ID: 1002593418

View in Genome Browser
Species Human (GRCh38)
Location 5:180306496-180306518
Sequence CCACCCTCTGGGCAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 9, 3: 53, 4: 458}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002593412_1002593418 -5 Left 1002593412 5:180306478-180306500 CCCTGCACGGCTCTCTGCCCACC 0: 1
1: 0
2: 1
3: 23
4: 301
Right 1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG 0: 1
1: 0
2: 9
3: 53
4: 458
1002593410_1002593418 8 Left 1002593410 5:180306465-180306487 CCGAGATGCAGGACCCTGCACGG 0: 1
1: 0
2: 0
3: 19
4: 109
Right 1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG 0: 1
1: 0
2: 9
3: 53
4: 458
1002593413_1002593418 -6 Left 1002593413 5:180306479-180306501 CCTGCACGGCTCTCTGCCCACCC 0: 1
1: 0
2: 4
3: 46
4: 386
Right 1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG 0: 1
1: 0
2: 9
3: 53
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002593418 Original CRISPR CCACCCTCTGGGCAGCCCTG TGG Intronic
900176789 1:1294660-1294682 CCAGCCCCTGGGCAGCCCCGGGG - Intronic
900198161 1:1387925-1387947 CAGCCACCTGGGCAGCCCTGGGG + Intronic
900205734 1:1431241-1431263 CCACCATCTGGGAAGCCAGGAGG + Intergenic
900412470 1:2519034-2519056 CCACCCTCCAGGCCTCCCTGGGG + Intronic
900432426 1:2609235-2609257 CTACCCTAGGGGCAGCCATGGGG + Intronic
900525147 1:3124863-3124885 CTCCCATCCGGGCAGCCCTGTGG + Intronic
901402860 1:9026234-9026256 CCACCAGCTGTGCAGACCTGTGG - Intronic
901458385 1:9376887-9376909 CCTCACTCTGGGGAGGCCTGTGG + Intergenic
902227530 1:15006111-15006133 CCACTCACTGGCCAGCCCAGGGG + Intronic
902569612 1:17338750-17338772 CCACCCCCTTAGCAGCCCAGAGG - Intronic
903193373 1:21668825-21668847 CCACCCTCTGGGGGGCGCTAGGG + Intronic
903215146 1:21839591-21839613 CCACCCTCTGCGGGTCCCTGAGG - Intronic
903389758 1:22955410-22955432 CAGCCTTCTGGGCAGCCCTAGGG + Exonic
903724342 1:25430129-25430151 CCACAGGCTGGGCAGCGCTGTGG - Intronic
903829265 1:26164861-26164883 CCCCCCTGAGGGAAGCCCTGGGG + Intergenic
903931174 1:26863374-26863396 GCACCCTCCAGGCAGCCCTCTGG - Exonic
904120265 1:28193633-28193655 CCAGAATCTGAGCAGCCCTGGGG + Intronic
904480402 1:30789678-30789700 CCACCCTCTTCTCAGTCCTGGGG - Intergenic
904493811 1:30875868-30875890 CCACCCCACGGGCAGCACTGTGG - Intronic
904593238 1:31626964-31626986 CCTCGCTCAGGGCAGCACTGTGG - Exonic
904599853 1:31667377-31667399 CCCTCCCCTTGGCAGCCCTGCGG + Intronic
904944377 1:34188706-34188728 CCACCCTCCGGGCCGCAGTGAGG - Intronic
905517073 1:38569794-38569816 CCTTTCCCTGGGCAGCCCTGTGG + Intergenic
905583193 1:39097778-39097800 CCAGCATCAGGGCAGTCCTGGGG - Intronic
907525090 1:55049452-55049474 CCAGCCTCTGGAAAGCTCTGTGG - Intronic
910091644 1:83471588-83471610 CCACCCACTGAGCAAGCCTGCGG + Intergenic
910450549 1:87339444-87339466 CCAGACTCTGGGCATCCCTTTGG - Intronic
912337529 1:108876856-108876878 CCCCCCTCTTCGCAGTCCTGGGG - Exonic
912480717 1:109980521-109980543 CCACCCTCTGGGGGTCCCTAAGG + Intergenic
913069147 1:115284028-115284050 CCTCCCTCTCGGCTGCCCAGGGG + Intergenic
913286986 1:117235703-117235725 CCCACCTCAAGGCAGCCCTGCGG + Intergenic
913609449 1:120495897-120495919 CAACCATCAGGGCAGCCCAGAGG + Intergenic
913936978 1:125064611-125064633 ACACCGTCCGGGCAGGCCTGAGG + Intergenic
914581742 1:149025942-149025964 CAACCATCAGGGCAGCCCAGAGG - Intronic
915137512 1:153743621-153743643 CAGCCCTCTTGGCAGCCCTTAGG + Intronic
915466094 1:156098928-156098950 ACAGCCTCTGGGCACCCCAGGGG - Intronic
915593959 1:156885942-156885964 ACCGCCTCTGGGCAGCCCTCCGG + Intergenic
916577336 1:166079469-166079491 CCACCCTCTGGCCACCCCGTGGG - Intronic
917795548 1:178530303-178530325 CCACCTTCTGGGCTGGCCTGTGG - Intronic
918038747 1:180899337-180899359 GCTCCCTCTTGGAAGCCCTGTGG - Intergenic
919737905 1:200965104-200965126 CCATCCGCTGGGCAGCTGTGTGG + Intergenic
919886754 1:201940532-201940554 CCACCCTCAGTGCTGCCCTCTGG - Intronic
920196245 1:204229045-204229067 CCAACCTGGAGGCAGCCCTGCGG - Exonic
920650088 1:207831189-207831211 CCCCTCTCTGTGCAGCCCTTGGG - Intergenic
921624526 1:217363710-217363732 CCACCTTGTGAGCTGCCCTGTGG + Intergenic
922215568 1:223516827-223516849 AGAGCCTGTGGGCAGCCCTGGGG + Intergenic
922422031 1:225466619-225466641 CCACAGACAGGGCAGCCCTGAGG + Intergenic
922675833 1:227548272-227548294 CCACCCTCTGCAGAGCTCTGTGG - Intergenic
923198575 1:231690861-231690883 CCACCTTCTGGGAAGGCCAGTGG + Intronic
923413366 1:233731452-233731474 CCACCCAGTGGGCAGGCCAGTGG + Intergenic
924598266 1:245465750-245465772 CCAGCCGCTGGGGAGGCCTGAGG + Intronic
1062939840 10:1412979-1413001 CCACCCTCCCGCCAGCCCTGAGG - Intronic
1064491253 10:15859958-15859980 CCATCCTCCGGGCTGCCCTTCGG - Intronic
1064851432 10:19713355-19713377 CCACACTCTGAGTAGCTCTGTGG + Intronic
