGGGGGCGCAGGAGAGAGGAGGG + Intronic
1160764865 19:803093-803115 GAGGCCACCAGAAGTGAGGACGG + Intronic
1160880221 19:1316246-1316268 AGGGGCAGCAGAGGTGAGGACGG - Intergenic
1161381087 19:3965218-3965240 ATGCCCAGCAGGTGTGTGGAGGG + Intronic
1161403991 19:4081763-4081785 AGGGGGAGTAGGAGGGAGGAAGG - Intergenic
1161978164 19:7617492-7617514 GGGGGCAGCAGGAATGAGCAGGG - Intronic
1162096305 19:8311913-8311935 AGGGGCAGCAGGAATGGGGGTGG - Intronic
1162128725 19:8512744-8512766 AGGGACAGCACTAGTGAGGAAGG - Intronic
1162413712 19:10521272-10521294 AAGGGCAGGGGGAGTGAGGAGGG - Intergenic
1162841728 19:13361726-13361748 AAGTCCAGCATAAGTGAGGAAGG - Intronic
1162897982 19:13776765-13776787 AGAGGAAACAGGAGTGAGGAGGG - Intronic
1162968548 19:14167157-14167179 TGGGGAAGCAGGAGCGAGGAAGG - Intronic
1163119247 19:15206739-15206761 AGGGCCTGGAGGAGGGAGAATGG - Intergenic
1163549368 19:17957104-17957126 AGGGACAGAGGGAGGGAGGAAGG + Intronic
1163809431 19:19421359-19421381 CAGGCCAGAAGGGGTGAGGAGGG - Intronic
1164450849 19:28363112-28363134 AGGGACAGCAGGTGTGAGTGTGG + Intergenic
1164537210 19:29094769-29094791 AGGGACAGCATGAGTGAAGCGGG - Intergenic
1164731026 19:30504507-30504529 GGGGGCAGGAGGAGGGAGGAAGG - Intronic
1165052113 19:33148268-33148290 AGGGACGGCAGGGGTGAGGCAGG - Intronic
1165323370 19:35099826-35099848 AGGGCCTGCAGGCATGAGGGTGG - Intergenic
1165827506 19:38713710-38713732 AGGAACAGAAAGAGTGAGGAGGG - Intronic
1166406967 19:42528371-42528393 AGGGCCAGCAGGAGACACCATGG - Exonic
1166750624 19:45162543-45162565 ACGGGCAGCAGGAGTGCGTAGGG + Intronic
1166880926 19:45929488-45929510 AGGGACAGAGGGAGGGAGGATGG + Intergenic
1167075338 19:47245036-47245058 AGGGCCGTCAGGAGTGTTGAGGG + Intergenic
1167148318 19:47695259-47695281 AGGGCCAGGAGGAGAGCGGTGGG + Intronic
1167357084 19:49010773-49010795 AGCACCAGCAGGGGTGGGGACGG - Intronic
925289892 2:2740451-2740473 AGGACCTGCTGGAGTGAGGGAGG + Intergenic
925384612 2:3453410-3453432 AGGGGCAGAAGGACTGTGGAGGG - Intronic
926439746 2:12875430-12875452 AGCGCCAGCAGGAGAGTAGAGGG + Intergenic
926571403 2:14534263-14534285 GGGGCCAGGAGGAGTTAGGACGG - Intergenic
926690711 2:15731383-15731405 AGGGCCCACAGGAGTCAGGCAGG - Intronic
927150717 2:20194248-20194270 AGGGTCAGGAGGTGTGAGGAGGG - Intergenic
927911387 2:26902169-26902191 AGGGGGAGAGGGAGTGAGGAGGG + Intronic
928531800 2:32200161-32200183 AGGGACAGCAGCAATGAGAATGG - Intronic
929551740 2:42897680-42897702 AGGCCAAGCAGGATGGAGGAGGG - Intergenic
929633987 2:43497525-43497547 AGGGCCTGTTGGAGTCAGGAAGG + Intronic
930857997 2:56039663-56039685 AGGACCAGCAGAAGTGAAAATGG + Intergenic
931131211 2:59338365-59338387 AGGGGAGGGAGGAGTGAGGAAGG - Intergenic
931621441 2:64214018-64214040 AGGGGCAGCACGGGAGAGGAAGG + Intergenic
932413293 2:71559693-71559715 AGGGCCAGCAGGCGTTAGTAAGG - Intronic
932923302 2:75941954-75941976 TGGGCCTGCAGGTGTGCGGAAGG + Intergenic
932983181 2:76695157-76695179 ATGGCCAGCAGAACTGAGAATGG - Intergenic
933242655 2:79940475-79940497 AGGGATAGAAGAAGTGAGGATGG - Intronic
936011929 2:108930462-108930484 TTGGCCAGCAGGGGTGAGGCAGG - Intronic
936050449 2:109218660-109218682 CCGGCCAGCAGGAGTGAGGGAGG + Intronic
936671618 2:114662792-114662814 TGGGCCACCAGGAGCGAGGCAGG + Intronic
937286608 2:120758094-120758116 GTGGCCAGCGGGTGTGAGGAGGG + Intronic
937308178 2:120884944-120884966 GGGGAAAGCAGGAGTGAGGCCGG - Intronic
937372008 2:121304986-121305008 AGAGCCAGTGGGAGTGAGCAAGG - Intergenic
937438395 2:121897495-121897517 GGTGCCAACAGGAGTGAGGCAGG - Intergenic
937856910 2:126678847-126678869 AGGGGCGGCAGGAGGCAGGAGGG - Intronic
937985899 2:127637978-127638000 AAGGACAGAAGGTGTGAGGAGGG - Intergenic
938228365 2:129636892-129636914 AGGGCCAGCAGGGGACAGGCCGG - Intergenic
939649180 2:144740832-144740854 ATGGCCAGGAGGAGAGAGGCTGG + Intergenic
942143490 2:173001739-173001761 AGGGGGAGCAGGAGCGAGGTGGG + Intronic
943209542 2:184945517-184945539 AGTGCCAACAGGAGCTAGGAAGG - Intergenic
943395144 2:187324366-187324388 AGGTCCAGAAGCAGAGAGGATGG + Intergenic
944419802 2:199517578-199517600 TGGGACAGTAGGGGTGAGGATGG - Intergenic
945221810 2:207491138-207491160 AGGGACAGAAGGACTGGGGAGGG - Intergenic
946898280 2:224346693-224346715 AGGGCTGGCATGAGAGAGGAAGG + Intergenic
947066955 2:226237811-226237833 AGGGGGAGCAGGAGGAAGGATGG + Intergenic
947187918 2:227471745-227471767 AGGTCCTGCAGGAGTCAGAAAGG + Intergenic
948027482 2:234789580-234789602 AGGGCCAGCTGGAGTCAGATGGG + Intergenic
