ID: 1002596570

View in Genome Browser
Species Human (GRCh38)
Location 5:180327634-180327656
Sequence CTGTGCACTTACTGTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2921
Summary {0: 1, 1: 10, 2: 88, 3: 558, 4: 2264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002596570_1002596573 -1 Left 1002596570 5:180327634-180327656 CCCAGCACACAGTAAGTGCACAG 0: 1
1: 10
2: 88
3: 558
4: 2264
Right 1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1002596570_1002596572 -5 Left 1002596570 5:180327634-180327656 CCCAGCACACAGTAAGTGCACAG 0: 1
1: 10
2: 88
3: 558
4: 2264
Right 1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG 0: 1
1: 0
2: 5
3: 57
4: 384
1002596570_1002596574 3 Left 1002596570 5:180327634-180327656 CCCAGCACACAGTAAGTGCACAG 0: 1
1: 10
2: 88
3: 558
4: 2264
Right 1002596574 5:180327660-180327682 ATATTAGTTGCATGGTTGGATGG 0: 1
1: 0
2: 3
3: 22
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002596570 Original CRISPR CTGTGCACTTACTGTGTGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr