ID: 1002593065

View in Genome Browser
Species Human (GRCh38)
Location 5:180304466-180304488
Sequence CCCTGGGGCAGGGTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002593065_1002593081 22 Left 1002593065 5:180304466-180304488 CCTGGGGAAACCCTGCCCCAGGG 0: 1
1: 0
2: 3
3: 39
4: 389
Right 1002593081 5:180304511-180304533 CTGAGCTCCAGGCTAGGATCTGG 0: 1
1: 0
2: 2
3: 17
4: 239
1002593065_1002593075 11 Left 1002593065 5:180304466-180304488 CCTGGGGAAACCCTGCCCCAGGG 0: 1
1: 0
2: 3
3: 39
4: 389
Right 1002593075 5:180304500-180304522 GAGTACCTCCCCTGAGCTCCAGG 0: 1
1: 0
2: 0
3: 17
4: 171
1002593065_1002593077 16 Left 1002593065 5:180304466-180304488 CCTGGGGAAACCCTGCCCCAGGG 0: 1
1: 0
2: 3
3: 39
4: 389
Right 1002593077 5:180304505-180304527 CCTCCCCTGAGCTCCAGGCTAGG 0: 1
1: 3
2: 4
3: 76
4: 1134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002593065 Original CRISPR CCCTGGGGCAGGGTTTCCCC AGG (reversed) Intronic
900264110 1:1748885-1748907 CCTCGGGGCAGGGTCTACCCAGG + Intergenic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900591710 1:3463164-3463186 CCCGGAGGCTGGGTTCCCCCCGG - Exonic
900990649 1:6096788-6096810 AGCTGGGGCAGGTTCTCCCCAGG - Intronic
901038596 1:6350756-6350778 CCCAGGAGCAGCGTCTCCCCAGG + Intronic
901451295 1:9338301-9338323 CCTGGGGACAGGGTCTCCCCTGG - Intronic
901653460 1:10756038-10756060 CCCTGGGGGAGGGTGTGTCCGGG - Intronic
902098339 1:13965001-13965023 CCCTGGGGCAGGGACGCACCTGG + Intergenic
902689786 1:18103418-18103440 CCCTGGGGCAGGGCCTGCCTGGG + Intergenic
903279808 1:22244024-22244046 GACTGGGGCAGGGATGCCCCTGG - Intergenic
904375885 1:30082302-30082324 CTCTGGAACAGAGTTTCCCCCGG + Intergenic
904439158 1:30518518-30518540 CCCTGGGGCTCGTTTTCCCTGGG - Intergenic
905132903 1:35774837-35774859 CACAGTGGCAGTGTTTCCCCAGG - Intergenic
905791371 1:40791492-40791514 CCCAGGGACAGGGTTGCCCAGGG - Intronic
905931648 1:41792234-41792256 CCCTGAGGCAAGGTTTCATCTGG + Intronic
906017071 1:42591577-42591599 CCCTGTGGCAGGGTTCTGCCTGG - Intronic
907312987 1:53550380-53550402 CTCTGGGGGAGGCTTGCCCCAGG + Intronic
907655785 1:56340638-56340660 CCCTGTGGCAGTCTTTCCCGAGG - Intergenic
908838809 1:68257140-68257162 CCCTGGGGCAGGCCTTCTCATGG - Intergenic
912659130 1:111513033-111513055 ACCTGGGGCAGCCTTTCCCCGGG - Intronic
913076362 1:115343566-115343588 CTCTGGGGCAGGATTCCCCAGGG + Intergenic
914937492 1:151993670-151993692 GCCGGGTGCAGGGTTTTCCCCGG + Intronic
915517158 1:156420301-156420323 CCGTGAGGCCGGCTTTCCCCGGG + Intronic
917967212 1:180186379-180186401 GCATGGGGCAGGGTTGTCCCTGG - Intronic
920067034 1:203276506-203276528 CTATGGGGCAGGTTTTCCGCAGG + Intergenic
920604571 1:207368671-207368693 CCCTGGGGCAGAGCTACCACTGG + Intergenic
922467429 1:225853791-225853813 ACCTGGGCCCTGGTTTCCCCAGG - Exonic
922727331 1:227928516-227928538 GCATGGGGCAGGGGTTACCCAGG - Intronic
922748374 1:228059730-228059752 CCCTGGGGACGGGGCTCCCCTGG + Exonic
923712700 1:236399861-236399883 CCCAGGCCCAGGGTTCCCCCAGG - Intronic
924707040 1:246509982-246510004 CCATGGGGCAGGCTTAGCCCCGG - Intergenic
924707715 1:246512487-246512509 CCCTGAGCCAGGGTCTCCCTGGG + Intergenic
1062816661 10:505941-505963 CAATGGGGCAGGTTTTCTCCTGG + Intronic
1064112855 10:12553425-12553447 CCCGGAGGCAGACTTTCCCCGGG + Intronic
1065225477 10:23539217-23539239 ACCTGAGGCTGGGATTCCCCTGG - Intergenic
1065980185 10:30887264-30887286 CTCTGGGCCATGCTTTCCCCTGG + Intronic
1066802845 10:39209299-39209321 ACCTTTTGCAGGGTTTCCCCAGG + Intergenic
1067748584 10:48955505-48955527 CCCAGGTCCAGGGATTCCCCAGG + Intronic
1067832966 10:49620946-49620968 GCCTGGGGCAGTGTTTCCCAGGG - Intronic
1068102247 10:52569871-52569893 CCTTGTGGCAGGGTTTCAGCTGG + Intergenic
1070071723 10:73096645-73096667 TTCTGGGGCGGGGGTTCCCCAGG - Intronic
1070428689 10:76315391-76315413 CGCTGGGGCAGGGGCTTCCCAGG - Intronic
1072714121 10:97737805-97737827 CCCTGGGGCAGAGATGGCCCAGG + Intronic