948102433 2:235385426-235385448 AAGTCCAGCAGCAGTGAGCAAGG + Intergenic
948372821 2:237501051-237501073 ACGGTGAGCAGGGGTGAGGAGGG - Intronic
948424442 2:237878287-237878309 AGGGCCAGGGGCAGGGAGGAGGG + Intronic
948456280 2:238106042-238106064 GAGGAAAGCAGGAGTGAGGATGG - Intronic
948461976 2:238134214-238134236 AGGGACAGCCGGAGCCAGGAGGG - Intergenic
948594966 2:239073949-239073971 ATGGGCAGCAGGACTGAGGGGGG + Intronic
948701767 2:239765108-239765130 GGAGCCTGCAGAAGTGAGGAGGG - Intronic
948712299 2:239832807-239832829 AGAGCCTGCAGGAGTGAGTGGGG + Intergenic
949000565 2:241610581-241610603 TGGGGAAGCAGGAGTGGGGAGGG - Intronic
1168739275 20:174267-174289 AGGGCTAGCAGGTGTGAGGAGGG - Intergenic
1168796293 20:611995-612017 AGGGTCAGAAGCAGAGAGGAGGG - Intergenic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1170757320 20:19215572-19215594 AGGGCCAACAGAAGGAAGGAGGG - Intronic
1170827706 20:19810450-19810472 AGGGCCCCCAGGAGGGAGGTGGG + Intergenic
1170973023 20:21134138-21134160 CGGGCCAGGAGGCGTGAGGTGGG + Intronic
1171463069 20:25309656-25309678 AGGGCCAGGAGGAGACAGGGAGG + Intronic
1171573758 20:26277954-26277976 AGGCACAGCAAGAGGGAGGATGG - Intergenic
1172126272 20:32627017-32627039 AGGGGAAGCAGGTGTCAGGAGGG - Intergenic
1172646286 20:36472138-36472160 AGTGGCAGCAGGGATGAGGAAGG + Intronic
1173040356 20:39456321-39456343 AGGGGAAGCAGGGATGAGGATGG - Intergenic
1173621060 20:44436331-44436353 AGGCTCAGGAGGAGAGAGGAAGG + Intergenic
1173642514 20:44613908-44613930 AGAGCCAGCAGGCGGGAGCATGG - Intronic
1173649473 20:44653751-44653773 GGGGCCAGCGGGGGTGAGGGAGG + Intergenic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173915502 20:46705376-46705398 AAGTTTAGCAGGAGTGAGGAGGG - Intergenic
1173970665 20:47149909-47149931 AGATGCAGCAGGACTGAGGAGGG + Intronic
1174037341 20:47676439-47676461 AGGGCCGGCTGCAGTCAGGAGGG + Intronic
1174110007 20:48192387-48192409 GGGGTCAGCAGGAGTCAGGTGGG + Intergenic
1174391502 20:50220866-50220888 GGGGCCAGGAGGGGTGAGGGTGG + Intergenic
1175130073 20:56782257-56782279 AGGGAAAGAAGGAGGGAGGAAGG + Intergenic
1175222938 20:57427752-57427774 AAGGCCAGGAGGAGTGACAAGGG - Intergenic
1175302348 20:57951792-57951814 TGGGCAAGCAGGGGTGAGCATGG - Intergenic
1175418686 20:58817752-58817774 AGGGCTGGGAGGATTGAGGAGGG - Intergenic
1175572875 20:60037316-60037338 AGGGACAGCAGGAGGGAGCCTGG + Intergenic
1175789702 20:61733495-61733517 AGGGACAGCAGGGGAGATGAGGG - Intronic
1175863294 20:62161547-62161569 TGGCCCTGCAGGAGGGAGGAGGG - Exonic
1176235930 20:64053563-64053585 AGGGCCAGCAGGACCGAGAGGGG + Intronic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1177880310 21:26686535-26686557 TGGGGCAGTAGGAGTGAGGAGGG + Intergenic
1178362536 21:31961096-31961118 AGGGAGAGCAGGAGGAAGGAAGG - Intronic
1178597565 21:33968451-33968473 AAAGCCAGCAGAAGTGATGAGGG - Intergenic
1178909652 21:36664291-36664313 AGAAGCAGCAGGAGTGAGGAGGG + Intergenic
1179183317 21:39063059-39063081 GGTGCCAGCAGCAGTGGGGAAGG + Intergenic
1179262055 21:39766019-39766041 AGGGAGAGCATGAGGGAGGAAGG - Intronic
1179344489 21:40544105-40544127 AGCATCAGCAGGAGTCAGGAGGG + Intronic
1179590281 21:42403571-42403593 GGGGCCAGCAGGATCCAGGAGGG + Intergenic
1179822188 21:43943408-43943430 TGGGACGGCAGGAGGGAGGAAGG - Intronic
1180155929 21:45977447-45977469 AGGGCCGGCAGGCCTGAGAAAGG + Intergenic
1180954662 22:19736290-19736312 AGGGACAGCAGGTGTGGGGGTGG + Intergenic
1181012956 22:20052926-20052948 AGAGACAGGAAGAGTGAGGAGGG + Intronic
1181119855 22:20658390-20658412 AGGGCGAGCGGGAAGGAGGAAGG + Intergenic
1181461531 22:23088809-23088831 AGGGCCAGCAAGGGAGAGCAAGG - Intronic
1182055624 22:27352375-27352397 AGAGCCAGGAGGAGACAGGATGG - Intergenic
1182093026 22:27608962-27608984 ATGGCTAGGAGGAGAGAGGAGGG + Intergenic
1182285263 22:29243408-29243430 AGAGATAGCAGCAGTGAGGAAGG - Intronic
1182544940 22:31069594-31069616 AGGGAGAGAAGGAGTCAGGAAGG + Intronic
1182556988 22:31134481-31134503 AGGAGCAGCAGGAGAGAGGCAGG - Exonic
1182872657 22:33662353-33662375 AGCCCCAGCATCAGTGAGGATGG + Intronic
1182931468 22:34178288-34178310 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1183186846 22:36296774-36296796 AGGGCCAGCAGCAAGCAGGAAGG + Intronic
1183320956 22:37164748-37164770 AGGGCCACCAGGAATGCAGAGGG + Intronic
1183363261 22:37393966-37393988 AGAGCCAGCAGGAGTGATGCTGG - Intronic
1183368160 22:37417978-37418000 GGGGACAGCAGGAGGGAGGGAGG + Intronic
