ID: 1002596572

View in Genome Browser
Species Human (GRCh38)
Location 5:180327652-180327674
Sequence CACAGTAAATATTAGTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 384}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002596564_1002596572 24 Left 1002596564 5:180327605-180327627 CCAGGTCAGATGTCACTAAGTCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG 0: 1
1: 0
2: 5
3: 57
4: 384
1002596570_1002596572 -5 Left 1002596570 5:180327634-180327656 CCCAGCACACAGTAAGTGCACAG 0: 1
1: 10
2: 88
3: 558
4: 2264
Right 1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG 0: 1
1: 0
2: 5
3: 57
4: 384
1002596571_1002596572 -6 Left 1002596571 5:180327635-180327657 CCAGCACACAGTAAGTGCACAGT 0: 1
1: 7
2: 47
3: 242
4: 820
Right 1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG 0: 1
1: 0
2: 5
3: 57
4: 384
1002596569_1002596572 1 Left 1002596569 5:180327628-180327650 CCAGGGCCCAGCACACAGTAAGT 0: 1
1: 1
2: 30
3: 140
4: 625
Right 1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG 0: 1
1: 0
2: 5
3: 57
4: 384
1002596567_1002596572 3 Left 1002596567 5:180327626-180327648 CCCCAGGGCCCAGCACACAGTAA 0: 1
1: 3
2: 21
3: 141
4: 735
Right 1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG 0: 1
1: 0
2: 5
3: 57
4: 384
1002596568_1002596572 2 Left 1002596568 5:180327627-180327649 CCCAGGGCCCAGCACACAGTAAG 0: 1
1: 3
2: 32
3: 170
4: 749
Right 1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG 0: 1
1: 0
2: 5
3: 57
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002596572 Original CRISPR CACAGTAAATATTAGTTGCA TGG Intronic
901586289 1:10296319-10296341 GATAGGAAATATTAGTTTCAGGG - Intronic
901767799 1:11515026-11515048 CCCAGTAAATATCTGTTGTATGG - Intronic
902077219 1:13796971-13796993 CTCAGCAAATATTTGTTGCCAGG + Intronic
902282149 1:15382553-15382575 CCCAGTAAATATTTGGTGAACGG + Intronic
902407039 1:16190041-16190063 CTCAGTGAATATTTGTTGCTGGG - Intergenic
904346267 1:29872235-29872257 CAAAGTAAAGATTTGTTGGATGG + Intergenic
905839049 1:41158191-41158213 CACTATAAATATTTGTTGGATGG - Intronic
905969477 1:42130639-42130661 CACTGAAAATATTAATTGCTTGG + Intergenic
906073463 1:43034849-43034871 CAAAGTAAATGTTAGTACCAGGG + Intergenic
906991077 1:50739581-50739603 CGAAGTATATATTATTTGCAAGG - Intronic
907115937 1:51968538-51968560 CACAGTAAATATTTGTTAAATGG + Intronic
907350073 1:53821804-53821826 CACAGTAAATATTTAGTGAAGGG - Intronic
907766562 1:57418157-57418179 CTCAGTAAACATTTGTTGAATGG + Intronic
907895055 1:58680448-58680470 CATAGTAAAGAATACTTGCAAGG - Intronic
907975415 1:59426784-59426806 TGCAGTAAATATTTGTTGAATGG + Intronic
908597822 1:65707386-65707408 CCCAGTAAATATTAGATCCCAGG + Intergenic
908674198 1:66583857-66583879 CTCAATAAATTTTTGTTGCATGG + Intronic
909442415 1:75712415-75712437 CTCAGTAAGTATTAGTTCCTGGG + Intergenic
910031875 1:82735906-82735928 CTAAATAAATATTAGTTTCATGG - Intergenic
910061707 1:83101498-83101520 CATAGAAAATACTAGTTGAATGG - Intergenic
911568384 1:99492406-99492428 TCCAGTAAATATTAGGTGCCTGG + Intergenic
911836728 1:102628982-102629004 CTCAATAAATATTTGTTGAATGG + Intergenic
911864469 1:102999402-102999424 CAAAATAAATATTAGTTAAAGGG - Intronic
912389713 1:109294424-109294446 CACTCTAAATGTTTGTTGCATGG - Intronic
913255724 1:116951478-116951500 CTCAATAAATATTAGCTGAACGG + Intronic
914908420 1:151765597-151765619 CTCAATAAATATTTGTTGAATGG + Intronic