1066338526 10:34505581-34505603 ACACCCTACAGGCAGCCCTGTGG + Intronic
1067042608 10:42962927-42962949 TCTCCCTCTGGTCAGCTCTGGGG - Intergenic
1067274558 10:44822106-44822128 CAGCCCTGGGGGCAGCCCTGTGG - Intergenic
1069490572 10:68857192-68857214 CCACCCTGGGGTAAGCCCTGGGG - Intronic
1069565645 10:69461707-69461729 CCAGCCTCTGGCCCACCCTGTGG + Intronic
1069719673 10:70541457-70541479 CCCACCTCGGGGAAGCCCTGAGG - Exonic
1069863664 10:71486885-71486907 CGACCCTCTGGGGAGCCCTGGGG + Intronic
1069864332 10:71492174-71492196 CCAATCTCTGGGCAGCCCCTTGG + Intronic
1070689835 10:78516384-78516406 CCACCCCTTGGGCAGAGCTGTGG + Intergenic
1071457451 10:85861788-85861810 CCACCCTCTGACCAGCTCAGGGG + Intronic
1072230847 10:93412873-93412895 CCAGCCTCGGGGAAGCACTGGGG + Intronic
1072733514 10:97864111-97864133 CTTCCCTCAGGGCTGCCCTGTGG + Intronic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1073405009 10:103289910-103289932 CCACCAACTGTGCAGCCATGGGG - Exonic
1073555657 10:104448257-104448279 CCAGCCACTGCCCAGCCCTGAGG + Intronic
1075655060 10:124155888-124155910 CCAGCCGCAGGTCAGCCCTGTGG + Intergenic
1076177226 10:128377368-128377390 CCACCCTGTGGGAGGCCGTGGGG - Intergenic
1076544860 10:131238447-131238469 CCACACTCAAGGCAGCACTGGGG + Intronic
1076667907 10:132103290-132103312 TGACCCTCTGGGCAGCCAAGAGG + Intergenic
1076689261 10:132212948-132212970 ACACCTCCTGGGCAGCTCTGGGG + Intronic
1076853406 10:133103887-133103909 CCATCCTCTGGGGTTCCCTGGGG + Intronic
1077032697 11:476752-476774 CCTCCCACTGGGCAGGACTGGGG + Intronic
1077214049 11:1387903-1387925 CAACCCTCACTGCAGCCCTGAGG - Intergenic
1077434333 11:2531528-2531550 CCACTGTCTGCGCATCCCTGGGG + Intronic
1077444819 11:2586066-2586088 CCACCCTCTGGGCACCTCAGCGG - Intronic
1078007076 11:7540214-7540236 CCACCCTCCTGGCAGCAGTGTGG + Intronic
1078929970 11:15905465-15905487 CCAGCCTGGGGGCAGCTCTGTGG - Intergenic
1079366351 11:19813572-19813594 CAACCCACTGGGCGGCCCTCTGG - Intronic
1082004258 11:47410967-47410989 CAACCCTCAGAGCAGCCCTGCGG + Intronic
1083431480 11:62615622-62615644 CCACATCCTGGGCAGGCCTGGGG + Exonic
1083856109 11:65393908-65393930 CCACCCTCTGCACGGCCCTCCGG + Intronic
1084562220 11:69911441-69911463 CCACCGGCTGGACAGCACTGAGG + Intergenic
1084676379 11:70637783-70637805 CCACACTCTAGGCTGCCCAGGGG + Intronic
1084742967 11:71150991-71151013 CCACCCACCTGGCAGCCATGTGG + Intronic
1084892924 11:72245212-72245234 CCTCCCTCTCCGCAGCCCCGTGG - Intronic
1089128092 11:116191439-116191461 CCAGCCACTGGGCTTCCCTGGGG - Intergenic
1089257237 11:117200399-117200421 TCACCCACTGGGCAGCTCAGGGG + Intronic
1089348689 11:117808966-117808988 TGACCACCTGGGCAGCCCTGGGG - Intronic
1089731611 11:120522844-120522866 CAACCCTCAGCGCAGCCCTGTGG - Intronic
1089912394 11:122114755-122114777 CCAGCTTCTGAGCTGCCCTGCGG + Intergenic
1090390274 11:126383450-126383472 CCAGCCCCCGGCCAGCCCTGAGG + Intronic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1090968132 11:131616197-131616219 GCATCCTCTGCGCAGCACTGGGG + Intronic
1091284077 11:134398396-134398418 CTACTCTCTCTGCAGCCCTGGGG + Intronic
1091310567 11:134572740-134572762 ACAGCCTCTGGTCAGTCCTGAGG - Intergenic
1091649750 12:2301168-2301190 CCACCATCAGCTCAGCCCTGGGG - Intronic
1091938158 12:4449996-4450018 CCTCCTGCTGGGCAGCCCGGGGG + Intergenic
1092066248 12:5591853-5591875 CCTCCCCCGGGGCAGCGCTGTGG - Intronic
1092428601 12:8392168-8392190 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1092429681 12:8398312-8398334 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1093746009 12:22741818-22741840 CCACCCTCAGGGCAACCCTGAGG - Intergenic
1095049197 12:37541869-37541891 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1095049570 12:37544053-37544075 ACACCGTCTGGGCAGGCCTGAGG - Intergenic
1095986717 12:48004291-48004313 CCAGCGTCTGGGGAGCCCCGAGG + Exonic
1096229954 12:49891203-49891225 CCACCCACAGGGCAGCCAGGAGG + Intronic
1096779026 12:53981750-53981772 CCAGCCCTTGGGCTGCCCTGTGG + Intergenic
1096801319 12:54112526-54112548 CCGCCATCTGGGCAGCTCAGAGG - Intergenic
1096981953 12:55733208-55733230 CTACTCTCTGGAGAGCCCTGCGG - Intergenic
1103210868 12:119165420-119165442 CCACCGCCTGGGCAGCCCTGGGG + Intergenic
1103700470 12:122846556-122846578 CCACTGGCTGGGCAGCCCTCAGG + Intronic
1103741951 12:123096970-123096992 CCCCACTCTGGGGAGTCCTGGGG - Intronic
1103891544 12:124242608-124242630 CAGCCCTCTGGGCAGCCCCCAGG - Intronic
1103946993 12:124532307-124532329 ACACCCACTTGGCAGCTCTGTGG - Intronic
1103960958 12:124609174-124609196 CCCTCCCCTCGGCAGCCCTGAGG + Intergenic
1104581812 12:130016338-130016360 CCATCCCCTGGGCAGTCCAGGGG - Intergenic
1104845668 12:131845538-131845560 CCAGCCTCTGGGCAGACGTAGGG - Intronic