1183577476 22:38701023-38701045 ACGGCTGGGAGGAGTGAGGACGG - Intronic
1183654616 22:39177379-39177401 CGAGCCAGCAGGAGAGGGGAGGG - Intergenic
1184242770 22:43220155-43220177 GGTCCCAGCAGGAGTGTGGAGGG + Intronic
1184411287 22:44327825-44327847 TGAGCCAGGATGAGTGAGGAGGG - Intergenic
1184549567 22:45197219-45197241 AGGGCCGGCAGGAGGGAAGCAGG + Intronic
1184552511 22:45212118-45212140 AGGCCAGACAGGAGTGAGGAAGG + Intronic
1184605042 22:45567941-45567963 AGAGCCAGTGGGAGGGAGGAAGG + Intronic
1184661955 22:45969497-45969519 AGGGCCAGCGGGGGTCAGTAAGG - Intronic
1184732494 22:46378478-46378500 AGGCTCAGCAGGTTTGAGGACGG + Intronic
1184893259 22:47392142-47392164 AGGGCAGGGAGGAGAGAGGAAGG - Intergenic
1184895248 22:47402897-47402919 AGGGTCTGCAGGAGGCAGGAAGG + Intergenic
1185002476 22:48254289-48254311 CTGGCCAGAAGGAGTGAGGGAGG + Intergenic
1185079895 22:48703836-48703858 TGGGCCAGCAGGAGTGGGGTTGG - Intronic
1185224980 22:49647190-49647212 AGGGCATGCAGGTGGGAGGATGG - Intronic
949850933 3:8419593-8419615 AGGACAAGTAGGAGTTAGGAAGG + Intergenic
950327170 3:12121695-12121717 AGGGCAGGGAGGAGGGAGGAAGG + Intronic
950437866 3:12991549-12991571 AGGGGCAGGGGGAGTGATGAGGG + Intronic
950514803 3:13457747-13457769 AGGGGCTGGAGGAGTGAGGATGG + Intergenic
950572606 3:13811367-13811389 AGGCCCAGCAGGTGCCAGGAGGG - Intergenic
951060750 3:18204254-18204276 TGGGGTGGCAGGAGTGAGGATGG - Intronic
951240973 3:20285840-20285862 AGGAACAGCAGGAGTGAGTGGGG + Intergenic
951585890 3:24214258-24214280 AGGGCTAGCTGGAGTCAAGATGG + Intronic
951866669 3:27316263-27316285 AGTGACAGCAGGAGTAAGAATGG + Intronic
953263104 3:41359155-41359177 AAGGCGAACAGGAGTGAGGGAGG + Intronic
953366675 3:42351300-42351322 AGAGCCAGCAGGGAGGAGGAGGG + Intergenic
953373184 3:42407067-42407089 AGGGCAAGGAGGTGAGAGGAGGG + Intronic
953450789 3:43004130-43004152 AGTGGCAGAATGAGTGAGGAAGG + Intronic
954006431 3:47594932-47594954 AGTGGCAGCAGGAGTCAGGATGG - Intronic
954145313 3:48631544-48631566 AGGGCCAGCTGGAGGGGGGCTGG - Intronic
954147888 3:48643230-48643252 AAGGTCAGCAGGGGAGAGGATGG + Intronic
954266180 3:49471946-49471968 AGGGCCAGCAGGAATTAGTGGGG + Intronic
954638285 3:52083474-52083496 GTGGCCAGCAGGAGAAAGGAGGG - Intronic
954712662 3:52512786-52512808 AGGGGCGGGAGGAGCGAGGAAGG - Intronic
954871303 3:53769399-53769421 AGGGCGAGGAGGAGAGAGGCAGG - Intronic
955558511 3:60163570-60163592 AGGGTGAGCAGGAGTCAGCAAGG - Intronic
959010043 3:101064716-101064738 TGGGCCAGCAGAAGAGAAGAAGG - Intergenic
960059601 3:113307465-113307487 AGGGAGTGCAGGAGTGGGGATGG - Intronic
960628301 3:119702894-119702916 AGGGTCAGGAGGAGAGTGGAGGG - Intergenic
960757492 3:121032136-121032158 TGGCCCAGGAGGAGTGAGTAAGG + Intronic
960899460 3:122540363-122540385 AGAGACAGAAGGAGAGAGGAGGG - Intronic
960906101 3:122603174-122603196 AGGGCCACCAGGAGTGGTGCTGG - Intronic
960997662 3:123350540-123350562 AGGGCCAGGAGGGGTGGGCAGGG + Intronic
961300688 3:125920251-125920273 TGGTGCAGCAGGAGTGGGGACGG - Intergenic
961359599 3:126358466-126358488 AGTGCCAGGAGGGGAGAGGAAGG - Intergenic
961568128 3:127778354-127778376 AAGACCAGCAGGACTGAGGCTGG - Intronic
961723921 3:128913447-128913469 AGTGCCAGCAGAAGGGAGGCTGG - Intronic
961733339 3:128983948-128983970 CAGGCCGGCAGGAGAGAGGAGGG + Intronic
961887812 3:130107837-130107859 TGGTGCAGCAGGAGTGGGGACGG + Intronic
962248443 3:133819011-133819033 AGGGCCAGCAGGTGGCAGTAAGG + Intronic
962258416 3:133887475-133887497 AGGGGCTGCAGGAGTGAGATGGG - Intronic
963103065 3:141623815-141623837 AGGCCCTGCTGGAGGGAGGAAGG - Intergenic
963363700 3:144307870-144307892 AGGGTCAGTAGGAATGAGGAGGG + Intergenic
964237999 3:154556958-154556980 AGGGCCAGGAGGACTTAGCAAGG + Intergenic
964392453 3:156211953-156211975 AGGGCCAGAAGGGGTGATGCTGG + Intronic
964555795 3:157936613-157936635 AGGGACAGCTGGAATGTGGAGGG - Intergenic
964762807 3:160150576-160150598 AGGGCAAACAGGAGTGGGAAAGG + Intergenic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
965394214 3:168142585-168142607 AGAGCCCACAGGAATGAGGATGG + Intergenic
965759069 3:172055691-172055713 AGGGGCAGTGGGAGTGAGTAGGG + Intronic
965772308 3:172193606-172193628 AAGTCCAGCAGTAGTGGGGATGG - Intronic
965793558 3:172414286-172414308 AAGGCCAGAAGGATGGAGGATGG + Intergenic
966164847 3:177006117-177006139 ACAGACAGCAGGAGTGAGGGAGG + Intergenic
966184315 3:177214464-177214486 AAGGCCAGGAGGTGAGAGGAAGG + Intergenic
966280255 3:178217862-178217884 ATGATCAGCAGGAGTGAGAAAGG + Intergenic