1072940616 10:99760381-99760403 CCCTGTGGCAGGCTTTTACCTGG + Intergenic
1073951470 10:108814130-108814152 CCATGGGGCAGGGATTCCTTGGG + Intergenic
1074295423 10:112183461-112183483 CGCTGGGGCATGGGTTCCCCTGG - Intronic
1074528533 10:114281100-114281122 CTCTAGGGCAGGGTCTTCCCTGG - Intronic
1074602196 10:114926113-114926135 CCCTAGAGCATGTTTTCCCCTGG - Intergenic
1076180576 10:128404369-128404391 CCCTGGGCCAGGCTTTCTGCAGG + Intergenic
1076303071 10:129442408-129442430 GCATGGGGCAGGCTTTCCCTTGG + Intergenic
1076335978 10:129706665-129706687 CCCAGGGCCAGGGCTTCCCACGG + Intronic
1076817164 10:132920676-132920698 CCCGGGGGCTGGGCCTCCCCTGG + Intronic
1077399905 11:2349810-2349832 CCCTGTGGCAGGCTTCCTCCTGG - Intergenic
1078085987 11:8233294-8233316 CCCTGGCTCAGGCTTCCCCCAGG - Intronic
1078501743 11:11885858-11885880 CCCTGGGACAGAGTTTCCAGAGG + Intronic
1079366671 11:19815988-19816010 CTCTGGGCCAGGTTGTCCCCTGG + Intronic
1080284830 11:30597999-30598021 CTCTGGGGCAGGGTTTTAGCAGG - Intergenic
1080614889 11:33937282-33937304 CCAGGGGACAGGCTTTCCCCAGG - Intergenic
1083274689 11:61590113-61590135 CCCTGGGCAAGGATTTCTCCAGG + Intergenic
1083481214 11:62948957-62948979 CTCAGGGCCTGGGTTTCCCCAGG + Intronic
1083609163 11:63996971-63996993 CCATGGGGGAGGGGTTCACCTGG + Intronic
1083792660 11:64995912-64995934 CCCTGGGCCATGGTTTCCCTTGG - Intronic
1083999420 11:66288192-66288214 TCCTGTGGCTGGGTATCCCCCGG + Exonic
1084264523 11:67997979-67998001 CACTGGGGCTGGGTGTTCCCCGG + Intronic
1084562770 11:69913743-69913765 CTCTGGGGCAGGGACTCCCCAGG + Intergenic
1084785071 11:71437474-71437496 CACTGGGGCAGGGCTGCCCTGGG - Intronic
1085033850 11:73288640-73288662 GCCTGAAGCAGGGTTGCCCCTGG - Intronic
1086964972 11:93018130-93018152 CCCTGTGGCAGGTTTTTCCACGG + Intergenic
1088583193 11:111334895-111334917 CCCGGGGACTGGGTTTCCACTGG - Intergenic
1089651208 11:119914549-119914571 CGCTATGGCAGGGTTTCTCCAGG + Intergenic
1091748495 12:3008277-3008299 CTCTGGGGCAGAGTGTTCCCTGG + Intronic
1091871091 12:3891809-3891831 CCCTGGGCCTGGGTTTTCTCAGG - Intergenic
1096216537 12:49800923-49800945 CCCTGTGGCAGGGTTCACCCTGG - Intronic
1097288762 12:57896868-57896890 CCCAAGGGCAGAGGTTCCCCAGG + Intergenic
1099277850 12:80600957-80600979 CCCTGAGGCAGGATTTCGCCTGG - Intronic
1102033665 12:109759048-109759070 CCCTGGAGAAGGGGTTCCCTTGG - Intronic
1102298428 12:111754694-111754716 CCCTGGGGCAGGGTGTTCAAGGG - Intronic
1103341368 12:120222828-120222850 CCCTGGGGCAGGGTCTACCAGGG - Intronic
1103856030 12:123972307-123972329 CCCAGGGGCAGGGGTGGCCCCGG - Intronic
1104215665 12:126730617-126730639 CCCTGGTGCAACATTTCCCCTGG - Intergenic
1104358715 12:128112142-128112164 CCCTGGGGCAGGCACTGCCCTGG - Intergenic
1104607481 12:130200621-130200643 TCCTGGGGCAGGGGCTCCCTGGG + Intergenic
1104828812 12:131733959-131733981 CCCTGGGGCAGGGTGACACATGG + Intronic
1105705597 13:22965870-22965892 CCCTGGGGCTGGGGTCCCCTGGG + Intergenic
1106775412 13:33003882-33003904 CCCTTGGGGAAGGTTGCCCCTGG - Intergenic
1107101448 13:36597799-36597821 CCCTAGGCCAGGTTTTCCCTGGG - Intergenic
1107723299 13:43272327-43272349 CCCTGTGGGAGGATTTCCCTGGG + Intronic
1111822337 13:93228328-93228350 CCGGGTGGCAGGGTGTCCCCGGG - Intronic
1112076143 13:95915637-95915659 CCCTGGGACAGGGCTTCCGGGGG + Intronic
1114353324 14:21878774-21878796 CCATGGAGCAAAGTTTCCCCTGG + Intergenic
1114499789 14:23160166-23160188 GCCTGGGAAAGGGTGTCCCCTGG + Intronic
1114670871 14:24410250-24410272 ACCTGGGGCAGGGCATCCCTGGG + Intronic
1118365521 14:65092287-65092309 CACTGGGGCAGTGTTTCTCAAGG - Intronic
1118395238 14:65330541-65330563 CCCTGGGGCAGGGCATGCCTGGG + Intergenic
1118443577 14:65832622-65832644 CCATGGAACAGGCTTTCCCCGGG - Intergenic
1118602712 14:67481812-67481834 CCCTGCAGCAGGCTTTCCCAGGG - Intronic
1118672105 14:68140015-68140037 CCCTCTGGCAGGGTTTCTCAGGG - Intronic
