ID: 1002589733

View in Genome Browser
Species Human (GRCh38)
Location 5:180282062-180282084
Sequence TCTAAGCTATAGGAGGTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002589730_1002589733 -1 Left 1002589730 5:180282040-180282062 CCAGGCTGGCAGGTCACTGTGCT 0: 1
1: 0
2: 3
3: 21
4: 265
Right 1002589733 5:180282062-180282084 TCTAAGCTATAGGAGGTGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002589733 Original CRISPR TCTAAGCTATAGGAGGTGCG AGG Intronic
1064079852 10:12299564-12299586 TCTAAGCTATTTGAGATGCCTGG - Intergenic
1068897121 10:62218034-62218056 TATAAACTGTAGGGGGTGCGGGG - Intronic
1079233639 11:18671389-18671411 TCAAATCTGTAGGAGGTGTGGGG + Intergenic
1091278337 11:134367420-134367442 TGTAAGCCATAGGGGGTGCAAGG + Intronic
1102222506 12:111204030-111204052 TCCAGGCTATGGGAGGTGCCTGG - Intronic
1107195753 13:37649442-37649464 TCTAAGCTATTGGCCGGGCGCGG + Intronic
1107311286 13:39081532-39081554 TCTAAGATGTAGGGGGTGTGAGG + Intergenic
1118211814 14:63772451-63772473 TCTAAGCTATAGGTCAGGCGCGG + Intergenic
1119377320 14:74205223-74205245 TCTAAGATATAGTAAGTGCTTGG + Intergenic
1147754057 17:42756504-42756526 TCCAAGCCCTAGGTGGTGCGGGG + Intergenic
1149727935 17:58915473-58915495 TCTAAGCCATAGGATGAGAGAGG - Intronic
1149739109 17:59026667-59026689 TAGAAGCTGGAGGAGGTGCGGGG - Intronic
1151617279 17:75221711-75221733 TCTAAGCCATATGGGGTGAGGGG + Intronic
1157324155 18:46657127-46657149 CCTGAGCTATAGGAGGGCCGTGG - Intergenic
1160762815 19:794157-794179 TCTAAGCTTCAGGTGGTGGGTGG + Intergenic
1161596238 19:5152422-5152444 CCTGAGCCATAGGAGGTGCAGGG - Exonic
1170380055 20:15748599-15748621 TCAGAGCTATAGGTGGTGAGAGG - Intronic
1173152476 20:40579369-40579391 GCGAAGATATAGGAGGTGAGGGG + Intergenic
1173752575 20:45488543-45488565 TCTAAGCCATAGGGGGTGGCTGG - Intergenic
1175010494 20:55729708-55729730 TCTAAGATAAAGGAGGTGTGAGG - Intergenic
951059547 3:18189096-18189118 TCTAAGCTTTAAAAGGTGGGAGG - Intronic
955889591 3:63635800-63635822 TCAAAGGTACAGGAGGTGGGCGG + Intergenic
960257239 3:115523775-115523797 TCTAAGCTATAGCCGGTCCTGGG - Intergenic
961644458 3:128385198-128385220 TCTGAGCTATAGCAGCTGCTGGG - Intronic
966181625 3:177193979-177194001 GCTATGCTCTAGGAGGTGTGAGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
988817863 5:34852245-34852267 TCTAAGGCATAGGAAGTGAGAGG + Intronic
992366461 5:76096146-76096168 TCCAAGCCATATGAGGTGCTGGG - Intronic
993916776 5:93753751-93753773 TCTAAGCTATAGTAGGGGCAAGG + Intronic
995248840 5:109966158-109966180 TCTTAGCTCTGGGAGGTGAGAGG - Intergenic
995432463 5:112096427-112096449 TTTAAGCTATAGGTCGTGCTTGG - Intergenic
1002589733 5:180282062-180282084 TCTAAGCTATAGGAGGTGCGAGG + Intronic
1012054031 6:94382271-94382293 TCTATGCTATAGAAAGTGCTGGG - Intergenic
1018377781 6:163229895-163229917 TCTAAATTATAGGAGGTTAGTGG - Intronic
1021683015 7:23153851-23153873 TCTAATATGTAGGAGGTGCTAGG + Intronic
1029189670 7:98762534-98762556 TCCATGCTATGGGAGGAGCGAGG + Intergenic
1029483037 7:100824371-100824393 TCTGAGCTAGAGGAGTTGGGGGG + Intronic
1030679703 7:112422137-112422159 TGCAAGCAATAGGAGGTGAGAGG - Intergenic
1035746996 8:1968231-1968253 ATTAAGCTATAGGAGGTGCTGGG + Intergenic
1044043403 8:87399023-87399045 TTTAATCTCTAGGAGTTGCGTGG - Intronic
1044868014 8:96591324-96591346 TGCAAGCTATAGGAGGTTTGGGG + Intronic
1047016143 8:120725203-120725225 TCAAACCTATGGGAGGTGGGGGG + Intronic
1049006515 8:139859064-139859086 TCTATGCTCTAGGAGTGGCGTGG + Intronic
1049032595 8:140048722-140048744 ACAAAGCTAGTGGAGGTGCGGGG + Intronic
1056497311 9:87171085-87171107 ACTCAGCTATAGGCGGGGCGCGG + Intergenic
1190920984 X:54852240-54852262 TCTAAGATTTAGGAGGTTAGAGG - Intergenic
1195523305 X:105855501-105855523 TCCCAGCTAGAGGAGGTGAGAGG - Intronic
1196888711 X:120272066-120272088 TCTCAGCTATAGCAGGGGAGTGG + Intronic