914957082 1:152172414-152172436 CCCAGTAAATATTAGGCGCTGGG + Intergenic
915487276 1:156230532-156230554 CTCAGTGAATATTTGTTGAAGGG + Intronic
915978165 1:160404052-160404074 CATAGTAAATGTTAGCTGGATGG + Intronic
917690688 1:177465214-177465236 CTCAATAAACATTAGTTGAATGG - Intergenic
918031019 1:180811288-180811310 AACATTAAATATTATTTTCATGG + Intronic
918384327 1:183990281-183990303 CTCAATAAATATTTGTTGAATGG + Intronic
918857345 1:189774943-189774965 TTCAGTAAATATTTGTTGAATGG + Intergenic
919213645 1:194521480-194521502 CCCAGTATAAATTAGTGGCAAGG - Intergenic
919449832 1:197757857-197757879 CAAAGGAAATATTAGTTGAGAGG - Intronic
923199838 1:231700749-231700771 CTCAGTAAATATTTGTTGAATGG + Intronic
924042739 1:239999294-239999316 CACAATAAATATTTGCTGAATGG + Intergenic
924450578 1:244175208-244175230 CACAGTAGAGATCTGTTGCAAGG + Intergenic
1063892058 10:10640655-10640677 CTCAGTAAATATTTGTTGGATGG + Intergenic
1064037337 10:11925471-11925493 CTCAGTAAATATTTGGTGAATGG - Intronic
1064132372 10:12721552-12721574 CTCAGTAAATATTTTTTGGATGG - Intronic
1064413512 10:15128706-15128728 CAAAGGAAATATTAGTTGGCTGG + Intronic
1064504649 10:16015450-16015472 CATAGAAAATATTAATTGCTAGG + Intergenic
1064524055 10:16234691-16234713 CTCAATAAATATTGGTTGAAAGG - Intergenic
1064884284 10:20092438-20092460 CTCAGTTAATATTGGTTGAATGG + Intronic
1065838630 10:29681574-29681596 GAAAGGAAATTTTAGTTGCAAGG - Intronic
1069200125 10:65603793-65603815 CACATTTAAGATTAGTTGAAAGG - Intergenic
1070162832 10:73876109-73876131 CTCAGTAAATATTTGTGGGATGG + Intergenic
1070272001 10:74965471-74965493 CTCATTAAATATTAGTTGAAGGG + Intronic
1071503771 10:86221058-86221080 CTCAGAAAATATTAGGAGCAGGG - Intronic
1071792481 10:88969869-88969891 CTCAGTAAATATCTCTTGCAAGG + Intronic
1073954555 10:108854598-108854620 CCAAGAAAATGTTAGTTGCAAGG + Intergenic
1074943822 10:118261055-118261077 AACAGTAACTATTTGTTGGATGG - Intergenic
1074947397 10:118294744-118294766 CATAGTACATATTTGTAGCATGG - Intergenic
1075502361 10:122987142-122987164 CTCAGTAAAAATTTGTTGGATGG - Intronic
1076004327 10:126935863-126935885 CTTAGTAAATATTTGTTGAATGG + Intronic
1076167029 10:128290968-128290990 CTCAGTAAATATTTGTAGAATGG - Intergenic
1076353974 10:129839213-129839235 CTCAGTAAATACTGGTTGAATGG + Intronic
1077404207 11:2375606-2375628 CCCACTAAATATTTGATGCATGG + Intergenic
1077897851 11:6467126-6467148 AAAAGTAAATAATAGTGGCAGGG + Intronic
1078185982 11:9052549-9052571 CACAGTAAGTATCTGTTACATGG + Intronic
1078578766 11:12523052-12523074 AACAGTACATATATGTTGCATGG + Intronic
1079497637 11:21063714-21063736 CACAATAAACATTAGTTAAATGG - Intronic
1079852950 11:25560728-25560750 CAAAGTAAATTTTAGTTGCTGGG + Intergenic
1080545139 11:33309513-33309535 CACACTTACTATTAGTTCCAGGG - Intronic
1080653137 11:34238499-34238521 CTCAATAAATATTTGTTGAATGG + Intronic
1080762253 11:35263004-35263026 CTCAATAAATATTTGTTGAATGG - Intronic
1080858153 11:36130038-36130060 CTCAGTCAATATTTGTTGAATGG + Intronic
1080941921 11:36928096-36928118 CTCAGTAAATATTAGCTGTTTGG + Intergenic
1081097782 11:38961451-38961473 GAAAGTCAATAATAGTTGCATGG + Intergenic
1081177377 11:39946039-39946061 TACAATAAGTATTAGTTTCAGGG + Intergenic
1083050923 11:59775858-59775880 CACTCTAAATATAAGTTTCACGG - Intronic
1083971605 11:66080207-66080229 CTCAGTAAATATTTGGTGAATGG - Intronic
1085040720 11:73324834-73324856 CTCAGTAAATATTAGTTGAATGG + Intronic
1085083771 11:73653394-73653416 CTCAGTAAATATTTGTTGTGCGG - Intronic