966317517 3:178664724-178664746 AGGGAGAGAAGGAGGGAGGAAGG + Intronic
966914785 3:184578638-184578660 GGGGCTAGCAGGAGTGAGTAGGG - Intronic
967039093 3:185672931-185672953 AGGGTTAGCAGGAGTGAGGCTGG - Intronic
967448767 3:189598289-189598311 AGGGACAGCAGGAGAGGGGAGGG + Intergenic
967811627 3:193765759-193765781 AGGGGCAGCCACAGTGAGGAGGG + Intergenic
967894698 3:194386416-194386438 AGGGACAGAAGGAGGCAGGAGGG - Intergenic
968047274 3:195631389-195631411 AGGGTTGGCAGGAGTGAGGCAGG - Intergenic
968073369 3:195801979-195802001 AGGGGCAGCAGGAGAGGGAAAGG - Intronic
968307339 3:197658535-197658557 AGGGTTGGCAGGAGTGAGGCAGG + Intergenic
968574366 4:1358143-1358165 CCGGCCAGCAGGAGTGAGGAAGG - Intronic
968712783 4:2131708-2131730 AGTGCCAGGAGCAGTGAGGGAGG - Intronic
968884110 4:3318143-3318165 AGGGCCAGCAGGAGGAAGCCAGG - Intronic
968964886 4:3764852-3764874 TGGGCCCGCAGGAGAGAGGGAGG - Intergenic
968996949 4:3951769-3951791 TGGTGCAGCAGGAGTGGGGACGG + Intergenic
969270290 4:6095028-6095050 AGGGACAGAGGGAGGGAGGAAGG + Intronic
969283361 4:6186378-6186400 GGGGCAAGCAGGAGTGATGGAGG + Intronic
969422805 4:7107227-7107249 AGGGCCAGCAGGAATCCAGATGG - Intergenic
969489399 4:7490574-7490596 AGGACCGGCAGGGGTGAGGATGG + Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969699853 4:8762078-8762100 GGGCCCAGCAGGGGTGAGGCGGG + Intergenic
969853421 4:9979933-9979955 AGGGTAAGCAGGAGTTAGGCAGG - Intronic
970406901 4:15772761-15772783 AGGGTCAGTAGGAGTCAGCAGGG + Intergenic
971473452 4:27050920-27050942 AGGGCCAGGAACAGTGTGGATGG - Intergenic
973113639 4:46427575-46427597 AGGGAAAGGAGGAGGGAGGAAGG - Intronic
973218725 4:47700887-47700909 AGGGAAAGCAGCATTGAGGAGGG - Intronic
974020520 4:56688229-56688251 AGGGAGAGAAGGAGGGAGGAAGG + Intergenic
976598657 4:86917589-86917611 AGGGAAAGAAGGAGGGAGGAAGG + Intronic
976818512 4:89177663-89177685 AGTGCCATCAGGATTGGGGATGG + Intergenic
977888932 4:102284239-102284261 AGGGTGAGCAGGAGGGAAGAGGG - Intronic
977979239 4:103303380-103303402 AGGGCTAGCAGGAGCAAGCAGGG + Intergenic
978228202 4:106364438-106364460 AGGACCAGCAGCTGTTAGGAAGG - Intergenic
978571722 4:110145226-110145248 AGGGCTGGCAGGAATGAAGAAGG + Intronic
979260183 4:118637335-118637357 AGGGGCAGCAGGAGTAAAGGAGG + Intergenic
979536561 4:121827611-121827633 AGGGAAAGAAGGAGTGAGGAAGG - Intronic
980963181 4:139496651-139496673 AGAGCCAGCAAAAGAGAGGATGG - Intronic
982653142 4:158112425-158112447 AGGGTCAGCATCAGTGAGAAAGG + Intergenic
982785989 4:159537518-159537540 AGGGCCAGTGGAAGTGGGGAGGG + Intergenic
983861082 4:172707914-172707936 AGGTCCAGCAGGGGTGGGGTTGG + Intronic
983998479 4:174213865-174213887 GGGGCCAGGGGGTGTGAGGACGG - Intergenic
984473007 4:180200960-180200982 AGGGGGAGCAGGACTGAGCATGG - Intergenic
984474048 4:180215172-180215194 AGGGCCACCAGGAGGGAAGCTGG - Intergenic
984575836 4:181447084-181447106 AGGAACACCAGGAGTGAGGAAGG + Intergenic
984834998 4:184011111-184011133 AGCGTCAGCAGGAGTCAGGAGGG + Exonic
985267976 4:188167642-188167664 TGGCCCAGGAGGAGAGAGGATGG + Intergenic
985359896 4:189162387-189162409 GGGGGCAGCAGGAGTGAGGTTGG + Intergenic
985711265 5:1431280-1431302 AGGGCCAGCAGGAGCTGGCACGG + Intronic
985744334 5:1637775-1637797 AGGGTCGGTAGGAGTGAGGCAGG + Intergenic
985888734 5:2699761-2699783 AGCTCCAGCTGGGGTGAGGAAGG + Intergenic
986099840 5:4597219-4597241 AGGACAAGCAGGAGTGAGCATGG - Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
987092925 5:14523437-14523459 AGCACCAGCAGGAGGAAGGAGGG - Intronic
988893357 5:35644698-35644720 AGAGTCAGCAAGAGTCAGGATGG - Intronic
989151359 5:38302902-38302924 ATAGCCAGGAGTAGTGAGGATGG - Intronic
989216316 5:38907985-38908007 AGTGTCAGCAGGAGTGGGGGTGG - Intronic
989513828 5:42319123-42319145 AGGGACGGAAGGAGGGAGGAAGG + Intergenic
990028206 5:51222241-51222263 ATTGCAATCAGGAGTGAGGATGG - Intergenic
990337998 5:54794009-54794031 AGGGCCACCGGGAGTCAGGATGG + Intergenic
990722887 5:58717790-58717812 AGAGACAGCAGGGTTGAGGAAGG - Intronic
992168285 5:74076572-74076594 TGGGCCAGCAGCTGAGAGGAAGG + Intergenic
992375026 5:76180669-76180691 CGGGCCAGGAGGAATGACGAAGG - Intronic
992401156 5:76413002-76413024 AGGGGCAGCAGTAATGAGGGGGG - Intronic
992460444 5:76954624-76954646 TGGACCAGCAGGAGCGAGGCGGG - Intronic
992744217 5:79803525-79803547 AGAGCCTGCAGGAGTGAGGAAGG - Intergenic
993278277 5:85890724-85890746 AGGGACAGAAGAAGTGTGGAAGG + Intergenic