1119040443 14:71269729-71269751 CACAGGGGCAGAGTTGCCCCAGG + Intergenic
1119551428 14:75516743-75516765 CTCTGGGCCACTGTTTCCCCAGG - Intergenic
1119765023 14:77182496-77182518 CCCTGGGCCTCAGTTTCCCCAGG - Intronic
1120431202 14:84418558-84418580 CCCTGGAGCAGGGTTCAGCCTGG - Intergenic
1121113788 14:91330032-91330054 CACAGGGGCCGGGTTTGCCCAGG + Intronic
1121281765 14:92704193-92704215 CCCTGGAGCGGGGGCTCCCCAGG + Exonic
1121445925 14:93978885-93978907 CCATGGGGCATGGTTCCCACTGG - Intergenic
1121556951 14:94845346-94845368 CCCTGGGGAAGGGCTTCCTGAGG + Intergenic
1122023840 14:98860123-98860145 CCATGGGGCAGCGGTACCCCAGG + Intergenic
1122267189 14:100552182-100552204 CCCTGGGTCCCAGTTTCCCCTGG - Intronic
1122267195 14:100552199-100552221 CCCTGGGCCTCAGTTTCCCCTGG - Intronic
1122546380 14:102524885-102524907 CCCTGGGGCAGCTTTGGCCCCGG - Intergenic
1122548536 14:102538155-102538177 CCCTGTGGCTGAGTTACCCCCGG - Intergenic
1122629390 14:103100374-103100396 CCCTGAGGCAGGCCTTCTCCCGG + Exonic
1122808987 14:104278532-104278554 CCCTGGGCAAGGGTCTCCTCTGG - Intergenic
1122960191 14:105090664-105090686 CCCTGAGGCAGGGCGCCCCCTGG - Intergenic
1123155306 14:106219090-106219112 CCCTGGGGAAGAGTTTCCTCTGG - Intergenic
1123206736 14:106720782-106720804 CCCTGGGAAAGCGTTTCCTCTGG - Intergenic
1123211758 14:106767787-106767809 CCCTGGGAAAGCGTTTCCTCTGG - Intergenic
1123401971 15:19996217-19996239 TCCTGGGGAAGAGTTTCCTCTGG - Intergenic
1123449005 15:20348967-20348989 GCCTGGGGCAGGGGTAGCCCAGG - Intergenic
1123466053 15:20516827-20516849 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1123511312 15:21002881-21002903 TCCTGGGGAAGAGTTTCCTCTGG - Intergenic
1123578143 15:21693652-21693674 CCCTGGGGAAGAGTTTCCTCTGG - Intergenic
1123614768 15:22136134-22136156 CCCTGGGGAAGAGTTTCCTCTGG - Intergenic
1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123760844 15:23431414-23431436 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124276777 15:28332803-28332825 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1126414115 15:48400084-48400106 CGCTGGGGCAGTGCTTCCCTTGG + Intergenic
1126979558 15:54226887-54226909 CCCTGGCTCAGGGAGTCCCCAGG + Intronic
1128149636 15:65355163-65355185 CGCGGGGGCCGGGCTTCCCCAGG - Intronic
1128603249 15:69015524-69015546 CCCTAGGGCAGCATTTCTCCAGG + Intronic
1129005379 15:72368614-72368636 TCCTGGGGCAGGGTCTCCTATGG + Intronic
1129190518 15:73934956-73934978 CCCTGAGGCAGGAGTTCCCTGGG + Intronic
1129194183 15:73954425-73954447 TCAGGGGGCAGGGTTTCCTCAGG + Intergenic
1129686909 15:77691496-77691518 CCCTGGGGAAGGGATGTCCCTGG + Intronic
1129888583 15:79056056-79056078 CTCTGAGGCAGGGGTCCCCCAGG + Intronic
1131046189 15:89317618-89317640 CCTTAGAGCAGGGCTTCCCCTGG + Intronic
1132092313 15:98956537-98956559 TCCTGGTGCAGGGCTACCCCTGG - Intronic
1132145025 15:99424527-99424549 CCCTGGGGCACAGACTCCCCTGG + Intergenic
1132363933 15:101242292-101242314 CACTGAGTCAGGGTTTGCCCTGG - Intronic
1202987013 15_KI270727v1_random:427897-427919 CCCTGGGGAAGAGTTTCCTCTGG - Intergenic
1132654571 16:1036501-1036523 CCCTGAAGGAGGGGTTCCCCGGG + Intergenic
1132724154 16:1331668-1331690 CCCTGGGCCTCCGTTTCCCCAGG - Intergenic
1132744597 16:1431468-1431490 CTCTGGGACAGGCTTTCCTCGGG - Intergenic
1132767075 16:1539856-1539878 CCCTGGGGCACGGGGTCCCCGGG - Intronic
1133056833 16:3149632-3149654 CCCTGGGGCAGGCTGAGCCCCGG + Intronic
1134048657 16:11121360-11121382 CACTTGGGCAAGGTTTCCCTAGG + Intronic
1134085803 16:11356804-11356826 CCCTAGGGCAGCTCTTCCCCAGG + Intergenic
1135586516 16:23675947-23675969 CACTTGGGCAGGAGTTCCCCTGG + Exonic
1135639082 16:24104726-24104748 CCCTGGGGCAGGAGTGCACCCGG + Intronic
1136121260 16:28136601-28136623 CAAAGGGTCAGGGTTTCCCCAGG - Intronic
1136232517 16:28894959-28894981 CCCTGTGGCAGGGGCTCCGCAGG - Intronic
1136635870 16:31522557-31522579 CCCAGGGGCAGGGACTCCCCTGG - Intergenic
1136687620 16:32004312-32004334 CCATGAGGCAGGGTGACCCCAGG + Intergenic