1104961676 12:132490958-132490980 CCGCGCCGTGGGCAGCCCTGAGG + Intronic
1105406978 13:20141561-20141583 AGACCCTCTGGGCCGCCCAGAGG + Exonic
1106128563 13:26920985-26921007 CCAGCCTCTGGGAAGCCTGGGGG - Intergenic
1107829655 13:44363019-44363041 CTACCATCTGGGCAGCCCATGGG - Intergenic
1108483467 13:50900458-50900480 CCACCCCTTGGCCAGCCCTTTGG + Intergenic
1109918845 13:69028517-69028539 CAACCCTCAGAACAGCCCTGTGG - Intergenic
1112203738 13:97303336-97303358 CCACCCATTGCCCAGCCCTGAGG - Intronic
1112326099 13:98443707-98443729 CCACAGGCTGGGCAGCCCTCTGG - Intronic
1112369030 13:98778640-98778662 CCACCCTCTGGACATGGCTGAGG - Intergenic
1112396201 13:99034569-99034591 CCATCCTCATGGCACCCCTGAGG - Intronic
1113416225 13:110130752-110130774 TCCCCCTCTCTGCAGCCCTGAGG - Intergenic
1113572757 13:111370443-111370465 TGTCCCTCTGAGCAGCCCTGTGG + Intergenic
1113939136 13:114009609-114009631 TCGTCCTCCGGGCAGCCCTGCGG - Intronic
1114689210 14:24564428-24564450 TCAGCCTCTGGGCAGACCTCAGG - Intergenic
1118747011 14:68781569-68781591 TCACCCTCTCTGCAGCCCAGGGG - Intergenic
1119841229 14:77794644-77794666 CCAGCCTCTGGGGAGCCAGGAGG + Intergenic
1121033485 14:90679482-90679504 CAACCCCCGGGGCAGCCCAGGGG - Intronic
1121553691 14:94820620-94820642 CCACCCTGTGGCTTGCCCTGGGG - Intergenic
1121625707 14:95384217-95384239 TCACCCTCTGGGCAGCACCCTGG + Intergenic
1122580321 14:102767727-102767749 CCAGGCTGTGGGCAGCCCTGGGG + Intergenic
1122606952 14:102953120-102953142 CGACCCTCTGTTCAGCCTTGGGG - Intronic
1122853249 14:104547937-104547959 CCAGCCTCTGGCCACACCTGGGG - Intronic
1122919458 14:104874061-104874083 CTGCCCCGTGGGCAGCCCTGAGG - Intronic
1123008059 14:105333858-105333880 ACCCCCTCTGGGAAGGCCTGTGG - Intronic
1124239764 15:28019657-28019679 CGGCCCTCTGGCCTGCCCTGTGG - Intronic
1124632446 15:31345347-31345369 CCACCCTGTGTGCTGCTCTGGGG + Intronic
1127842912 15:62846091-62846113 TCTCCCACTGGGCAGCTCTGTGG - Intergenic
1127874965 15:63104137-63104159 CCTTCCTCTGGGAATCCCTGAGG + Intergenic
1128222517 15:65979279-65979301 CCACCCCCTTGTCAGCTCTGGGG + Intronic
1128742734 15:70095451-70095473 CCTCTCTCAGGGCCGCCCTGCGG + Intronic
1129448726 15:75637266-75637288 CCACAATCTTGGGAGCCCTGAGG + Intergenic
1129691328 15:77715269-77715291 CCACGCCCTGCTCAGCCCTGAGG - Intronic
1130051894 15:80490632-80490654 CCAGGCTGTGGGCAGCCCCGAGG - Intronic
1130063281 15:80584702-80584724 GTGCCCTCTGTGCAGCCCTGGGG + Intronic
1131344222 15:91631134-91631156 CCACCCTCTGGGCTGGCCCTGGG - Intergenic
1132010165 15:98268179-98268201 CCAGCCTCTGTGCAACCCTGGGG - Intergenic
1132215297 15:100057750-100057772 CCAGTCTCTGGGAAACCCTGTGG - Intronic
1132584062 16:698471-698493 CACCCCTCTGGGCAGGCCAGGGG + Intronic
1132602408 16:779555-779577 GCACCTGCTGGGCAGCCCCGGGG + Intronic
1132671445 16:1103676-1103698 CCATCCCCTGGGCAGCCCTCAGG + Intergenic
1132772484 16:1571918-1571940 CCATCCACTGGGGAGCTCTGGGG + Intronic
1132849745 16:2019698-2019720 CCCCCATCTGGGGAGCCCAGCGG + Exonic
1133102832 16:3489580-3489602 GCTCACTGTGGGCAGCCCTGTGG - Intergenic
1133284912 16:4686244-4686266 CCCCTCTCCGCGCAGCCCTGGGG + Intronic
1133297690 16:4762883-4762905 CCTCCCTCTGCCCAGCCGTGTGG + Intronic
1135869590 16:26137028-26137050 CTACTCTTTGAGCAGCCCTGTGG - Exonic
1136247984 16:28986032-28986054 CCACACCCTGGACAGGCCTGGGG - Intronic
1136298586 16:29318057-29318079 CCCACTTCTGGGCAGCCCTCGGG - Intergenic
1136513415 16:30753317-30753339 CCACCCCCTGCTCACCCCTGGGG - Intronic
1137061562 16:35795315-35795337 ACACCATCTAGGCAGGCCTGAGG + Intergenic
1138246512 16:55470802-55470824 GCTCCCTCTGGTCAGCCCTCTGG + Intronic
1139491781 16:67289824-67289846 CCACCCTGTGAGATGCCCTGGGG - Intronic
1139670492 16:68489969-68489991 CCACCCCTGGGGCAGTCCTGGGG - Intergenic
1141440361 16:84025962-84025984 ACACTCTCAGGTCAGCCCTGTGG + Intronic
1141703561 16:85653156-85653178 CCCCCATCTGGGCCGCCCTGAGG + Intronic
1141850934 16:86645568-86645590 CCCTCCTGTGGGCAGCCCCGAGG + Intergenic
1141850937 16:86645572-86645594 CCACCCTCGGGGCTGCCCACAGG - Intergenic
1142060243 16:88024553-88024575 CCCACGTCTGGGCAGCCCTCAGG - Intronic
1142160742 16:88556128-88556150 CCACACTCTGGGGAACCCTTTGG - Intergenic
1142281480 16:89150475-89150497 CCACGCAGAGGGCAGCCCTGAGG - Intronic
1142495229 17:302665-302687 ACACCTGCTGGGCAGGCCTGGGG - Intronic
1142962129 17:3557613-3557635 CCACGCTCTGGGCTCCCCAGGGG + Intronic
1143239706 17:5433629-5433651 CTAGCCTCTTGGCACCCCTGGGG - Intronic
1144263499 17:13546015-13546037 CCAGCCTCTTGCCAGCTCTGGGG + Intronic
1144671490 17:17135097-17135119 CCATCCTGTTGGCAGCCCTCTGG + Intronic
1145009958 17:19362425-19362447 CAACCCCCCGGGCTGCCCTGTGG - Intronic