993515393 5:88827239-88827261 AGGGCAAGAAAGAGTGAGGGAGG - Intronic
993961045 5:94296697-94296719 AGGGCAAGCAGAAGTGGGGAGGG - Intronic
994927441 5:106135833-106135855 AGGGAAAGAAGGAGGGAGGAAGG - Intergenic
996624521 5:125554081-125554103 AGGGTCATTGGGAGTGAGGATGG - Intergenic
996735640 5:126755817-126755839 AGGGGCGGCAGGAGAGAGAAGGG - Intergenic
997174699 5:131763026-131763048 AGTGGCAGGGGGAGTGAGGATGG + Intronic
997206796 5:132054900-132054922 AGGCCCAGCACGGGTGAGGGCGG + Intergenic
997844965 5:137277939-137277961 AGGGCCACCAGGAGTGCTGGTGG - Intronic
998128359 5:139638828-139638850 AGGGCCAGGGGCAGTGAGGCAGG - Intergenic
998489577 5:142534576-142534598 AGAGCCTGCTGGTGTGAGGAGGG - Intergenic
1000353318 5:160369821-160369843 TGGGGCAGCAGCAGTGGGGATGG + Intronic
1001221516 5:169904505-169904527 AGGGCCTGAGGGAGTGAGGTGGG + Intronic
1001249528 5:170136053-170136075 AGGGCCAGCAGGAAGGAGGGGGG + Intergenic
1001446594 5:171789775-171789797 AGGCAGGGCAGGAGTGAGGATGG + Intronic
1001487226 5:172128274-172128296 TGGGCCAGAAAGAGTGAGAATGG - Intronic
1001525660 5:172426810-172426832 AGAGCCAGAGGGAGAGAGGAGGG + Intronic
1001931037 5:175673124-175673146 AGCGCCAGCAGCAGGGAGGCTGG + Intronic
1001935479 5:175700505-175700527 AGGGGCTGCAGGAGCCAGGAGGG + Intergenic
1002188351 5:177466425-177466447 AGGGGCCACAGGAGTGAGGCAGG - Intronic
1002275775 5:178103623-178103645 TGGCCCAGCAGGAGTGAGTGGGG + Intergenic
1002526056 5:179816812-179816834 AGGGCCAGCCTGAGTGCGCAAGG - Intronic
1002586788 5:180253593-180253615 AGGGCCAGCAGGAGTGAGGAAGG - Intronic
1002705625 5:181159681-181159703 AAGGGCAGCAGGAGGGAGGCTGG - Intergenic
1002710544 5:181192254-181192276 AGGCCCAGCGGGAGTGTGGCGGG + Intergenic
1002735048 5:181379098-181379120 AGGAGCAGGAGGAGTAAGGAGGG - Intergenic
1003337284 6:5185923-5185945 AGGGGAGGCAGGAGTGAGGAGGG + Intronic
1003465954 6:6380210-6380232 AGGGAGAGGAGGAGGGAGGAAGG - Intergenic
1004892680 6:20116497-20116519 AGGGACAGAAGGAAGGAGGAAGG + Intronic
1005238417 6:23793897-23793919 AGGTCCAATAGGAGTGATGAGGG - Intergenic
1005994395 6:30922592-30922614 AGGGTTTGCAGGAGAGAGGAAGG + Intronic
1006123532 6:31822268-31822290 AGGGCCGGCTGGCGAGAGGAGGG - Intergenic
1006133270 6:31881194-31881216 AGGGCTGGCAGGTGTGGGGAAGG + Intronic
1006291549 6:33141622-33141644 GGGGGCAGCAGTAGGGAGGATGG + Intergenic
1006445991 6:34080047-34080069 AGGGGCAGAATGAGTGAGGCAGG - Intronic
1006771924 6:36560928-36560950 AGGGGCATCAGGAGTGTGGATGG - Intergenic
1007273641 6:40657686-40657708 AGGGCCAGCAGGGGCCAGGCAGG - Intergenic
1007578227 6:42939511-42939533 AGGAGCAGCAGGAGAGAGGGAGG - Intergenic
1007680665 6:43631065-43631087 AGGGCCACAAGGAGGGAGGCAGG + Intronic
1008691749 6:53987050-53987072 AGGGACAGCTTGATTGAGGAGGG + Intronic
1009403692 6:63287438-63287460 AATACCAGCAGGAGTGAGGTGGG + Intronic
1010586766 6:77664508-77664530 AGCCCCACCAGGTGTGAGGAGGG + Intergenic
1010826982 6:80486393-80486415 AGTCCCACCAGGTGTGAGGAGGG + Intergenic
1010939880 6:81904320-81904342 AGGGCCTGCGTGAGTGTGGAGGG + Intergenic
1010940125 6:81906960-81906982 AGGGCCAGAAGGAGAAATGAAGG - Intergenic
1012330689 6:97982023-97982045 GGGGCCAGGAGGAGAGAAGAAGG - Intergenic
1012848916 6:104424149-104424171 AGGGCGGGCAGGAGGAAGGAAGG + Intergenic
1012848932 6:104424201-104424223 AGGGCGGGCAGGAGGAAGGAAGG + Intergenic
1012848957 6:104424285-104424307 AGGGCGGGCAGGAGGAAGGAAGG + Intergenic
1012848973 6:104424333-104424355 AGGGCGGGCAGGAGGAAGGAAGG + Intergenic
1012848990 6:104424385-104424407 AGGGCGGGCAGGAGGAAGGAAGG + Intergenic
1012865388 6:104612333-104612355 AGGGCAGGAAGGAGTTAGGAAGG - Intergenic
1013288035 6:108697615-108697637 AGGCCTAGCAGCTGTGAGGAGGG + Intergenic
1013399900 6:109783105-109783127 AGGGCCTGCAGTGGTGAGGGTGG + Intronic
1014044870 6:116874348-116874370 AGGGGTAGCAGGACAGAGGAGGG + Intergenic
1014800703 6:125775216-125775238 AGAGTAACCAGGAGTGAGGAAGG - Intergenic
1015827116 6:137325910-137325932 AGGGACATAAGGAGAGAGGATGG + Intergenic
1016848747 6:148595054-148595076 AGGGCCAGCTGGCAGGAGGAGGG - Intergenic
1016882402 6:148923763-148923785 AAGGCCCCCAGGAGTGGGGAGGG - Intronic
1016882761 6:148927213-148927235 AGGACCAGTGGGAGGGAGGAAGG + Intronic
1016982440 6:149864796-149864818 AGGGCCGGGAGGGGTGGGGATGG + Intergenic
1017286373 6:152681039-152681061 AGGGACAGAGGGAGGGAGGAAGG + Intergenic
1017896772 6:158686861-158686883 AGGGCCAGGAGGAGGGAGAAGGG - Intronic
1018131368 6:160735037-160735059 AGGGACACCAAGAGGGAGGAAGG + Intronic