1085113514 11:73909713-73909735 CAGAGTAAATATTAATCGTATGG - Intronic
1085539947 11:77258010-77258032 CTCAATAAATATTTGTTGAATGG + Intronic
1085646854 11:78229610-78229632 GAAAGTAAATATTAGTAGGATGG - Intronic
1085763969 11:79266200-79266222 CTCAGTAAATGTTAGATGAATGG + Intronic
1085964897 11:81510889-81510911 CAAATTAAATATTATTAGCAAGG - Intergenic
1086019005 11:82203057-82203079 CACAGTAAATATTATTGATATGG - Intergenic
1086081516 11:82907841-82907863 CACAATAAATATTTATTGAATGG - Intronic
1086232558 11:84588159-84588181 CTCAGCAAATGTTAGTTGAATGG - Intronic
1086906396 11:92422836-92422858 ATCAGTAGATATTCGTTGCATGG + Intronic
1086926276 11:92643924-92643946 CCTAGTAAATATTTGTTGAATGG + Intronic
1086940448 11:92792316-92792338 GACAATAAATGTTAGTTGAATGG + Intronic
1087207030 11:95407487-95407509 GAAAGTAAAAATTAGTTTCATGG + Intergenic
1087708835 11:101526024-101526046 CACAGTATATTTTAATTACACGG + Intronic
1088085784 11:105978182-105978204 CTCAGTAAATATTTGTTGAGTGG - Intronic
1088671621 11:112146751-112146773 CTCAATAAATATTAGTTGGAGGG - Intronic
1089094840 11:115911144-115911166 CTCAGTAAATATTTATTGCCTGG - Intergenic
1089723164 11:120448800-120448822 CTTAGTAAATATTTGTTGAATGG + Intronic
1091260489 11:134230275-134230297 CCTAGTAAATATTTGTTGAATGG + Intronic
1092574431 12:9764184-9764206 CACAGTGAATAATGGTTGCTTGG + Intergenic
1092941493 12:13411672-13411694 CACAGTAAAAATTAAGTACATGG + Intergenic
1093955523 12:25213884-25213906 CCCAGTAAATATTTATTGCGTGG - Intronic
1094354765 12:29565901-29565923 CTGAGTAAATATTTGTTGAATGG - Intronic
1094436783 12:30429714-30429736 AACAGTAAACATTAGTTCTATGG - Intergenic
1095563646 12:43594976-43594998 CCCGGTAAATGTTAGTTGAATGG - Intergenic
1095743807 12:45635262-45635284 CTCAGTAAATTTGTGTTGCATGG - Intergenic
1096030614 12:48410758-48410780 CTCAGTAAATATTTGTTGAATGG + Intergenic
1096504688 12:52085337-52085359 CACCGTAGTTATTAGCTGCATGG + Intergenic
1097131526 12:56814425-56814447 CACAGTAAATATTCTGTGGAAGG + Intergenic
1098038173 12:66327653-66327675 CTCAGTAAGTATTTGTTGAACGG - Intronic
1098221171 12:68271348-68271370 CTCACTAAATATTTGATGCATGG + Intergenic
1098242211 12:68479765-68479787 CACAATAAATATTTATTGAATGG - Intergenic
1099135775 12:78898502-78898524 CACAGAAAGTAGTAGTTGAATGG + Intronic
1099149207 12:79087969-79087991 CTCAGTGACTATTAGTTGAATGG + Intronic
1099447625 12:82770911-82770933 CACAGTAAAGAGTTGTTGCGGGG + Intronic
1099875561 12:88401697-88401719 CTCAGTAAATGTTTGTTGAAAGG + Intergenic
1100048931 12:90420569-90420591 CACTGTCAACATTAGTTGCCTGG + Intergenic
1100955808 12:99906797-99906819 TACAATAAATATTTGTTGAATGG - Intronic
1101371105 12:104131713-104131735 CTCAGTAAATATTTGTTGGCTGG - Intronic
1102927684 12:116839282-116839304 CTCAGTAAATATTGGATGGATGG + Intronic
1106092764 13:26612714-26612736 CACAGTAAATAATAGCTGAAGGG - Intronic
1107308815 13:39053667-39053689 AACAATACAAATTAGTTGCAGGG - Intergenic
1107609577 13:42099632-42099654 CACAATAAATATTTGCTGAATGG - Intronic
1107916171 13:45153572-45153594 CGCAATAAATATTTGTTGAAGGG - Intronic
1108995824 13:56733371-56733393 CACATTAAATTTTAATTGAATGG - Intergenic
1109574794 13:64240987-64241009 CACAGTAATTCTTATTTACATGG - Intergenic
1110454779 13:75679227-75679249 GACAGTAAATATTTGTAACATGG - Intronic
1110520720 13:76472933-76472955 CACAGCAAATATCAGTTCTATGG - Intergenic
1111714141 13:91857647-91857669 TACATTAAATATAAGTTACAAGG + Intronic