1145272484 17:21412269-21412291 ACACCATCTGGGCAGGTCTGCGG + Intronic
1145294017 17:21574244-21574266 ACACCGTCCGGGCAGGCCTGAGG + Intronic
1145306532 17:21678589-21678611 ACACCGTCTGGGCAGGCATGAGG + Intergenic
1145306998 17:21680915-21680937 GCACCATCTGGGCAGGCCTGAGG + Intergenic
1145307226 17:21682080-21682102 ACACCGTCTGGGCAGGCCTGAGG + Intergenic
1145307449 17:21683245-21683267 ACACCGTCTGTGCAGGCCTGAGG + Intergenic
1145307676 17:21684410-21684432 ACACCGTCTGGGCAGGCCTGAGG + Intergenic
1145307911 17:21685575-21685597 GCACCGTCTGGGCAGGCCTGAGG + Intergenic
1145310694 17:21699732-21699754 ACACCATCTGGGCAGGTCTGGGG + Intronic
1145370201 17:22301148-22301170 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1147552636 17:41455185-41455207 CCTCCCTCTGCCCAGCCCTCTGG - Intergenic
1150246429 17:63679110-63679132 CAACCCTCTGGCCAGGCATGGGG + Intronic
1151654537 17:75489741-75489763 CCTCCCTCTCTGCAGCCCAGAGG + Intronic
1152072081 17:78138885-78138907 CCACCCTCTGGGCTGCCATGGGG + Intronic
1152190523 17:78884934-78884956 CCACCCTGAGAGCTGCCCTGGGG - Intronic
1152606296 17:81292612-81292634 CCTCCCTCTGGGCAGCCCTCAGG + Intronic
1152638698 17:81440648-81440670 CCACACTCCCGGCTGCCCTGGGG - Intronic
1152643085 17:81457269-81457291 TCACCCTCTGGGCCGCTCTGTGG - Intronic
1152821778 17:82441222-82441244 CCTCCATCTGCGCAGCTCTGTGG + Exonic
1152935457 17:83134177-83134199 CGACGCTCAGGGCGGCCCTGCGG + Intergenic
1152935593 17:83134905-83134927 CGACGCTCAGGGCGGCCCTGCGG + Intergenic
1152935707 17:83135529-83135551 CGACTCTCAGGGCAGCCGTGCGG + Intergenic
1153915879 18:9743697-9743719 CCACCCTCTGGGAAGCCACAGGG + Intronic
1154074752 18:11189043-11189065 ACACCATCAGGGCAGGCCTGAGG + Intergenic
1154315885 18:13303097-13303119 CTTCCCTGTGGGCAGCTCTGAGG - Intronic
1155238784 18:23846403-23846425 CCACCCTCAGGGCTGCAGTGAGG - Exonic
1157433674 18:47651295-47651317 CGTCCCTCTGGGCAGTCCTCTGG - Intergenic
1158648303 18:59266259-59266281 CCACCCTCAGAGCTGCCCTGCGG + Intergenic
1159729933 18:72013488-72013510 CCATACTCTGTGCATCCCTGGGG - Intergenic
1160011716 18:75111183-75111205 ACACCCTCAGGGGACCCCTGGGG - Intergenic
1160437999 18:78866312-78866334 CCTCCCTCTAGCCAGCTCTGAGG - Intergenic
1160438025 18:78866437-78866459 CCTCCCTCTAGCCAGCTCTGAGG - Intergenic
1160438094 18:78866772-78866794 CCTCCCTCTAGCCAGCTCTGAGG - Intergenic
1160697849 19:493326-493348 CCACCCACTGGTCAGTTCTGGGG - Intronic
1160769234 19:822700-822722 CCTCCATATGCGCAGCCCTGCGG + Intergenic
1160969169 19:1759827-1759849 CCACACTCCGTGCATCCCTGTGG - Intronic
1161272470 19:3397650-3397672 CCACCCAGTGGGCTGCCCGGAGG + Intronic
1161273913 19:3404886-3404908 CCCGCCTCTGGGGACCCCTGGGG - Intronic
1161299762 19:3537080-3537102 GCCCCATCTGGCCAGCCCTGGGG - Intronic
1161567484 19:5011755-5011777 CCACCCGAGGGTCAGCCCTGGGG + Intronic
1161570883 19:5030401-5030423 TCACCCTGTGGCCAGTCCTGTGG + Intronic
1162066145 19:8126493-8126515 CCACCCTCGGGGCAGCCTGGGGG - Exonic
1162756829 19:12865793-12865815 CAACCCTCTGGTCAGGCTTGGGG + Exonic
1162947877 19:14054641-14054663 TCACCCTCAGGGCTGCCCTGGGG + Exonic
1163290046 19:16373298-16373320 CCAGCATCTGGGAAGCCCTGGGG + Intronic
1164078240 19:21840200-21840222 CCCCCCTGTGGGCAGTGCTGAGG + Intronic
1164181346 19:22821564-22821586 CCACTCTGTGGGCAGGGCTGTGG - Intergenic
1164205436 19:23054628-23054650 CCACCCTGTGGGCAGCACCAAGG + Intergenic
1164314377 19:24074018-24074040 CCTCCCTGTGGGCAGTGCTGAGG - Intronic
1164596439 19:29533466-29533488 CCACCTTCTGGGCACCCCAAAGG - Intronic
1164876817 19:31696746-31696768 CAACCCCCAGGCCAGCCCTGGGG + Intergenic
1165169360 19:33880275-33880297 CCTCCTTCTGGCCAGCCCAGGGG + Intergenic
1165334797 19:35162212-35162234 CCAGCCTCTAGGCAACCCAGAGG - Intronic
1165595364 19:37008056-37008078 ACACCGTCCGGGCAGGCCTGAGG - Intronic
1165683327 19:37796390-37796412 ACACCGTCCGGGCAGGCCTGAGG + Intronic
1165755131 19:38288529-38288551 GCACCCTCGGGGCAGACCTCAGG + Intronic
1166385253 19:42376894-42376916 GCCCCATCTGGGCAACCCTGGGG - Exonic
1167633363 19:50639392-50639414 CCATCCTCTCTGCAGCCCGGAGG - Intronic
1167643648 19:50694935-50694957 CCTCCAGCTGGCCAGCCCTGGGG - Intronic
925512062 2:4638711-4638733 TCATCCTGAGGGCAGCCCTGTGG + Intergenic
927192547 2:20526765-20526787 CCACCACCTGGCCAGGCCTGGGG - Intergenic
927927771 2:27025380-27025402 CCAGCAGCTGGGCAGCCCTTTGG - Intronic
928136918 2:28694760-28694782 GATCACTCTGGGCAGCCCTGTGG + Intergenic
928684010 2:33729088-33729110 CAGCCCTCTGGGCTGCTCTGTGG + Intergenic
929017062 2:37508410-37508432 CCACCCCATGGGGAGCTCTGAGG + Intergenic
931458794 2:62432902-62432924 CCTCCTTTTGGGCAGCTCTGAGG - Intergenic
931763320 2:65434843-65434865 CCACCCTGTGGGCATCTCTTGGG + Intergenic