1018635135 6:165854292-165854314 GGGGCCCGCAGGAGGCAGGAGGG + Intronic
1018756507 6:166853866-166853888 ATGGCCTGCAGGAGAGAGGCAGG + Intronic
1018816797 6:167338939-167338961 AGGGAGAGCAGGAAGGAGGAAGG - Intronic
1018958917 6:168432292-168432314 AGGATGAGCAGGAGGGAGGAGGG + Intergenic
1019166354 6:170100192-170100214 AGGGGCAGCGGGGATGAGGACGG - Intergenic
1019344106 7:521242-521264 GGGGCCTGCAGGTGTGTGGAAGG - Intergenic
1019404927 7:877960-877982 AAGGCCAGGAGGAGGGAGGCAGG - Intronic
1019427310 7:983695-983717 AGGGACAGCAGAGGGGAGGAGGG + Intronic
1019474918 7:1239772-1239794 AGGGGGAGCAGGAGAGAGGCCGG + Intergenic
1019494925 7:1333366-1333388 AGGGGGAGGAGGAGAGAGGAGGG - Intergenic
1019494965 7:1333456-1333478 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1019539537 7:1545557-1545579 AGGGGCAGCAGAAGTGGGCAAGG - Exonic
1019571957 7:1717029-1717051 AGAGCATGCAGGAGGGAGGAGGG + Intronic
1019613331 7:1947809-1947831 AGGGCCAGCAGGAGGGCTGAAGG + Intronic
1019754767 7:2760928-2760950 AGGGGGAGCTGGAGTGGGGAAGG - Intronic
1019938168 7:4269779-4269801 GGGGCCAGCAGGAGGAAGCATGG + Intergenic
1020260753 7:6529593-6529615 AGGGCCAGCAGGAGCCAGGTTGG - Intronic
1020279022 7:6640850-6640872 AGGGGCAGCAAGAGAGAGGGAGG - Intronic
1020907892 7:14088065-14088087 AGAGACAGCAGGAGTGAGCCAGG - Intergenic
1021553320 7:21895010-21895032 AGGGCCAGTGGCAGTGAGGATGG - Intronic
1021823918 7:24528219-24528241 AGGACCAGCAGGAGGGAGAAAGG + Intergenic
1021851665 7:24814642-24814664 CGGGGCTGCAGGAGGGAGGAAGG - Intronic
1022544923 7:31177570-31177592 AGGGCTTGCAGGAGTGAAGCTGG - Intergenic
1023832876 7:44050305-44050327 AGGGACACCAGGAGGTAGGAGGG + Intronic
1024037891 7:45524085-45524107 AAGGCAAGCAGGAGGGAGCAAGG - Intergenic
1024086257 7:45894217-45894239 AGGGTGAGCAAGAGTTAGGAGGG - Intergenic
1024094775 7:45974818-45974840 AATGACAGCAGGAGTGAAGAGGG + Intergenic
1024666195 7:51549707-51549729 AGGGCAAGCAGGAGAATGGAAGG + Intergenic
1024979433 7:55145115-55145137 AGGGCCAGCACACGTGAGGGAGG - Intronic
1026109237 7:67445677-67445699 ACAGTCAGCAGGAGTGAGGATGG - Intergenic
1026191916 7:68136516-68136538 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026191924 7:68136535-68136557 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026268544 7:68816621-68816643 AGAGCCAGCAGCAGACAGGAGGG + Intergenic
1026530069 7:71189530-71189552 AGGGGCAGTTGGAGGGAGGAAGG + Intronic
1026792547 7:73344019-73344041 ATGGCCAGCATCAGTGACGAAGG - Intronic
1027254784 7:76424220-76424242 AGGGCCAGCAGGGGATCGGAGGG + Intronic
1027579071 7:79970320-79970342 AGGGGCAGCAGGAGATAGGAAGG + Intergenic
1027622032 7:80500158-80500180 AAGCCCACCAGGAGTGAGGCAGG - Intronic
1028679333 7:93507396-93507418 AGGGCAATGAGCAGTGAGGAGGG + Intronic
1028947645 7:96599043-96599065 AGGGGCAGAGGGAGGGAGGAAGG + Intronic
1030227275 7:107168132-107168154 AGTGCCAGGAAGAGTGAGGCTGG - Intergenic
1030613191 7:111711000-111711022 ATGTCCAGCAGGAGTCAGGATGG - Intergenic
1031154174 7:118089278-118089300 ATAGACAGCAGGAGTGAGGGAGG - Intergenic
1031327645 7:120421970-120421992 AGACCCAGCAGGATGGAGGAAGG + Intronic
1032645147 7:133815764-133815786 AAGGCCAGCACAAATGAGGAAGG - Intronic
1032797474 7:135289281-135289303 AAGCCCAGCAGGAGTGAGGAGGG - Intergenic
1034535825 7:151725050-151725072 CGGGCCAACAGGAGCGAGGTCGG + Intronic
1034542099 7:151764784-151764806 AGGGCCAGCAGGTGGGGGTAAGG + Intronic
1034551335 7:151822567-151822589 AGGGCCAGGAGGCGAGGGGAAGG + Intronic
1034794444 7:154000343-154000365 GGGGCCAGCTGCACTGAGGATGG + Intronic
1035023514 7:155812222-155812244 CGGGCGAGCCGGAGCGAGGAAGG - Exonic
1035203499 7:157280580-157280602 CGGGCAGGCAGGAGGGAGGAAGG + Intergenic
1035259035 7:157650054-157650076 CAGGCCCGCAGGAGTGAGGCTGG + Intronic
1035361788 7:158318243-158318265 AGTGCAAGCAGGAGTGGGAAAGG + Intronic
1035547451 8:494339-494361 AGGGACAGACGGAGTGGGGAGGG + Intronic
1035555468 8:564304-564326 AGGGCCAGGAGGAGAGAGACCGG + Intergenic
1035605266 8:926349-926371 AAGGCCAGGAGGTGTGAGGGGGG - Intergenic
1035942201 8:3913716-3913738 AGGGAAGGCAGGAGTGGGGAAGG + Intronic
1036387339 8:8293997-8294019 AGGACAAGCAGGAGTGAGTCAGG + Intergenic
1036642184 8:10591578-10591600 CAGGCCAGCGGGAGCGAGGAAGG + Intergenic
1036711648 8:11083266-11083288 AGGCCTTACAGGAGTGAGGAAGG + Intronic
1036849274 8:12190434-12190456 TGGTGCAGCAGGAGTGGGGACGG + Intronic
1036870634 8:12432708-12432730 TGGTGCAGCAGGAGTGGGGACGG + Intronic