1112867326 13:103921192-103921214 CTCAGTAAATATTAGTTCACAGG - Intergenic
1114526397 14:23369382-23369404 CACAGTAAATATTTGGTGAGTGG + Intergenic
1114875206 14:26708726-26708748 CAAGATATATATTAGTTGCAAGG - Intergenic
1115464435 14:33699429-33699451 CTCAGGAAAAATTATTTGCACGG + Intronic
1115716414 14:36109928-36109950 CAAAGTAAATATATGTTGAAGGG + Intergenic
1115779141 14:36750067-36750089 CTCAGTAAATATTTGTTGACTGG + Intronic
1116344201 14:43769318-43769340 GACAGCATATATTAGTTACATGG + Intergenic
1116772143 14:49138915-49138937 CTCAGTAAATACTAGTTGATTGG + Intergenic
1116822288 14:49637199-49637221 CACAATAAATATCTGTTGAAAGG - Intergenic
1117249473 14:53922059-53922081 AACAGGAAATATTATTTGCAAGG + Intergenic
1118345328 14:64936272-64936294 CATAGTAAATATTAAATGAATGG + Intronic
1118559056 14:67057826-67057848 GTCAGTAAATATTTGTTGAATGG + Intronic
1119127834 14:72144620-72144642 CACAATAAATATTAGCTGAGTGG - Intronic
1119198386 14:72734050-72734072 CTCAGTAAATATCTGTTGAATGG - Intronic
1119407882 14:74410032-74410054 CTCAGTAAATATGTGTTGAATGG - Intronic
1119510918 14:75210548-75210570 CTCAATAAATATTTGTTGCATGG + Intergenic
1119525964 14:75322898-75322920 CTCAGTAAATCCTTGTTGCATGG + Intergenic
1119678445 14:76573885-76573907 CTCAATAAATATTTGTTGAATGG - Intergenic
1119924175 14:78476104-78476126 CTCAGTAAGTATTAGTTTAATGG - Intronic
1120594756 14:86419827-86419849 CAAAGTAACTATAAGTTACATGG + Intergenic
1120678078 14:87445645-87445667 CTCAATAAATATATGTTGCATGG + Intergenic
1120678266 14:87448552-87448574 CAAAATATATTTTAGTTGCATGG - Intergenic
1120855754 14:89211106-89211128 CACAGTATATTCTAGTTGAAAGG - Intronic
1121149817 14:91622338-91622360 CTCAATAAATATTTGTTGAATGG + Intronic
1121506784 14:94483743-94483765 CTCAGTGAATATTTGTTGAATGG + Intergenic
1121736161 14:96219666-96219688 CTCAGGAAATATTTGTTGAAAGG - Intronic
1124445522 15:29728349-29728371 CAGAGAAAATATTATTTGTATGG + Intronic
1124810131 15:32928467-32928489 TACAGTAAATATTTTTTGAATGG - Intronic
1127744624 15:61953962-61953984 TACAATAAATATTTGTTGGATGG + Intronic
1127917716 15:63468921-63468943 CACCATAAATATTTGTTGAAGGG + Intergenic
1128485913 15:68088652-68088674 CTCAATAAATATTTGTTGAAGGG + Intronic
1128922952 15:71628916-71628938 CTCAATAAATATTAGTTAGATGG - Intronic
1129248389 15:74293951-74293973 CACAGCAAATTTTATTTGAAAGG + Intronic
1129829257 15:78657406-78657428 TCCAGTAAATATTTGTTGTATGG + Intronic
1129924411 15:79350107-79350129 CTCAGTGAATATTTGTTGAAGGG + Intronic
1131401998 15:92132731-92132753 CTCAATAAATATTTGTTGCCTGG - Intronic
1131929423 15:97423381-97423403 AAGAGTAAATATTGGTTGAATGG + Intergenic
1131941119 15:97566788-97566810 CTCAGTAAATTTATGTTGCATGG + Intergenic
1134582997 16:15387506-15387528 CCCCGTCAGTATTAGTTGCATGG + Intergenic
1134655623 16:15946515-15946537 CTCAATAAATATTTGTTGAAAGG + Intergenic
1135181781 16:20281190-20281212 CTCAATAAATATTTGCTGCATGG - Intergenic
1136034750 16:27530732-27530754 CTCAGTAAATATTTGCTGAATGG - Intronic
1136193290 16:28631871-28631893 CCCTGTGAGTATTAGTTGCATGG - Intergenic
1137775524 16:51051044-51051066 CATAGTAAATATTAGCTGTTAGG - Intergenic
1138045558 16:53720732-53720754 TACAGTAAATATTTGTTGACTGG + Intronic
1138959880 16:62016376-62016398 CTCAATAAATATTCGTGGCATGG + Intronic
1139858678 16:70002658-70002680 CCCCGTCAGTATTAGTTGCATGG + Intergenic
1140945698 16:79766383-79766405 CTCAGTAAATATTTGCTGGATGG + Intergenic