1136788229 16:32947863-32947885 CCATGAGGCAGGGTGACCCCAGG + Intergenic
1136881554 16:33905926-33905948 CCATGAGGCAGGGTGACCCCAGG - Intergenic
1137395489 16:48113936-48113958 CCCTGCTGCAGGGTGTCTCCAGG + Intronic
1137538058 16:49342416-49342438 CCCTGGTCCAGGTCTTCCCCGGG - Intergenic
1137569993 16:49559033-49559055 CCCTGGCCCAGGCTTGCCCCAGG + Intronic
1139350128 16:66329699-66329721 CCGTGGGGCAGGTTCTTCCCTGG - Intergenic
1141083610 16:81075843-81075865 CCCTGGGCCTTGGTTTCTCCTGG - Intronic
1141644914 16:85362110-85362132 CCCTGGGGCTGGGATTCCTCTGG + Intergenic
1141808652 16:86358933-86358955 CCCTGGCTCTGGGTTCCCCCCGG + Intergenic
1141982208 16:87557498-87557520 CCCAGGGGCAGGGATTTCCGTGG + Intergenic
1142441691 16:90102573-90102595 CCCAGGGGCAGAGTGCCCCCAGG + Intergenic
1203090460 16_KI270728v1_random:1209520-1209542 CCATGAGGCAGGGTGACCCCAGG + Intergenic
1143586814 17:7854567-7854589 CACTGGGGCAGGGACACCCCGGG + Exonic
1144631002 17:16872468-16872490 TCCTGGGGCAGGGACTCTCCAGG - Intergenic
1146506020 17:33406035-33406057 ACCTGGGCCAGGCTTTGCCCTGG + Intronic
1146627881 17:34447729-34447751 CACTGTGGCAAGGTTGCCCCAGG + Intergenic
1147148604 17:38499981-38500003 CCATGAGGCAGGGTGACCCCAGG + Intronic
1148105715 17:45117885-45117907 CTCTGGGCAAGGGTTTCCTCTGG + Intronic
1148215184 17:45830340-45830362 CCCTGGGCCTGGGCCTCCCCAGG - Intronic
1148842887 17:50510115-50510137 CTCTGAGGCTGGGTCTCCCCAGG - Intronic
1148872023 17:50663876-50663898 CCCAGGGCCAGCCTTTCCCCTGG - Intronic
1149384540 17:56128651-56128673 CACTGGGGCAGTATTTCCCAAGG + Intronic
1149539390 17:57457290-57457312 CCCTAGAGCCGTGTTTCCCCAGG + Intronic
1149603484 17:57908451-57908473 CCCAGGGGCACGGTTTCCTGAGG + Intronic
1150002634 17:61451544-61451566 CCCTGGGCCGCAGTTTCCCCAGG + Intergenic
1150985760 17:70195498-70195520 CCCTGGAACAGGGTTTCTCAAGG - Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1151666792 17:75549771-75549793 CCCTTGGGCAGGGTCCTCCCTGG + Intronic
1152233852 17:79128371-79128393 CCCAGAAGCAGGTTTTCCCCAGG + Intronic
1152339644 17:79716897-79716919 GCCTGGGGCAGGGGTAGCCCAGG + Intergenic
1152528712 17:80904263-80904285 GCCTGGGGCACTGGTTCCCCAGG + Intronic
1152533966 17:80939862-80939884 CCCTGGGGAGGCGTTTCCCAAGG + Intronic
1152799815 17:82325617-82325639 CTATGGGGCAGGGTTCACCCAGG - Intronic
1152805493 17:82353922-82353944 CCCAGGGGCAGTGTTTCCACAGG + Intergenic
1153497345 18:5713005-5713027 CACTGGGGAAGTGTTTCTCCAGG - Intergenic
1153617418 18:6947590-6947612 CCCTGCGGCAGTCTTTCCCGTGG + Intronic
1153796117 18:8623851-8623873 CCCTGGGGCAGGGTGTGGCCAGG - Intronic
1154181416 18:12142763-12142785 CCCTGGGACAGGGCTTCCAGTGG - Intergenic
1154182488 18:12148821-12148843 CCCTGGGACAGGGCTTCCAGTGG + Intergenic
1155231470 18:23779027-23779049 CCCTGGGGCAGGGGCAGCCCTGG + Intronic
1158574978 18:58629147-58629169 CCCTGGGGCTGCATTTCACCAGG - Intergenic
1160123961 18:76153769-76153791 CCCTGGTGCCGGGTTGCCCGTGG - Intergenic
1160329271 18:77977386-77977408 CCCTGGGGCTGCATCTCCCCAGG - Intergenic
1160802455 19:976710-976732 CCCAGGAGCTGGGTTCCCCCGGG - Intergenic
1160871893 19:1281521-1281543 CCCTGGTGCCGGGGTGCCCCAGG + Intergenic
1160965487 19:1745397-1745419 CCTGGGGGCAGGGGCTCCCCAGG - Intergenic
1161069316 19:2252486-2252508 CGCTGGGGTAGGGCTTCCCGGGG + Exonic
1161120222 19:2521548-2521570 CCCTGACCCAGGGTCTCCCCTGG - Intronic
1161226172 19:3146971-3146993 CCCTGGGGCAGGGCCGCACCTGG - Intronic
1161239324 19:3213291-3213313 CCCTGGGGCAGGATCGCGCCTGG + Intergenic
1161262495 19:3345580-3345602 CCCTGGGGCAGGATGGCACCTGG - Intergenic
1161326358 19:3666025-3666047 CCAGGGGGCAGGCTCTCCCCAGG + Intronic
1161338871 19:3729942-3729964 CCCTGGGGAGGGGGTGCCCCTGG - Intronic
1161430478 19:4229447-4229469 CCCTGGGCTGGGCTTTCCCCTGG + Intergenic
1161493743 19:4576390-4576412 CCCTGGGGCAGGACCTCACCTGG - Intergenic