932592571 2:73076010-73076032 CCACCATCTGGCCAGCCTGGGGG + Exonic
932827473 2:74955081-74955103 CCATTGGCTGGGCAGCCCTGAGG - Intergenic
934577767 2:95413849-95413871 GCACCATCAGGCCAGCCCTGTGG + Exonic
934640055 2:96022557-96022579 GCACCATCAGGCCAGCCCTGTGG + Intronic
934657411 2:96123422-96123444 CCAGCCACAGGGCTGCCCTGAGG + Intergenic
934657413 2:96123426-96123448 TCTCCCTCAGGGCAGCCCTGTGG - Intergenic
934793595 2:97082847-97082869 GCACCATCAGGCCAGCCCTGTGG - Intergenic
935482590 2:103611923-103611945 CTTTCCTCTGGGCAGCCATGTGG - Intergenic
936528320 2:113257508-113257530 CCACCCTCTGGGCTGATCTAAGG - Intronic
936854822 2:116944703-116944725 TCAGCCTCTGGGGAGCCCTTGGG + Intergenic
937223494 2:120355354-120355376 CCTCCTCCTGGGCAGCCCGGGGG - Intergenic
937433720 2:121862675-121862697 CCTCCCTCAAGGCAGCCATGTGG + Intergenic
937983952 2:127630275-127630297 CCACCCTCAGGGCAGACATTTGG + Intronic
939185912 2:138860940-138860962 CCACCCAGTGGGTAACCCTGAGG + Intergenic
940987282 2:160062336-160062358 ACACCCTCGGCGCAGCCCCGCGG + Exonic
942047484 2:172108268-172108290 CTACCCTCTGCGCAGCCGGGCGG - Intergenic
942438459 2:176005955-176005977 CGTCCCACTGGGCAGCCCAGAGG + Intergenic
943179359 2:184524103-184524125 CAGCCCTTTGGGGAGCCCTGGGG - Intergenic
944414472 2:199468728-199468750 CCCGCCTCTGGGCAGGCCTGAGG + Intronic
944639584 2:201709999-201710021 GCACCCCCTGGGCAGGCTTGTGG - Exonic
944667809 2:201971600-201971622 TCACCCTCCTGGCAGCCCTGTGG - Intergenic
945251218 2:207768014-207768036 CCACCTTCTGGATAGGCCTGTGG - Exonic
945933539 2:215880597-215880619 CAACCCCATGGGCAGCTCTGTGG + Intergenic
946135420 2:217642736-217642758 CCACTCTCTGGGCAGCTCAGTGG - Intronic
946438345 2:219674464-219674486 CCACGGTGTGGGCAGCTCTGGGG + Intergenic
946443983 2:219722419-219722441 CTGCCCGCTGGGCAGCTCTGAGG + Intergenic
947751395 2:232534577-232534599 CCACACTCTGAGCATCCCTTAGG + Intronic
948643276 2:239388594-239388616 CCACCCTCTGGGCCCCCCTTTGG + Intronic
948818089 2:240523711-240523733 CCACGCCATGGCCAGCCCTGTGG - Intronic
949076709 2:242063928-242063950 GCACCTCCTGGGCAGCCCTGAGG + Intergenic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1171349655 20:24492700-24492722 CCCTCCCCTGGGCAGCCCTTTGG - Intronic
1171524043 20:25796053-25796075 ACACCGTCCGGGCAGGCCTGAGG + Intronic
1171532101 20:25859748-25859770 ACACCGTCCGGGCAGCCCTGAGG + Intronic
1171532413 20:25861411-25861433 ACACCGTCCGGGCAGCCCTGAGG + Intronic
1171532739 20:25863068-25863090 ACACCGTCCGGGCAGCCCTGAGG + Exonic
1171533627 20:25867961-25867983 TCACCGTCCGGGCAGGCCTGAGG + Intronic
1171543729 20:25985369-25985391 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1171544104 20:25987563-25987585 ACACCGTCTGGGCAGGCCTGAGG - Intergenic
1171552784 20:26059830-26059852 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1171807176 20:29690046-29690068 ACACCGTCTGGGCAGGCCTGAGG - Intergenic
1171847212 20:30284430-30284452 ACACCATCCGGGCAGGCCTGAGG - Intergenic
1171847559 20:30286315-30286337 ACACCGTCCGGGCAGGCCTGAGG + Intergenic
1172655196 20:36532540-36532562 ACACCCTGTGGGAGGCCCTGAGG - Intergenic
1173424150 20:42928308-42928330 CCCCTCTCTGGGCATCTCTGAGG - Intronic
1174146696 20:48456930-48456952 CCAGTCTCTGGGGAGCCCTTTGG + Intergenic
1174414992 20:50360472-50360494 TCACACTCTGGCCAGGCCTGGGG + Intergenic
1174704742 20:52644054-52644076 CAACCCTTTGGGGAGCTCTGGGG + Intergenic
1175251943 20:57615215-57615237 CCACCCTCAGGGCACCTCTGCGG - Intronic
1175698026 20:61117078-61117100 CCATCCTCCCGTCAGCCCTGTGG - Intergenic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1175928090 20:62480662-62480684 CCACCCTCTGTCCAGCCAGGGGG + Intergenic
1176048819 20:63105929-63105951 CCACCCTCAGCCCAGCCTTGTGG - Intergenic
1176235486 20:64051691-64051713 CCACCCTCTTGGCTGGGCTGTGG + Intronic
1176656477 21:9592598-9592620 ACACCATCCGGGCAGGCCTGAGG + Intergenic
1176679298 21:9810881-9810903 ACACCCTCTGGCAACCCCTGAGG + Intergenic
1178619082 21:34158597-34158619 CCACCCTCTGGCCATGCCTGGGG - Intergenic
1179278924 21:39917299-39917321 CCACCTTCTGGTAAGCCCTGAGG - Intronic
1180698512 22:17769365-17769387 TCTCCCTCTGGGTATCCCTGAGG - Intronic
1181118420 22:20649014-20649036 CCACCCACTGACCAGCACTGAGG + Intergenic
1181363530 22:22357031-22357053 CTTCCCTCTGGGATGCCCTGGGG - Intergenic
1181600880 22:23951306-23951328 CCTCCCTCTGGCCTGCCCAGGGG - Intergenic
1181607633 22:23990020-23990042 CCTCCCTCTGGCCTGCCCAGGGG + Intergenic
1181626950 22:24128780-24128802 CCACCTTCCTGGCAGCCCTGTGG + Intronic
1182061048 22:27397711-27397733 CCACCCTCTCCACAGTCCTGGGG + Intergenic
1182132909 22:27871513-27871535 CCACCATCTGGGCTGCTCTCTGG + Intronic
1182143984 22:27985493-27985515 CCAACCTCTGTGCAGACATGGGG - Intronic