1141058131 16:80837952-80837974 ATCAATAAATATTAGTTGAATGG - Intergenic
1141265398 16:82492204-82492226 CACATTAAAAATTATTTTCAAGG + Intergenic
1141667119 16:85471342-85471364 GATAGTAAATGTTGGTTGCATGG + Intergenic
1141886703 16:86897183-86897205 CCCAGTAAGTATTTGTTGAATGG - Intergenic
1143675017 17:8426223-8426245 CTCATTAAATATTTGTTGAATGG + Intronic
1144327846 17:14198765-14198787 CTCAATAAATATTTGTTGAATGG - Intronic
1145730303 17:27176952-27176974 CACAATAAATATTAGAAGCAAGG + Intergenic
1146481531 17:33208801-33208823 CTCAGTAAATATCTGTTGAATGG + Intronic
1147267806 17:39245281-39245303 CCCAGTAAATGTTAGTTGAAGGG - Intergenic
1148909893 17:50935894-50935916 CTCAGTAAATATTTGTTGAATGG - Intergenic
1149096719 17:52850547-52850569 CACAGAAAATAATACTTGAAAGG + Intergenic
1149611831 17:57963169-57963191 CAGACTACTTATTAGTTGCAAGG + Intergenic
1150165325 17:62935854-62935876 CACACTAAAGATAAGTTGCTTGG + Intergenic
1150924434 17:69517723-69517745 AACAGAAAAGATTATTTGCAGGG + Intronic
1155299495 18:24416449-24416471 CTCAATAAATATTAGTTAAATGG - Intergenic
1155351837 18:24914670-24914692 CTCAGTAAATATTTGTTGAATGG + Intergenic
1155402987 18:25459071-25459093 CTCAATAAATATTTGTTGAATGG - Intergenic
1155647688 18:28100021-28100043 CTCAGTAAATATTGGATGGATGG - Intronic
1155952516 18:31928798-31928820 ATCAATAAATATTTGTTGCATGG + Intronic
1156588554 18:38460150-38460172 CTCAGTAAATATTTATTGCTTGG - Intergenic
1156708843 18:39917024-39917046 TACAATAAATATTGGTTTCAAGG - Intergenic
1157468432 18:47968492-47968514 CTCAGTAAATATTTGTTGAATGG + Intergenic
1157993182 18:52521897-52521919 CTCAATAAATATTTGTTGGAAGG + Intronic
1158288076 18:55906946-55906968 CACAATAAAAATTAGCTTCAAGG - Intergenic
1159060855 18:63512413-63512435 CAAAATAAATATGAGTTCCAAGG + Intergenic
1159371919 18:67539159-67539181 TACAGTAAATATTTATTGAATGG - Intergenic
1159697538 18:71579241-71579263 AATAGGAATTATTAGTTGCATGG - Intergenic
1163155558 19:15438304-15438326 CTCAGTAAATATTTGTTGAATGG + Intronic
1165676491 19:37728947-37728969 CAAAGTAAATATTAGTTGAATGG + Intergenic
1167318463 19:48780520-48780542 CTCAGTCAATATTAGAAGCATGG + Intergenic
1167646964 19:50711167-50711189 CTCAGTAAATATCTGTTGGATGG + Intronic
1167693014 19:50998734-50998756 CTCAATAAATATTTGTTGAATGG - Intronic
925826009 2:7849275-7849297 CTCAGTAAGTATTTGTTGTAAGG + Intergenic
926570270 2:14521992-14522014 CTCAGTAAATATTTTTTGAATGG + Intergenic
928277308 2:29914721-29914743 CCCACCAAATATTTGTTGCATGG + Intronic
929579920 2:43075486-43075508 CACAGTAAATAAAAGAGGCAAGG - Intergenic
929738346 2:44575572-44575594 CCCAGAAAATATTTGTTGCCAGG + Intronic
930136778 2:47910023-47910045 CACAGTAAATATCACCTGCCAGG - Intergenic
930331922 2:49995973-49995995 CTCAGTAAATATTCATTGAAAGG - Intronic
931940249 2:67244136-67244158 AACAGTAAATATTTGTAGAAGGG + Intergenic
932365933 2:71153638-71153660 TATAGTAAATATTAGGTGCTGGG - Intergenic
933261429 2:80135755-80135777 CTCTGTAAATATGAGTTGCTTGG + Intronic
935061063 2:99608192-99608214 CACAGAAAATATCATATGCAAGG - Intronic
936286622 2:111186303-111186325 CACAGTAAAGCTTAGTGGCTGGG - Intergenic
936374956 2:111932746-111932768 AAGAGTATATATTAGTTTCAGGG + Intronic
936632404 2:114217704-114217726 AACAATAAATATTTGTTGAAAGG + Intergenic
936974810 2:118208197-118208219 AACAGTAAATATCAGTTTCTTGG + Intergenic
939883841 2:147659705-147659727 CTCAATAAATATTAGTTGAAGGG + Intergenic