1161522248 19:4731096-4731118 CCCTGCGGCAGGACTTCACCTGG - Intergenic
1161537775 19:4830898-4830920 CCCTGGGGCAGGACTGCGCCTGG + Intronic
1161592465 19:5135043-5135065 CCCTGGTGCTGGGTGGCCCCTGG - Intronic
1161594122 19:5142540-5142562 CCCCGGGGCTGGGTTTCTCCTGG + Intronic
1161653126 19:5497462-5497484 CCCTGGGGCAGGACTGCGCCTGG + Intergenic
1162035725 19:7937676-7937698 TCCAGGGCCAGGGTTTCTCCAGG - Intronic
1162112203 19:8405298-8405320 CCCTGGGACATGGATTCCCCTGG + Intronic
1162135953 19:8555447-8555469 CGCTGGGGCTGAGCTTCCCCAGG + Intronic
1162328784 19:10014173-10014195 CTCTGGGTCAGGGGTTCTCCTGG - Intronic
1162369329 19:10269678-10269700 CCGTGGCGCAGGATTTTCCCAGG + Intergenic
1162430424 19:10625332-10625354 CCCGGTGGCAGGGTGTTCCCAGG + Exonic
1163364504 19:16868566-16868588 GCCTGGGACAGGGTTTTCCAGGG + Intronic
1163399881 19:17085804-17085826 CCCTGGGGATGGCTTTCCTCCGG + Intronic
1163758409 19:19120345-19120367 GCCTGGGGTAGGGTTTGCCTTGG - Intronic
1164051067 19:21586342-21586364 TGCTGGGGCAGGGTGGCCCCTGG + Intergenic
1165066616 19:33232845-33232867 CCCTGGGGCGTGGTCTCCCCTGG + Intergenic
1165435010 19:35790705-35790727 CCCTGGGCCTGGGCCTCCCCAGG + Intergenic
1165454775 19:35904045-35904067 CCCTGAAGCAGGGGGTCCCCAGG + Intronic
1166198060 19:41219494-41219516 CCTTGGGGCAGGGATCCCCTCGG + Intronic
1167367697 19:49063765-49063787 CTCTGGGGCTGGGAGTCCCCAGG + Intronic
1167566810 19:50261891-50261913 GCCTGGGTCTGGGTTTCCCAGGG + Intronic
1168161866 19:54515822-54515844 CACTGGGGCTGGGTCTCTCCTGG + Intergenic
1168294086 19:55370316-55370338 CACAGGGCCAGGGGTTCCCCAGG + Exonic
928316344 2:30249594-30249616 CCCTGTGGCTCTGTTTCCCCAGG - Intronic
928418076 2:31113407-31113429 CTCTGGGCCAAGCTTTCCCCAGG - Intronic
929598148 2:43188882-43188904 CCCTGGGGCGAGGTGTCCCCAGG + Intergenic
930687544 2:54325599-54325621 CCCTGCAGCAGGCTTTTCCCTGG - Intergenic
931107148 2:59068682-59068704 CCCTGTACCAGGGCTTCCCCTGG + Intergenic
931177653 2:59869987-59870009 CCCTGGGGCAGTGTGGCCTCAGG + Intergenic
935098947 2:99973831-99973853 CTCTGGGGCAGGGGTGCCCGGGG + Intronic
935304781 2:101726948-101726970 TCCTGGTGCAGGGTATCACCTGG + Intronic
935365956 2:102291359-102291381 CCCTGGGCCAAAGTTTCCCTGGG - Intergenic
937024875 2:118689662-118689684 GCCTGGGGCAGGGTTGCACGGGG - Intergenic
937337188 2:121069238-121069260 CCCTGGGGCAGGTTGTGCCTGGG - Intergenic
937680016 2:124633720-124633742 CCCTGGAGCAGGTTTTTGCCTGG + Intronic
937919938 2:127121958-127121980 CCCTGGGGCAGGGTGGGCCTAGG - Intergenic
937982184 2:127622264-127622286 CCCTGGGGCTCGGCCTCCCCAGG + Intronic
938062524 2:128264250-128264272 CACTATGGCTGGGTTTCCCCAGG + Intronic
939152792 2:138493327-138493349 CTCTGGGGAAGAATTTCCCCTGG - Intergenic
941431811 2:165422711-165422733 CACAGGGGCAGGGCTTCCCAAGG - Intergenic
941846769 2:170141574-170141596 CCTGGGAGCAGGATTTCCCCTGG + Intergenic
943064797 2:183074280-183074302 CCCTGGGGAAGGCATTTCCCAGG - Intergenic
943575455 2:189626165-189626187 CCCTGGAGCAATGTTTCCACAGG + Intergenic
945178180 2:207064678-207064700 GCCTGGGGCAGGTGTTTCCCAGG - Intergenic
945466089 2:210171565-210171587 CTCTGGTGCAGGGTTTACCTCGG + Intergenic
946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG + Intronic
946758023 2:222965880-222965902 TCCTGGGGCAGGTTTGGCCCAGG - Intergenic
948599413 2:239099872-239099894 CCCTGGGACAGCGTGTCCTCCGG + Intronic
949046579 2:241875020-241875042 CCCTGGATTGGGGTTTCCCCTGG - Intergenic
1169068530 20:2707830-2707852 CCCTGGGGCAGGGTCTCCCTGGG + Intronic
1170011141 20:11725416-11725438 CCCTGGGGAAGGGGGTCCCCTGG - Intergenic
1171327751 20:24310599-24310621 CCCTGGGGTAGGGTGTTCCGTGG + Intergenic
1171366418 20:24627838-24627860 CCCTGGGGCAGGGCCGCCTCTGG + Intronic
1172175969 20:32972077-32972099 CTATAGGGAAGGGTTTCCCCAGG + Intergenic
1172645975 20:36469855-36469877 CCCTTGGGCAACGTTCCCCCAGG - Intronic
1172704307 20:36871953-36871975 TCCTGGGGCAGTGTTCCCTCCGG - Intergenic