1182456471 22:30454114-30454136 CGCACCTCTGGGCAGTCCTGGGG + Intronic
1182472598 22:30557581-30557603 CCACCGTCTCTGCAACCCTGGGG - Intronic
1182678553 22:32059982-32060004 CCGCCCACTGGGCAGCACAGGGG + Intronic
1183315605 22:37135435-37135457 CCCACCCCTGGGCAGCCCTTGGG - Exonic
1184509599 22:44925914-44925936 CCACAGTCTGGGCTGGCCTGGGG - Intronic
1184596467 22:45517101-45517123 CCGCCCTCTGGGCCACCCCGAGG + Intronic
1184688672 22:46107741-46107763 CCACCTACCTGGCAGCCCTGGGG - Intronic
1184858305 22:47158538-47158560 CCACCCTCTGCACAGCCCCGTGG + Intronic
1185247222 22:49779628-49779650 CCACACGCTGAGCTGCCCTGGGG + Intronic
949508868 3:4751355-4751377 CCACTCCCTGGGCAGCCATAGGG - Intronic
950590731 3:13934456-13934478 CCTCCCTCAGCGGAGCCCTGAGG - Intergenic
950660371 3:14463512-14463534 CCGCCCTCTGGAGACCCCTGCGG + Intronic
951867421 3:27323582-27323604 CCCCCCTCTGAACAGACCTGTGG - Intronic
952425935 3:33174447-33174469 CCCAGCTCTGGGCTGCCCTGAGG - Intronic
952903550 3:38125614-38125636 GCACCCACTGGGCTGCACTGGGG - Exonic
953032137 3:39186041-39186063 CCACCCCCCAGGCAGCCCTCTGG + Exonic
953045182 3:39288587-39288609 CCACCTGGTGGGCAGCCCTTTGG + Intergenic
953969913 3:47339089-47339111 CCTCTCTCTGGGCAGTCTTGAGG + Intronic
954463402 3:50640529-50640551 ACACCCCCTCGGCATCCCTGTGG + Intronic
954798749 3:53175019-53175041 CCACCCTCCATGCAGTCCTGGGG + Intronic
955621637 3:60870693-60870715 CCATCCTCTAAGCAGGCCTGAGG - Intronic
956724500 3:72145935-72145957 CCACCCAGTGGGCAGGGCTGAGG + Intergenic
960092726 3:113657907-113657929 CCATCCTCTGGCCAGCTGTGCGG - Exonic
960640319 3:119816992-119817014 GCAGCCTCAGAGCAGCCCTGAGG + Intronic
961010097 3:123429898-123429920 CCACCCCCAGGGCAGCCGTTGGG - Intronic
961155422 3:124675713-124675735 CCTGCAACTGGGCAGCCCTGAGG + Intronic
961252668 3:125520096-125520118 CCAGCGTCTGGGGAGCCCAGCGG + Exonic
961649563 3:128410656-128410678 CCACCCCCAGGGCAGCCCTCTGG - Intergenic
962267761 3:133955610-133955632 GCACCCTGTGCTCAGCCCTGGGG + Intronic
962630629 3:137272160-137272182 CCACTCTCTGTGGGGCCCTGAGG + Intergenic
962863713 3:139428669-139428691 AGACCCTCACGGCAGCCCTGTGG - Intergenic
964634530 3:158844871-158844893 TCTCCCTCGTGGCAGCCCTGTGG - Intergenic
964791081 3:160453462-160453484 CCACATGCTGGGCAGGCCTGGGG - Intronic
966715569 3:183010328-183010350 GCACCCTGGGGTCAGCCCTGAGG + Intergenic
966871192 3:184291443-184291465 TCACCCTCTCGGAAGGCCTGGGG + Intronic
966924461 3:184635321-184635343 CCACTCTCAGGGCAGGACTGGGG + Intronic
967998951 3:195188259-195188281 CCTACCTCTGGGCAGCACAGAGG - Intronic
968137032 3:196227127-196227149 CCCCCCACAGGGCAGCCCCGGGG - Intronic
968161604 3:196431936-196431958 CCCTTCTCTGTGCAGCCCTGCGG - Intronic
968234124 3:197021697-197021719 TCATCCTCAGAGCAGCCCTGTGG - Intronic
968595614 4:1480907-1480929 CCACCCTGTGGCCAGCCCTGGGG - Intergenic
968659408 4:1793052-1793074 CCGCCCCCTGGGCCGCCCCGCGG + Intergenic
969138878 4:5051969-5051991 CCACCCTCGGCCGAGCCCTGCGG + Intronic
969613954 4:8241662-8241684 CCAGCCACTGGTCAGTCCTGTGG + Intronic
969670470 4:8587387-8587409 CCACCTTCTAAGAAGCCCTGTGG + Exonic
980436702 4:132785018-132785040 CCACCCTATCCGCTGCCCTGGGG - Intergenic
981796694 4:148604063-148604085 CCACACTTTGGGAGGCCCTGAGG + Intergenic
982181418 4:152751622-152751644 CCAACATCTGTGCAGCCCTCAGG - Intronic
982181448 4:152751762-152751784 CCAACATCTGTGCAGCCCTCAGG - Intronic
983690675 4:170465357-170465379 CCACACCCTTCGCAGCCCTGAGG + Intergenic
985502009 5:254205-254227 ACACCCCCTGGCCAGCCATGCGG + Intronic
985735008 5:1574461-1574483 ACACCCCCTGGCCAGCCATGCGG - Intergenic
985885077 5:2671176-2671198 CCACCCTCTGGGAGGGCCTTTGG + Intergenic
986741471 5:10709519-10709541 CAACCCTCTGGGCAGTGCAGTGG - Intronic
987073638 5:14360475-14360497 CATACCTCTGGGCTGCCCTGTGG + Intronic
987386844 5:17338161-17338183 CCACCTTGTGAGCTGCCCTGTGG - Intergenic
990825538 5:59893774-59893796 GCCCCCTCTCGGTAGCCCTGAGG - Exonic
992078946 5:73216309-73216331 CCACTCGCTGGGCAGCCCCGCGG - Intergenic
992441577 5:76801931-76801953 CCACACACTGGAGAGCCCTGAGG - Intergenic
992828270 5:80570210-80570232 CGACCCTCTGTGCGGCCCTAGGG + Exonic
994353080 5:98769053-98769075 CCACCCTCCGCGCCGCCCTCCGG - Intronic
996407430 5:123119459-123119481 CCACCTTCAGGGCGGCTCTGTGG + Intronic
997359405 5:133285055-133285077 CCACTCTCAGGGCCGCCCAGTGG - Intronic
997519352 5:134512644-134512666 CCACACAGAGGGCAGCCCTGAGG + Intergenic
998003834 5:138644256-138644278 CCACCCCCAAGGCAACCCTGTGG - Intronic
999197595 5:149793094-149793116 CCATCATCTGGGCCTCCCTGTGG + Intronic
999556747 5:152751883-152751905 CCAACCTAAGGGAAGCCCTGAGG + Intergenic
1000252204 5:159506394-159506416 CCACCCAGTGGCCTGCCCTGTGG + Intergenic