940508949 2:154588095-154588117 CTCAGTAAATATTAGTGTGATGG - Intergenic
940604768 2:155907432-155907454 TACAGTTAAAATCAGTTGCAGGG + Intergenic
941303531 2:163831734-163831756 CTCAGCAAATATTTGTTGAATGG + Intergenic
942285435 2:174411359-174411381 CACTGAAAATATTTGTTACATGG + Intronic
942456906 2:176144346-176144368 CATAGTACATATTAGTTTCCAGG - Intergenic
942642418 2:178073290-178073312 CTCAGTAAATATTAATGGAATGG + Intronic
942998996 2:182300824-182300846 CACAGTAATTATTCATTTCATGG - Intronic
943422974 2:187691683-187691705 CTCAATAAATATTAGTTGATTGG + Intergenic
943698736 2:190965809-190965831 CTCAGTAAATATTTGTTGAATGG + Intronic
944099827 2:196011809-196011831 CACTGTAAATTTTAGTTAAATGG - Intronic
944463174 2:199973667-199973689 CTCAGTAAATATTAGTTGACCGG + Intronic
944824534 2:203468172-203468194 CTCAGTAAATATTTGTTGAATGG + Intronic
945326014 2:208483083-208483105 AACAGTAAATACTACCTGCAGGG - Intronic
945543888 2:211124509-211124531 CATGGTAAATATGAGTTGCTGGG + Intergenic
1170435873 20:16328160-16328182 CCCAGTAAATACTAGTGGGAGGG - Intronic
1170834366 20:19870956-19870978 AACAGTATTTGTTAGTTGCAAGG - Intergenic
1171351945 20:24509576-24509598 CAAAGTAAAAATGAGATGCAAGG - Intronic
1172212982 20:33213974-33213996 CACAGTAAATAATGGTTGGGTGG + Intergenic
1172257418 20:33531202-33531224 CTCAGGAAATATTTGTTGAAGGG + Intronic
1172364141 20:34335890-34335912 CACAGTAAATATTAGTTTGAAGG - Intergenic
1172767648 20:37359245-37359267 CACAGAAAATATTTGTGGGATGG - Intronic
1175135732 20:56822298-56822320 TTCAGAAAAGATTAGTTGCAGGG - Intergenic
1175524792 20:59626150-59626172 TCCAGTAAATATTTGTTGAATGG - Intronic
1175627198 20:60499513-60499535 CTCAGTAAATATTTGTTGGATGG - Intergenic
1181205518 22:21249067-21249089 CTCAAAAAATATTAGTTGAATGG + Intergenic
1182032259 22:27168578-27168600 CTCAATAAATATTTGTTGGATGG + Intergenic
1182755344 22:32674511-32674533 CACAGAAAATGTTTGTTGAATGG + Intronic
1184723874 22:46331919-46331941 CTCAGTAAATATTTGCTGCATGG - Intronic
949346067 3:3077948-3077970 CCCAGTAAATATTAGTTAAATGG - Intronic
949650588 3:6154555-6154577 CCCAGTAAATATTGGTTGTTCGG + Intergenic
949870518 3:8584010-8584032 CATAGTAAACATCAGTTGAATGG + Intergenic
950160778 3:10759016-10759038 CACAGTAAATATTTGCTGAACGG - Intergenic
951044581 3:18023975-18023997 CACAGTAAATATTTGTTGAAAGG - Intronic
951327536 3:21322214-21322236 CACAGTATATAATATTAGCAGGG + Intergenic
951648251 3:24918375-24918397 CAAAGTAGATATGAGTTGCCTGG + Intergenic
952170708 3:30803962-30803984 GACAATAAATATTAGTAACATGG + Intronic
953221578 3:40976658-40976680 CTCAATAAATATTGGTTGAATGG + Intergenic
954307593 3:49737738-49737760 GAAACTAAATTTTAGTTGCAGGG + Intronic
955776573 3:62440167-62440189 CCCAGTAAATATTTGCTGAATGG + Intronic
955856730 3:63280031-63280053 CACAGGAAATATTTATTGAATGG - Intronic
955935856 3:64101855-64101877 CACATTGCTTATTAGTTGCAAGG + Intronic
956586208 3:70867776-70867798 CTCAGTAAATATTTGTTGAATGG - Intergenic
958120528 3:89281569-89281591 AACAGTAAATATTTGTTGAAAGG - Intronic
958647681 3:96893343-96893365 CACAATAAACATGAGATGCAAGG - Intronic
960990433 3:123306952-123306974 CACTTAAAATATTAGTTTCAAGG - Intronic
962321745 3:134396326-134396348 CACAATAAATATCCGTTGAATGG + Intergenic
965409158 3:168307748-168307770 TACAGTAAGTATTTGTTGGATGG + Intergenic
965687211 3:171316827-171316849 TCAAGTAAATAGTAGTTGCATGG - Intronic
965758615 3:172051442-172051464 CACAGTAAATATTCATTTGATGG + Intronic