1173088924 20:39951855-39951877 CTCTGGGGCAGCTTTGCCCCAGG + Intergenic
1174258499 20:49277259-49277281 CCCTGGGTCAGGGATTCCCCAGG - Intronic
1174546771 20:51331555-51331577 CCCTGGGGCTGGGCAACCCCAGG - Intergenic
1175780639 20:61680069-61680091 CCCTGGGGCAGGGTCCTCCATGG - Intronic
1175862280 20:62156801-62156823 CCCTGGAGCAGGGGAGCCCCAGG - Intronic
1176037941 20:63049424-63049446 CCCTGGGCAAGGGTCGCCCCTGG + Intergenic
1176288978 21:5034246-5034268 CCCAGGAGAAGGGGTTCCCCGGG + Intronic
1177602729 21:23336466-23336488 CGCTGGGGCAGGGCTGCCCAAGG + Intergenic
1178680202 21:34668255-34668277 CCCTGGGTTAGGGTTCTCCCAGG - Intergenic
1178843524 21:36156651-36156673 CGCGGGGGCGGGGTTTCCGCGGG - Intergenic
1179180376 21:39039662-39039684 CCCAGGGGCAGGACTGCCCCCGG + Intergenic
1179629021 21:42665453-42665475 CCCTTGGGCAGGGTGTAGCCAGG - Intronic
1179868256 21:44229358-44229380 CCCAGGAGAAGGGGTTCCCCGGG - Intronic
1180099845 21:45579244-45579266 CCCTGGGACGGGGGTGCCCCTGG + Intergenic
1180099874 21:45579312-45579334 CCCTGGGACACGGGTGCCCCTGG + Intergenic
1180189391 21:46155284-46155306 CCCTGGGTCAGGCACTCCCCAGG + Intronic
1181009738 22:20033185-20033207 CCCAGGGGCTGGCTTTCCTCTGG + Intronic
1181032866 22:20156728-20156750 CTCAGGGGCAGGGTGTCTCCGGG - Intergenic
1181033873 22:20160787-20160809 CACAGGGGCAGGGTGTCCCTGGG + Intergenic
1181042073 22:20196981-20197003 CCCTGGGGCACGGGGACCCCTGG + Intergenic
1181431703 22:22885365-22885387 GGCTGGGGCAGGGTCTGCCCTGG - Intronic
1181509481 22:23382616-23382638 CACAGGGGCAGGGTGTCCCTGGG - Intergenic
1183211755 22:36455453-36455475 CCCTGGGGCCTGCCTTCCCCAGG + Intergenic
1183667788 22:39255215-39255237 CGCTGGGACAGGGTTGCCTCAGG - Intergenic
1183727834 22:39599291-39599313 CACTGGGCCAGAGTCTCCCCGGG + Intronic
1184421933 22:44387167-44387189 CACTGAGGCAGGGTTGCCCCTGG - Intergenic
1185237683 22:49724425-49724447 CCCTCAGGCAGGGTGTCCACGGG - Intergenic
1185322054 22:50205972-50205994 CCATGGGGCAGGGCTGCCCCAGG + Intronic
1185330986 22:50251930-50251952 CGCGGGGGCAGGGTGTCCCCTGG - Intronic
1185373283 22:50470592-50470614 GGCTGGGGCAGAGTTTCCCAGGG - Intronic
1185409625 22:50674864-50674886 CCCAGGGGCCGGGCTTCCCGGGG - Intergenic
949393024 3:3583972-3583994 ACATGGGACAGGGTTTCCCAAGG + Intergenic
950032819 3:9863323-9863345 CCCTGGGGCACGGATCCTCCAGG + Intergenic
950046224 3:9950020-9950042 CCCTGGGGAGGGGCTTTCCCAGG - Exonic
950054141 3:10011653-10011675 CCCTGGGGCACGGATCCCCCAGG + Intergenic
950306045 3:11915837-11915859 CCCTAGGTCATGGATTCCCCAGG + Intergenic
950404809 3:12797598-12797620 CCCTGGGCCTCAGTTTCCCCAGG - Intronic
950416065 3:12869555-12869577 CCCTGGGGCACGGATTCCCCAGG + Intronic
950655727 3:14435122-14435144 CCCTGGGGCAAGGTGACCTCTGG - Intronic
950873004 3:16245461-16245483 CCCTGTGGCAGGATTCCCACAGG - Intergenic
952071495 3:29642561-29642583 GACTGGGGCAGTGTTTCCTCAGG - Intronic
954130572 3:48558675-48558697 GCCTGGGGCAGGGTGTTCCCAGG - Intronic
954994005 3:54865464-54865486 CACTGGGGCTGCCTTTCCCCGGG + Intronic
956238624 3:67104253-67104275 CACAGGGGTAGGGTTTCCCAGGG + Intergenic
961041746 3:123682999-123683021 CCATGAGGAAGGGTTTCCTCTGG - Intronic
961779362 3:129312774-129312796 CCCTGGGGCTGGGTTCCCAAGGG + Intergenic
961785550 3:129344649-129344671 CCCTGGGGCAGGGATCCTCCAGG + Intergenic
962444249 3:135450601-135450623 CTCAGAGGCAGGGCTTCCCCAGG + Intergenic
962653315 3:137517688-137517710 CCCTGGAGGAAGGTTGCCCCAGG - Intergenic
962929089 3:140021123-140021145 CCTCGAGCCAGGGTTTCCCCAGG + Intronic
964729721 3:159851858-159851880 CATTTGGGCAGGGTTTTCCCTGG - Intronic
966913073 3:184569866-184569888 GAATGGGGCAGGGTTGCCCCAGG - Intronic
968055848 3:195691254-195691276 ATCTGGGGTAGGGTCTCCCCAGG - Intergenic
968361950 3:198153540-198153562 CCCAGGGGCAGAGTGCCCCCAGG + Intergenic
968427826 4:534936-534958 CCCTTGATCTGGGTTTCCCCGGG - Intronic