1000642418 5:163718459-163718481 CCAGCGTCTGTGGAGCCCTGAGG + Intergenic
1001542456 5:172549193-172549215 CCGCCCTTTGGGAAGTCCTGGGG - Intergenic
1001582178 5:172806320-172806342 CCAGCCTCTGGGAAGCTGTGTGG + Intergenic
1001644168 5:173268082-173268104 CCTTCCTCTGGGCACCTCTGCGG + Intergenic
1001756939 5:174177670-174177692 CCAGCCGCTTGGCAGCCCTGGGG + Intronic
1002090456 5:176802572-176802594 GCCACCTTTGGGCAGCCCTGGGG - Intergenic
1002317495 5:178352780-178352802 CTCCCCTCTCAGCAGCCCTGGGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002571189 5:180140211-180140233 CCCCTCTCTGGGCATCCCTGTGG - Intronic
1002586425 5:180251781-180251803 CTACCCTGTGGGCAGCAGTGAGG + Intronic
1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG + Intronic
1002895826 6:1379552-1379574 GCAGGCTCTGGGCCGCCCTGTGG - Intergenic
1003266443 6:4568576-4568598 TCAACCTCTGGGCTGCCCTTTGG - Intergenic
1003564966 6:7215041-7215063 CCCTCATCTGGGGAGCCCTGGGG - Intronic
1004996613 6:21199457-21199479 CAACCTTCTGCTCAGCCCTGGGG + Intronic
1006037942 6:31228775-31228797 ACTCCCTCTGGACAGCTCTGTGG + Intergenic
1006193426 6:32223074-32223096 CCACCCTCAGGGCTGCTGTGTGG - Exonic
1006637976 6:35474123-35474145 CCAGCCTCTGGGCAGACCAGAGG - Exonic
1006946445 6:37787623-37787645 CTGCCCTCTAGCCAGCCCTGAGG - Intergenic
1007339833 6:41184266-41184288 CAACAGCCTGGGCAGCCCTGAGG - Intergenic
1009997008 6:70907149-70907171 TCACCCTCTTGGCAGTCATGTGG - Intronic
1010011384 6:71051625-71051647 CCTCACTGTGGGGAGCCCTGGGG - Intergenic
1011042248 6:83042630-83042652 CACCTCTCTGAGCAGCCCTGTGG - Intronic
1014079472 6:117270616-117270638 CCCGCCGCTGGGCAGCCCTCTGG + Exonic
1017011733 6:150068148-150068170 CCACCCTCAGGTCACACCTGAGG + Intronic
1017063098 6:150504930-150504952 CCAGCCTCTGGCCATCCCAGAGG - Intergenic
1019143038 6:169960215-169960237 CCAGCCCCTGGGAGGCCCTGAGG - Intergenic
1019162332 6:170076875-170076897 CCACACTCTGCAGAGCCCTGTGG - Intergenic
1019162785 6:170080378-170080400 CCACGTTCTGGGCAGCGCTTGGG - Intergenic
1019505589 7:1388928-1388950 CCACCCTCTTGCGTGCCCTGAGG - Intergenic
1019527702 7:1488137-1488159 CGCGCCTCTGGGCAGCGCTGCGG - Intronic
1019713755 7:2529242-2529264 TCACCCTCCTGGCAGCCCCGGGG + Intergenic
1021056817 7:16059577-16059599 CAACCATCTGTGCAACCCTGTGG - Intergenic
1021751856 7:23808891-23808913 CCACCCTCTTCCCAGTCCTGTGG + Intronic
1022200376 7:28110796-28110818 CTACCCTGTGGCCAGCCATGTGG - Intronic
1022505408 7:30906280-30906302 TCACCCTCAGGGCAGGGCTGGGG + Intergenic
1023043672 7:36193827-36193849 CCTCCCTCTGGGAGGGCCTGGGG + Intronic
1023632035 7:42174734-42174756 TCACCCTCTGTGCGGCCCTGGGG - Intronic
1023832168 7:44045642-44045664 CCACACTGTGGTCAGCACTGAGG + Intronic
1023840943 7:44097125-44097147 CCACCCACAGGCCACCCCTGAGG - Intergenic
1023870168 7:44259024-44259046 CGATCCTCTGGGCAGCCCTAGGG - Intronic
1025202031 7:56968395-56968417 CCAGCCTGTCGGCAGCCCTTTGG + Intergenic
1025268222 7:57485214-57485236 ACACCGTCTGGGCAGGCCTGAGG - Intergenic
1025284482 7:57651047-57651069 ACACCGTCCGGGCAGGCCTGAGG + Intergenic
1025295483 7:57772646-57772668 ACACCTTCTGGGCAGGCCTGAGG - Intergenic
1025301511 7:57822249-57822271 ACACCGTCTGGGCAGGCCTGAGG - Intergenic
1025669916 7:63608533-63608555 CCAGCCTGTCGGCAGCCCTTTGG - Intergenic
1026857064 7:73762100-73762122 CCAACACCTGGGCACCCCTGGGG - Intergenic
1026976590 7:74502541-74502563 CCACTTTCTAGCCAGCCCTGGGG - Intronic
1027170294 7:75866916-75866938 CCACCACCTGGGCATCCCAGGGG - Intronic
1027868124 7:83673549-83673571 CTTCCCTCGGGGCAGGCCTGGGG + Intergenic
1028194996 7:87895824-87895846 CCACCCTCAGGGCAGAACTGTGG + Intronic
1029457658 7:100679217-100679239 CCACCCCCTCAGCAGCCCTCAGG - Intergenic
1029547440 7:101217653-101217675 GCACTCTCTGGGCAGGGCTGCGG - Exonic
1029599848 7:101557372-101557394 CCTCCCTCTGGGGAGGCCAGGGG - Exonic
1029921494 7:104269369-104269391 GCACTCACTGGGCAGCCATGTGG - Intergenic
1030117110 7:106070386-106070408 CCAGCCTCAGGGCAGCGCGGTGG - Intergenic
1033599947 7:142882153-142882175 GTACCCTCTGGGCAGGGCTGGGG + Intronic
1033951796 7:146793715-146793737 CCAGCCTTTGGGCAGCTGTGGGG + Intronic
1034272658 7:149810968-149810990 CTACCCCCCGGGCAGCACTGTGG + Intergenic
1034535932 7:151725758-151725780 CCAGCCCCTGTGCAGCCCTGGGG - Intronic
1034737654 7:153443959-153443981 CCACCTCCTGCGGAGCCCTGTGG - Intergenic
1034748321 7:153544145-153544167 TCACCCTCATGGCACCCCTGAGG - Intergenic
1035026473 7:155829995-155830017 ACGGCCTTTGGGCAGCCCTGGGG - Intergenic
1035245572 7:157560347-157560369 ACACGCTCTGGGCATCCGTGTGG - Intronic
1035426796 7:158783599-158783621 CCTCCTTCGGGGCAGCTCTGAGG + Intronic
1035622089 8:1042644-1042666 CCATCCTCTGGGAAGTCCTGGGG + Intergenic