1037655170 8:20876937-20876959 GGTGTCAGCAGGAGTGAGGCTGG - Intergenic
1038050480 8:23805857-23805879 AGGAGCAGCAGGAGAGGGGAAGG - Intergenic
1038248223 8:25878822-25878844 GGGGGCAGTCGGAGTGAGGAGGG - Intronic
1038482151 8:27909252-27909274 AGGGTCAGCAGGAGTCATGGTGG + Intronic
1038613028 8:29071455-29071477 TGGGCCTGCAGGGGTGAGGCTGG - Intronic
1039910941 8:41826390-41826412 CTGGGCAGCAGGAGTGAGCATGG - Intronic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1040517134 8:48144452-48144474 AGGGCCCGCAGGAGGGTGGGTGG + Intergenic
1040600939 8:48883345-48883367 AGTGCCAGCAGGAGAGAGCAGGG - Intergenic
1040615790 8:49037229-49037251 GGGGTCAGCAGCAGTGATGATGG - Intergenic
1040845514 8:51834084-51834106 GGGGCCAGCAGAAATGAGAAGGG + Intronic
1041343983 8:56876505-56876527 AGAGACAGAAGGAGGGAGGAAGG + Intergenic
1041405309 8:57492396-57492418 AGGGCTGGCAGGAATGAGGCAGG - Intergenic
1042568793 8:70140273-70140295 AGGGCCAGGAGTTGTGGGGAGGG - Intronic
1042751698 8:72164337-72164359 ATGGCCAGCAGGAGGGTGGGGGG - Intergenic
1044350578 8:91160601-91160623 ATGGTCAGCAGGAGAGAGAAGGG - Intronic
1044547644 8:93477329-93477351 AGGGCCAAGGGGAGTGAGGTGGG - Intergenic
1044857026 8:96486852-96486874 AGGGCAAGCAGGAGTTAGGCAGG + Intergenic
1045361957 8:101441155-101441177 AGGGACAGAAGGAGGGAGGGAGG - Intergenic
1045834872 8:106508014-106508036 AGGGGGAGCAGGAGTTAAGATGG - Intronic
1046969251 8:120203303-120203325 AGGTCCACCAGAAGTGGGGAGGG + Intronic
1047084801 8:121504935-121504957 AGGAGGAGCAGGAGTGGGGATGG - Intergenic
1047521322 8:125597335-125597357 AAAGGCACCAGGAGTGAGGATGG - Intergenic
1047939614 8:129816371-129816393 AGGAGCAGCAGTGGTGAGGAGGG + Intergenic
1047965173 8:130041164-130041186 AGGGGAAGAAGGAATGAGGAGGG - Intergenic
1048139341 8:131777885-131777907 AAAGACAGCAGGAGTGAGAAAGG - Intergenic
1048540930 8:135341771-135341793 AGAGAGAGCAGGACTGAGGAGGG + Intergenic
1049003970 8:139843279-139843301 AGAGCCAGCAGGAGGGCGGCAGG + Intronic
1049106429 8:140616662-140616684 AGGGGCAGCAGCAGTGGGCAGGG + Intronic
1049203402 8:141352414-141352436 AGGCCCTGAAGGAGAGAGGAGGG + Intergenic
1049266107 8:141668681-141668703 AGGGCGAGCAGAAGTGAGGAAGG + Intergenic
1049389184 8:142359333-142359355 CGGGCCAGCGTGGGTGAGGACGG - Intronic
1049443341 8:142619070-142619092 AGGGCCACCTGCAGTGGGGACGG + Intergenic
1049499379 8:142953432-142953454 AGAGGCAGCAGGGGTGGGGAGGG - Intergenic
1049526316 8:143128445-143128467 GGAGCCAGCAGGAGGGAGCATGG + Intergenic
1049686331 8:143940721-143940743 AGGGGCAGTAGGAATGAGGTGGG - Intronic
1049820319 8:144629471-144629493 AAGGCCAGCAGGAGTGGGGCTGG + Intergenic
1049912733 9:285194-285216 AGGGACAGCAAGAGTGGGGAGGG + Intronic
1049989156 9:976335-976357 AGGACCAGCGGGAGTGAGGGTGG - Intergenic
1050022002 9:1293975-1293997 ATGGCCAGTAGGAGTAGGGAGGG + Intergenic
1051459359 9:17294844-17294866 AGGGCGGGGAGGAGGGAGGAGGG + Intronic
1053054718 9:34987797-34987819 GGGGTGAGGAGGAGTGAGGAAGG - Intergenic
1053174086 9:35909893-35909915 AGGGACATGAGGAGGGAGGAAGG - Intergenic
1054769521 9:69070448-69070470 AGGGCCACCAGGAGGGAGGCAGG + Intronic
1055494345 9:76839830-76839852 AGGGTCAGCAGGACTGCTGATGG + Intronic
1055892908 9:81142195-81142217 AGGGCCAGGAGAAGTGAAGGAGG + Intergenic
1055984297 9:82040357-82040379 AGGAGCAGTGGGAGTGAGGATGG + Intergenic
1056731063 9:89167108-89167130 GGGTCCAGCAGGAGGGAGGGAGG + Intronic
1056786030 9:89593151-89593173 AGGGAATGCAAGAGTGAGGAAGG - Intergenic
1056806315 9:89731807-89731829 AGGGGCAGCAGGAGGGAAGGGGG - Intergenic
1056930126 9:90867332-90867354 AGGAACAGCAGGTGTGAGCAAGG - Intronic
1056935113 9:90910560-90910582 AGGGGGAGCAGGAATGAGGCTGG + Intergenic
1057531998 9:95857171-95857193 AGGGGCAGCAGAAGTGATGGGGG + Intergenic
1057878657 9:98776753-98776775 CCAGCCAGCAGGAGAGAGGAGGG - Intronic
1058483159 9:105417395-105417417 AGACCAAGCAGGAGGGAGGAGGG - Intronic
1058699572 9:107589363-107589385 AGGGCCAGCAGCAGTGACCACGG - Intergenic
1059405287 9:114095339-114095361 AGGGAGAGCAAGAGTTAGGAAGG + Intronic
1059738024 9:117121827-117121849 ATGGCCAGCAGGAGAGAGACAGG + Intronic
1060530235 9:124343531-124343553 AGGGACTGCAGGAGTGGGGAGGG - Intronic
1060617751 9:125034192-125034214 AGGGTCAGCAGGAGGTTGGAGGG - Intronic
1060741782 9:126103541-126103563 AGGATCAGCAAGAGTGAGGCTGG + Intergenic
1060748772 9:126155129-126155151 AGGTTCAGCAGCAGCGAGGAGGG + Intergenic
1060973105 9:127749937-127749959 AGGGTCTGGAGGAGTGAGAATGG + Intronic