968476849 4:814679-814701 CCCCAGGCCAGGTTTTCCCCAGG + Intronic
968945399 4:3661012-3661034 CCCTGAGACAGCGTTTCCCTGGG - Intergenic
969441248 4:7218000-7218022 CTCTGTGGCCGGGCTTCCCCAGG + Intronic
969574381 4:8028086-8028108 GCCTTGGGCTGGGGTTCCCCAGG + Intronic
970326227 4:14927963-14927985 TCCTGGGGGAAGGATTCCCCAGG - Intergenic
972829836 4:42802414-42802436 CACAGGGGCAGGGCTTCCCAAGG - Intergenic
973008598 4:45044145-45044167 ACCTTTGGCAGGGGTTCCCCAGG - Intergenic
975064452 4:70043020-70043042 CCCAGGGGCAGCGTTTGCCTGGG + Intergenic
976000771 4:80370985-80371007 CCCTGCCGCAGGGTTTTGCCTGG + Intronic
976453579 4:85219762-85219784 CACTGGGGCAGAGCTTCCCAAGG + Intergenic
981240179 4:142467299-142467321 CACAGGGGCAGGGCTTCCTCAGG + Intronic
982284929 4:153724864-153724886 CCCTGGGGCAGGATCACACCTGG - Intronic
982836992 4:160131335-160131357 CCCTGGGGTAGGGGTGCCACAGG - Intergenic
985503738 5:265926-265948 ATCTGGGGTAGGGTTCCCCCAGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
986283260 5:6340730-6340752 CCCTGGGGCATGCTTTCCTCAGG - Intergenic
986724758 5:10585932-10585954 CCCTGTGCCAGGCTTTCCGCAGG + Intronic
987063957 5:14269685-14269707 CCCTGTAGCAGGGCTTGCCCGGG + Intronic
991689627 5:69213680-69213702 CCATGGGGTAGGGCTGCCCCGGG + Intergenic
993084547 5:83348060-83348082 CACAGGGGCAGAGTTTCCCAAGG - Intronic
994452020 5:99955402-99955424 CCCTGGGTCAGGGTCGCCCTAGG + Intergenic
996071546 5:119137095-119137117 CACAGGGGCAGAGTTTCCCAAGG + Intronic
998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG + Exonic
998129082 5:139642308-139642330 ACCTGGGGGAGGGTTGCCCTCGG + Intergenic
998402655 5:141855993-141856015 GCCTGGGACAGGGGCTCCCCTGG + Intronic
999238776 5:150115511-150115533 CTCTGAGCCAGGGTTCCCCCAGG - Exonic
999288225 5:150406882-150406904 CCCTGGGGCAGGGCTCCCATGGG + Exonic
1001303041 5:170551515-170551537 TCCTGGGCCAGGGCTTCCCCAGG + Intronic
1001734852 5:173989395-173989417 GCCTGGGGCAGGCTGTCGCCAGG + Exonic
1001957781 5:175860109-175860131 CCCTCGGGCAGGCCCTCCCCAGG + Intronic
1002468690 5:179421849-179421871 CCCAGAGGCTGGGTTTCCCCAGG - Intergenic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1002620128 5:180482216-180482238 GCCTAGGGCAGGGGTTCCCCAGG + Intergenic
1002843470 6:925503-925525 TCCTGGGTGAGGGTTTCCCAAGG - Intergenic
1004186448 6:13425445-13425467 CCCTGGGGCTGATGTTCCCCAGG + Intronic
1006038533 6:31233966-31233988 ACCTTTTGCAGGGTTTCCCCAGG + Intergenic
1006305354 6:33215268-33215290 CCCTGAGGGAAGGTTCCCCCAGG + Intergenic
1006461654 6:34162639-34162661 CCCTGGGGCAGCCGTTCCCGCGG - Intergenic
1006849547 6:37087888-37087910 CCATGGGGCAGGTTTTGACCTGG + Intergenic
1009413387 6:63392253-63392275 CCCTAGGCCAGGGTTTGCCATGG - Intergenic
1010205075 6:73315173-73315195 CCCTGGTGTTGGGTGTCCCCTGG + Intergenic
1011702436 6:89968189-89968211 TCCTTTGCCAGGGTTTCCCCTGG - Intronic
1014290447 6:119551985-119552007 GCATGGGGACGGGTTTCCCCAGG - Intergenic
1014752213 6:125268795-125268817 CAGTTGGGCAGGGGTTCCCCTGG - Intronic
1017344869 6:153369351-153369373 CCCTGTGACAGAGTTTCCACAGG + Intergenic
1018429648 6:163713220-163713242 CTCTGGCTCAGGGCTTCCCCTGG + Intergenic
1018858050 6:167689505-167689527 CCCAGCAGCAGGGTCTCCCCAGG - Intergenic
1019008800 6:168825533-168825555 CCCAGGGCCAGGGTTTGACCAGG - Intergenic
1020279492 7:6643105-6643127 AACCTGGGCAGGGTTTCCCCCGG + Intronic
1023727941 7:43163651-43163673 CCCTGGGAAAGAGTTGCCCCAGG + Intronic
1024047011 7:45591803-45591825 CCCTGGGTCAGGCTGGCCCCAGG + Intronic
1026296505 7:69057523-69057545 CACTGGGGCTGGGTCTCCACTGG - Intergenic
1029113242 7:98223967-98223989 CCCAGGGGCAGGGGTCTCCCTGG + Intronic
1032262733 7:130350106-130350128 AGCTGGGGCAGGGCTTCACCTGG - Exonic
1032500613 7:132396968-132396990 TCTTGGGGCAGGATTTCCCTAGG - Intronic
1035393942 7:158523519-158523541 CCCTGGAGCAGAGTCTGCCCTGG + Intronic
1035393958 7:158523596-158523618 CCCTGGAGCAGAGTCTGCCCTGG + Intronic
1035662815 8:1360276-1360298 CTCTGGGGCGGGGCTTCTCCGGG + Intergenic
1036121414 8:6021484-6021506 TCGTGGGGCTGGTTTTCCCCTGG - Intergenic
1036760769 8:11507321-11507343 CCCAGGGGCAGGGTTTGCCAAGG - Intronic
1039349179 8:36742684-36742706 GCCTGGTGCCGGGGTTCCCCAGG + Intergenic
1039424112 8:37471511-37471533 TCCTGGGCCAAGGTTTCCCCTGG + Intergenic
1040285392 8:46098095-46098117 CACTGGTGCAGGGTTCTCCCAGG + Intergenic
1040734605 8:50490679-50490701 CCCTGGGGCTGGGCTGCCCGGGG - Intronic
1040902042 8:52427509-52427531 GCCTGCCGCAGGTTTTCCCCTGG - Intronic
1040954463 8:52965473-52965495 CCCTGGGGCATGGTGAGCCCAGG - Intergenic
1044125249 8:88451907-88451929 CACAGGGGCAGAGTTGCCCCAGG - Intergenic
1045326650 8:101122300-101122322 CCCAGAGGCAGGGTTACTCCAGG + Intergenic
1045350368 8:101332826-101332848 CGCTGGGACAGCATTTCCCCAGG - Intergenic
1048738836 8:137531961-137531983 CCCTGCAGCAGGGTTCCGCCTGG - Intergenic
1049355690 8:142187050-142187072 CCCTGGGCCAGGGTGTGGCCGGG + Intergenic
1049508708 8:143017402-143017424 CCCAGAGGCAGGGACTCCCCCGG + Intergenic
1049571296 8:143371446-143371468 CCCTGGGCCAGGCAGTCCCCAGG - Intronic
1049692082 8:143965884-143965906 CCCTGGGGAAGGAGTTCCCTGGG - Intronic
1049799518 8:144511343-144511365 CCCTGTGGCAGGTTTTGCCCAGG + Exonic
1050133913 9:2441725-2441747 TCCTTGGGCAGGGTTTGCCATGG + Intergenic
1052997847 9:34560768-34560790 GCCTGTGGCAGGGTGTCCCTGGG + Intronic
1053364330 9:37511950-37511972 CCCTGGGGCAGCCTTTCCATGGG + Exonic
1055468718 9:76590858-76590880 CTCTGGGGCAGGAATCCCCCAGG - Intergenic
1056077875 9:83060129-83060151 CCCTGGGGCAGACTGTCCCCAGG + Intronic
1056750665 9:89348733-89348755 CCATGGGGCAGGGTCTCCTGGGG - Intronic
1056773348 9:89495500-89495522 CCCTGGGCCAGGGTCCGCCCTGG - Intronic
1057336113 9:94156551-94156573 CCCTGAGGCAGGGAGGCCCCAGG - Intergenic
1057800108 9:98185797-98185819 CCTTGGGCCAGGGTCTCTCCTGG - Intronic
1060277089 9:122190700-122190722 CCCTGTGGCAGGCTTTGCCTAGG + Intronic
1060439495 9:123625896-123625918 CCCTGTCGCACGGTTCCCCCTGG - Intronic
1060508313 9:124214737-124214759 CCCTGGGGGAGGGCCTCCCCTGG + Intergenic
1060521599 9:124297177-124297199 ACCTGGGGCAGGGATGACCCTGG + Intronic
1060745052 9:126125893-126125915 GCATGGGGCAGGGTTTTTCCAGG + Intergenic
1061138562 9:128750866-128750888 CTCTGGGGCAAGGTTTAGCCTGG + Intronic
1061294138 9:129667748-129667770 CTCTGGTGGCGGGTTTCCCCGGG + Intronic
1061808917 9:133151325-133151347 CCCTGGGTCAGGATGGCCCCAGG - Intergenic
1062368806 9:136225971-136225993 CCCTGGGGCAGGGCTGACACCGG + Intronic
1062398626 9:136362910-136362932 CACTAGGGCAAGGTTCCCCCAGG + Intronic
1062398735 9:136363283-136363305 CCCTGGGGCGGGGCCTTCCCGGG - Intronic
1062453439 9:136625023-136625045 CCCTGGGCCTCGGTTTCCCCAGG - Intergenic
1062510412 9:136902286-136902308 CCCAGGGTCAGGGTCTCCCTGGG + Intronic
1062704064 9:137925085-137925107 CCCTTGGCCAGGTTTTCCCTGGG - Intronic
1062746668 9:138217361-138217383 CCCAGGGGCAGAGTGCCCCCAGG + Intergenic
1186131068 X:6465771-6465793 CCCTGTGGCACAGATTCCCCAGG - Intergenic
1189652239 X:43203184-43203206 CCCTGGGACAAGGTTTCCAGAGG - Intergenic
1189853450 X:45199642-45199664 AACTGGGGAAGGGCTTCCCCAGG - Intronic
1190491631 X:50988492-50988514 CCCTGTGGCAGTGTTGCCCTGGG + Intergenic
1192035234 X:67555802-67555824 CCCCGTGGCAGGATTTCCCTGGG + Intronic
1193051964 X:77111409-77111431 CCCTGGGACAGAGTTTCCAGAGG + Intergenic
1194098320 X:89671580-89671602 CTCTGTGGGAGGATTTCCCCTGG + Intergenic
1194668687 X:96704366-96704388 CCCTTGGGCAGGGGCTCCCCTGG + Intronic
1199575513 X:149310354-149310376 CCTTGGGGCAGAATTTACCCAGG - Intergenic
1199603332 X:149556597-149556619 CCTTGTGGCAGGCTTTTCCCTGG - Intergenic
1199647055 X:149922878-149922900 CCTTGTGGCAGGCTTTTCCCTGG + Intergenic
1200451341 Y:3332958-3332980 CTCTGTGGGAGGATTTCCCCTGG + Intergenic
1201179801 Y:11333261-11333283 GGCTGGGGCAGGGGTTCCCAGGG + Intergenic