1037331599 8:17748609-17748631 CCACCACCTGGGCACCACTGTGG + Intronic
1037578489 8:20230463-20230485 CCACCCTCAGGGCAGCTCTGTGG - Intergenic
1037828994 8:22177252-22177274 CCAGGCTGTGGGCAGCGCTGCGG - Intronic
1038488084 8:27950482-27950504 TCACCCTCTGGCCAGCACCGTGG + Intronic
1039903077 8:41767007-41767029 CCCCCCTCGGGGCACCCCGGCGG + Intronic
1040334417 8:46408791-46408813 ACACCCCCGGGACAGCCCTGAGG - Intergenic
1040439623 8:47427721-47427743 CCACTCTGTGGGCTGCACTGTGG - Intronic
1044988691 8:97776384-97776406 CCAGCCTCCGCGCAGCCCCGCGG + Intronic
1045694195 8:104789259-104789281 CCAGGCTCTGTGCAGGCCTGTGG - Intronic
1048293185 8:133195889-133195911 CCATCCTCTGGGCAGCAGGGAGG + Intronic
1049195981 8:141315835-141315857 GGAGCCTCTGAGCAGCCCTGTGG + Intergenic
1049214905 8:141403035-141403057 CCAGCCTCCCAGCAGCCCTGGGG + Intronic
1049306984 8:141909236-141909258 TCACCCCCTGGGGGGCCCTGTGG - Intergenic
1049336411 8:142089038-142089060 TCACCCAGTGGGCAGCGCTGGGG + Intergenic
1049554511 8:143275320-143275342 CCCACATCTGGGCGGCCCTGGGG + Intronic
1049638939 8:143705623-143705645 CCTCCCTCTGAGCAGGTCTGTGG - Intronic
1049796034 8:144497630-144497652 CCAAGCAGTGGGCAGCCCTGAGG + Intronic
1049807895 8:144549160-144549182 CCCTGCTCTGGGCAGCACTGCGG + Intronic
1051875918 9:21793511-21793533 CCATCCTCTGATCATCCCTGTGG + Intergenic
1052940339 9:34127249-34127271 CCCACCGCTGGGTAGCCCTGAGG + Intronic
1053475975 9:38382258-38382280 CCACCCTCTGGTGGCCCCTGAGG - Intergenic
1053596451 9:39566637-39566659 CCACACTCTGAATAGCCCTGAGG - Intergenic
1053784453 9:41644213-41644235 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1053854415 9:42323277-42323299 CCACACTCTGAATAGCCCTGAGG - Intergenic
1054160226 9:61668049-61668071 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1054172409 9:61854346-61854368 ACACCGTCCGGGCAGGCCTGAGG - Exonic
1054173179 9:61858186-61858208 ACACCATCCGGGCAGGCCTGAGG - Intergenic
1054447265 9:65383373-65383395 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1054447739 9:65385818-65385840 ACACCGTCTGTGCAGGCCTGAGG - Intergenic
1054448036 9:65387228-65387250 ACACCGTCCGGGCAGGCCTGAGG - Intergenic
1054569808 9:66798381-66798403 CCACACTCTGCGTAGCCCTGAGG + Intergenic
1054664363 9:67722595-67722617 ACACCATCCGGGCAGGCCTGAGG + Intergenic
1054665129 9:67726459-67726481 ACACCGTCCGGGCAGGCCTGAGG + Intergenic
1054806505 9:69400972-69400994 CCATCCTATGAGCAGCCCTATGG - Intergenic
1057549224 9:96039792-96039814 CCATCCTCTGTGCAGCCCTGGGG - Intergenic
1057911086 9:99021194-99021216 CCTCCCTCTGGGCTGCACAGAGG + Intronic
1060103929 9:120862053-120862075 CCTCCCTCTGGGCCACCCTAGGG - Intronic
1060748930 9:126156118-126156140 TCACCCGATGGGCTGCCCTGGGG - Intergenic
1060876066 9:127084436-127084458 CCACCATCCAGGCAGCCCTCTGG + Intronic
1061288543 9:129637990-129638012 CCACCCTGTGGGCAGCCTGGCGG - Exonic
1061782708 9:133005180-133005202 CCACCCGCAGGGCTGTCCTGGGG + Intergenic
1061806247 9:133139282-133139304 CTCCCCTCTCCGCAGCCCTGAGG - Intronic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062245717 9:135565162-135565184 CTCCGCTCTGGGCAGCGCTGGGG - Intronic
1062250520 9:135591628-135591650 GCCCGCTCTGGGCAGCACTGGGG - Intergenic
1062250526 9:135591650-135591672 CTCCGCTCTGGGCAGCACTGGGG - Intergenic
1062315651 9:135965776-135965798 CCACTCTCTGGGACTCCCTGGGG + Intergenic
1062358961 9:136178453-136178475 CGACCCTGTGGGCAGAGCTGGGG + Intergenic
1062421913 9:136486736-136486758 CCACCCTCTGGCCAGCCTGGTGG - Intergenic
1062600757 9:137317698-137317720 CCACCCTCCTGTCAGCCCTGGGG + Intronic
1203634192 Un_KI270750v1:96080-96102 ACACCATCCGGGCAGGCCTGAGG + Intergenic
1203664469 Un_KI270754v1:13417-13439 ACACCCTCTGGCAACCCCTGAGG + Intergenic
1190168428 X:48092377-48092399 CCTCCCACTGGACAGGCCTGGGG + Intergenic
1190168815 X:48095308-48095330 CCTCCCACTGGACAGGCCTGGGG - Intergenic
1190457966 X:50643745-50643767 CCACCCCCTCGGCAGCTCAGAGG + Intronic
1192191582 X:68994448-68994470 CCACACTCAGGGCAGGTCTGGGG + Intergenic
1192227463 X:69238935-69238957 CCACCATCTGGAAACCCCTGTGG + Intergenic
1192538653 X:71949894-71949916 ACAACCTCAGGCCAGCCCTGTGG - Intergenic
1193205080 X:78738853-78738875 TCACCTTCTGGGGAGGCCTGAGG + Intergenic
1196491317 X:116270820-116270842 CCTTCCTCTTTGCAGCCCTGTGG + Intergenic
1197962778 X:132023749-132023771 CTGCCCTCAGGGGAGCCCTGGGG - Intergenic
1199606530 X:149583689-149583711 CCGCCCTCTTGACAGCACTGAGG - Intronic
1199676212 X:150191275-150191297 GCACCCTGTGGGCAGCTCAGGGG - Intergenic
1200064980 X:153499911-153499933 CCACCTTCCACGCAGCCCTGCGG - Intronic
1200701126 Y:6403465-6403487 ACAACCTCTAGGCAGGCCTGAGG + Intergenic
1201032986 Y:9761233-9761255 ACAACCTCTAGGCAGGCCTGAGG - Intergenic