1060999922 9:127897260-127897282 AGGGCGGGCAGGAGTGCAGAGGG + Intronic
1061110767 9:128568669-128568691 AGAGGGAGCAGGATTGAGGAGGG + Intronic
1061246165 9:129402165-129402187 AGGGTGGGGAGGAGTGAGGAGGG - Intergenic
1061424833 9:130492424-130492446 AGGGCCTCTAGGAGTGAGGCTGG - Intronic
1061616370 9:131782497-131782519 AGGAGCAGCAGGAGAGGGGAAGG - Intergenic
1062229641 9:135474555-135474577 GGGGCCAGCAGGAGTGCGGCGGG - Intergenic
1062236986 9:135515070-135515092 AGGGCAGGCAGGAGGGAGGCAGG - Intergenic
1062273448 9:135720107-135720129 AGGGCCAGCAGGAGCAGGAATGG + Intronic
1062323405 9:136001448-136001470 AGGGCCTGCAGGAGAGGAGAGGG - Intergenic
1062445666 9:136593155-136593177 AGGGGCAGGAGGAGTGGGGACGG - Intergenic
1062590334 9:137271798-137271820 AGGGACAGGAGGAGGGTGGAGGG - Intronic
1062626860 9:137447210-137447232 AGGGTCTGCTGGAGTGAGTAAGG - Intergenic
1185643587 X:1601328-1601350 CGGGCCAGCAGCAGGGAGGACGG + Exonic
1185833991 X:3328643-3328665 CAGGCCAGCAGCTGTGAGGATGG + Intronic
1186079280 X:5912858-5912880 AGGGAGAGCAGGAGGGAGGAAGG + Intronic
1186079323 X:5912973-5912995 AGGGAGAGCAGGAGGAAGGAAGG + Intronic
1186435975 X:9543476-9543498 TGAGCCAGCAAGAGGGAGGAGGG - Intronic
1187173333 X:16871382-16871404 AGGGCCAGGAGCAGAGGGGACGG + Intergenic
1187505368 X:19874681-19874703 AGGGAGAGCAGAAGTGGGGAGGG + Intronic
1188588201 X:31802573-31802595 ATGTCCAGCAGGGGTGAGGTGGG + Intronic
1189323135 X:40098032-40098054 AGGGCGGGCGGGAGGGAGGACGG - Intronic
1189332221 X:40151284-40151306 GGGGCAAGCAGGAGGGAGGGGGG + Intronic
1189548516 X:42069407-42069429 AGGGCCTGTTGGAGAGAGGAGGG + Intergenic
1189694646 X:43652037-43652059 AGGACCAGCAGGAGACTGGAGGG + Intergenic
1190221293 X:48514102-48514124 AGGGCCCCCAGGGGTCAGGAAGG - Intronic
1190417948 X:50199738-50199760 AGGGAGAGCGGGAGTGGGGAGGG - Intronic
1190734709 X:53248653-53248675 AAGGACAGCAAGAGGGAGGAAGG - Intronic
1191122727 X:56922742-56922764 ATGGCCAGCAGAAGAGAGGTGGG - Intergenic
1192176208 X:68887155-68887177 AGGGAAAGAAGGAGGGAGGAAGG - Intergenic
1192536583 X:71933757-71933779 AGAGGCAGCAGAAATGAGGAAGG - Intergenic
1193958180 X:87888755-87888777 AGGGACAGTAGGCATGAGGAGGG + Intergenic
1194294619 X:92113169-92113191 AGGAGCAGCAGGAGAGGGGAAGG - Intronic
1195141355 X:101963760-101963782 AGGGCCAAGAGTAGAGAGGAAGG + Intergenic
1195387164 X:104324279-104324301 AGGGTGAGCAGGAGTCAGGAAGG - Intergenic
1196283492 X:113852377-113852399 AGGGCCAGGGGAAGTGGGGATGG - Intergenic
1196794327 X:119490136-119490158 AGGGGCAGGAGGTGTGAGAACGG + Intergenic
1197126679 X:122955092-122955114 AGTGACAGCAGGACAGAGGATGG - Intergenic
1197976761 X:132173855-132173877 CTGGTCAGCAGGAATGAGGAAGG + Intergenic
1198111963 X:133509750-133509772 AGTGGCAGGAGGAATGAGGAGGG + Intergenic
1198212512 X:134529352-134529374 AAGGGCAGCAGGGGTGGGGATGG + Intergenic
1198395188 X:136212766-136212788 AGGGATAACAGGAGTGAGGAGGG - Intergenic
1198559981 X:137839009-137839031 GGGGGCAGCAGGAGTGGGCATGG + Intergenic
1199717772 X:150518508-150518530 AGGGCAGGCAGGAGAGGGGATGG + Intergenic
1199943509 X:152647663-152647685 AGGGCCTCCAGGAGTGCGGAGGG + Intronic
1200686249 Y:6262915-6262937 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200827517 Y:7659507-7659529 TCGGGCAGCATGAGTGAGGATGG - Intergenic
1200909069 Y:8515085-8515107 AGGGGCAACATGAGTGAGGATGG + Intergenic
1200954209 Y:8928749-8928771 CGGGGAAGCATGAGTGAGGATGG + Intergenic
1200958027 Y:8971074-8971096 AGGGGAAGCATGAGTGAGGATGG + Intergenic
1200986269 Y:9305507-9305529 CGGGGAAGCATGAGTGAGGATGG - Intergenic
1200989132 Y:9333831-9333853 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200991789 Y:9354161-9354183 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200994443 Y:9374441-9374463 CAGGGCAGCGGGAGTGAGGATGG + Intronic
1200997106 Y:9394787-9394809 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200999622 Y:9463325-9463347 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1201002280 Y:9483633-9483655 CAGGGCAGCGGGAGTGAGGATGG + Intronic
1201004939 Y:9503920-9503942 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1201007597 Y:9524247-9524269 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1201018438 Y:9626847-9626869 TGGGCCAGTGTGAGTGAGGATGG - Intergenic
1202381673 Y:24279705-24279727 AGGGGCAGCAGGAGTAAAGGAGG + Intergenic
1202489112 Y:25390421-25390443 AGGGGCAGCAGGAGTAAAGGAGG - Intergenic