965859142 3:173125846-173125868 CACAGTAAATATTTGTTGACTGG + Intronic
965917717 3:173871517-173871539 CTCAGTAAATGTTACTTGAATGG + Intronic
965961918 3:174439787-174439809 CACAGCAAATATTAGTGGGCTGG - Intronic
966059171 3:175734205-175734227 CCAAGCAAATATTTGTTGCAGGG - Intronic
966226359 3:177602448-177602470 CATTGTAAATATCACTTGCATGG + Intergenic
966415806 3:179688233-179688255 CTGAGTAAATATTTGTTGGATGG - Intronic
967590268 3:191265694-191265716 GTAAATAAATATTAGTTGCATGG - Intergenic
967673978 3:192273653-192273675 CTCAGTAAATATTAAATGAATGG + Intronic
967811435 3:193764457-193764479 CTCAATAAATATTTGTTGCATGG + Intergenic
968761886 4:2446743-2446765 CTCAGTAAATACCAGTTGGATGG + Intronic
970021396 4:11573582-11573604 CTTAGTAAATATTTGTTGGATGG + Intergenic
970845479 4:20532858-20532880 CTTAATAAATATTTGTTGCATGG - Intronic
971049991 4:22850676-22850698 CTCAGTGAATATCAGTTGGAAGG + Intergenic
971536646 4:27760378-27760400 GTCAGTAAATATTTGTTGAATGG - Intergenic
972250819 4:37298760-37298782 CAAAATACCTATTAGTTGCAAGG + Intronic
972404717 4:38734714-38734736 CACTGTAAATACTTGTTGCATGG + Intergenic
973896131 4:55414998-55415020 CAGATTAGATAGTAGTTGCAAGG - Intronic
974894220 4:67919494-67919516 CTCAGTAAATATTTGTGGAAGGG - Intronic
975478883 4:74855826-74855848 CCCAGTAAATATTTGTTTCATGG - Intergenic
976191749 4:82493932-82493954 CCCAGTAAATATTTTTTGCTTGG - Intronic
976241138 4:82957903-82957925 CTCAGTAAATACTTGTTGTATGG + Intronic
977656480 4:99527348-99527370 CAGAGTGAATATTTGTTTCATGG - Intronic
977723953 4:100272212-100272234 CTCAATAAATATTAGTTATATGG - Intergenic
978160079 4:105535961-105535983 CGCAATAAATTTTAGTGGCAGGG + Intergenic
979087095 4:116427167-116427189 CACAGTAAATATTCTTAGTATGG - Intergenic
980113178 4:128654082-128654104 CTCAGTAAATATTAATTGAAGGG + Intergenic
983035228 4:162856401-162856423 TTCAGTAATTATTAGTAGCAAGG - Intergenic
983354661 4:166640823-166640845 CAGTGTAAAAATTAGTTACATGG - Intergenic
983382721 4:167018245-167018267 AAAAGGAAATATTAGGTGCAAGG - Intronic
984552629 4:181179378-181179400 CTCAGTAAATATTTGTTTTAAGG + Intergenic
985045483 4:185936314-185936336 ATCAATAAATATTTGTTGCAGGG - Intronic
985109874 4:186537958-186537980 CACAGTCAATATTTGTTCCCAGG + Intronic
988063756 5:26207412-26207434 CTCAGTAAATTTCAGTTGCATGG + Intergenic
989669822 5:43902963-43902985 CACTGTAAACTTTATTTGCATGG + Intergenic
990726212 5:58757693-58757715 CAGACTATTTATTAGTTGCAGGG - Intronic
991414437 5:66377924-66377946 CACAGTCAATATTTATTGAATGG - Intergenic
991679310 5:69122739-69122761 CTGAATAGATATTAGTTGCAAGG + Intronic
992090939 5:73316314-73316336 CTCAGTAAATGTTTGTTGAATGG - Intergenic
992268881 5:75045697-75045719 CACAGTAAATGTTTGTGGGATGG - Intergenic
992666499 5:79014836-79014858 CTCTGTAAATATTTGTTGAAGGG - Intronic
992671756 5:79068562-79068584 CCCAGTAAATATTTGTTGAATGG + Intronic
993971954 5:94430303-94430325 CTCACTAAATATTAGTTGAATGG + Intronic
994282637 5:97924173-97924195 CTCAGTGAATATTTGTTGAAGGG - Intergenic
994431128 5:99662597-99662619 AACAGTAAACATCAGTTCCATGG - Intergenic
995025776 5:107420778-107420800 CTCAGGAAATATTTATTGCATGG - Intronic
996117236 5:119632665-119632687 CTCAGTAAATATTTGTTGGATGG + Intronic
996939988 5:128992937-128992959 CTCAGTAAATATTTATTGAATGG + Intronic
997122665 5:131191492-131191514 CACTGTAGATATTATTTGAATGG - Intronic
997377234 5:133405911-133405933 CTCAGTAAATATTTGTTGGGTGG - Intronic
998551628 5:143083445-143083467 CACAGTAAATATTTTTTGAGTGG + Intronic
998560600 5:143167910-143167932 CACATTAAAGATGAGTTACAGGG + Intronic
999016721 5:148114546-148114568 CACAATACATATTATTTGCCTGG - Intronic
999476185 5:151900910-151900932 CTCAGTAAATATTTGTTAAATGG + Intronic
999479096 5:151928834-151928856 CTCAGTAAATATTTATTGCAAGG + Intergenic
999847725 5:155503852-155503874 TACAGCAAATATTATGTGCAAGG + Intergenic
1000078081 5:157813804-157813826 CACAGTAAATATTATTTGGTGGG + Intronic
1000148511 5:158476691-158476713 CTGAGTAAATATTTCTTGCATGG + Intergenic
1000197504 5:158973624-158973646 CTCAGTAACTATAAGTTCCATGG + Intronic
1000347514 5:160327270-160327292 ATCACTAAATATTAGTTGAATGG - Intronic
1000488414 5:161878125-161878147 CTCAGTAAATATTTATTGAATGG + Intronic
1000996816 5:167967818-167967840 GACAGTTGATATTAGTTGAATGG - Intronic
1001411265 5:171513964-171513986 CACAGTAAATATTTGTGGAATGG - Intergenic
1001822636 5:174721731-174721753 CTCAGTAAATGTTAGTTCCCAGG - Intergenic
1002596572 5:180327652-180327674 CACAGTAAATATTAGTTGCATGG + Intronic
1004328313 6:14697684-14697706 CACAGTAGATACTTATTGCAAGG - Intergenic
1007140901 6:39572899-39572921 TAATGTAAATATTTGTTGCATGG - Intronic
1010394735 6:75377680-75377702 CTCAGTAAACATTTGTTGAATGG + Intronic
1010439454 6:75876371-75876393 CTCAGTAAATATTTGTTGAATGG + Intronic
1010658114 6:78536575-78536597 TTCAATAAATATTAGTTGAATGG + Intergenic
1011029882 6:82910311-82910333 TTCAGTAAATATTTGTTGCCTGG + Intronic
1012239093 6:96851822-96851844 CTCAGTAAATATTTGTGGAATGG + Intergenic
1012533117 6:100262825-100262847 AACAATAAATATTGGTTGAATGG + Intergenic
1012869254 6:104654917-104654939 AACAGTATATTATAGTTGCAGGG + Intergenic
1014032879 6:116727143-116727165 CAATGTAAATAATAGGTGCATGG + Intronic
1014049020 6:116930036-116930058 CACAGTACATTTTAGTCTCATGG - Intronic
1014255222 6:119154382-119154404 TCCAGTAAATATTTATTGCACGG + Intergenic
1014477646 6:121893466-121893488 CTTAGTAAATATTTGTTGAAAGG + Intergenic
1015186632 6:130424563-130424585 CAAAGTAAATATTAGTTAAATGG - Intronic
1015552621 6:134427813-134427835 CACAGGAAATGATAGATGCATGG + Intergenic
1017267024 6:152459252-152459274 CAAAGTGAAAATGAGTTGCATGG - Intronic
1017538403 6:155373258-155373280 CTCAGTAAATACTTGTTGAATGG - Intergenic
1018626996 6:165789586-165789608 AACAGCAAATACTAATTGCATGG + Intronic
1020638728 7:10728996-10729018 CACAGTAAATGTCAATTGCCCGG + Intergenic
1020639577 7:10738729-10738751 CACAGTAACCACTAGCTGCATGG - Intergenic
1023057983 7:36304910-36304932 TTCAGTAAATATGAGTTGGATGG - Intergenic
1023185500 7:37528890-37528912 AATAGTAAATACTTGTTGCATGG - Intergenic
1023574910 7:41617413-41617435 CTCAATAAATATTTGTTGAATGG - Intergenic
1023683254 7:42710383-42710405 CAGAGTGAATATTAGGTGAAAGG - Intergenic
1023761216 7:43467100-43467122 CACAGAAAATGTTTGTTGAATGG - Intronic
1024504712 7:50152362-50152384 AACAGGAAATGTTAGATGCAAGG + Intronic
1024716405 7:52084299-52084321 CAGAGAACATATTAGTTTCAGGG + Intergenic
1027719988 7:81728471-81728493 CAGAGAAAATATTAGTTATAAGG - Intronic
1028409355 7:90511455-90511477 CACAGAAAATAGTAATGGCAGGG - Intronic
1028658907 7:93244186-93244208 CTCAATAAATATTTGTTGAATGG - Intronic
1028977487 7:96930304-96930326 CTCAGTAAATATTTGTTGCATGG + Intergenic
1029177741 7:98676827-98676849 CTCAGTAAATATTATTAGGATGG + Intergenic
1029949153 7:104564424-104564446 CTCAGTAAATATTTGTTGAATGG - Intronic
1030367334 7:108660424-108660446 CCCAATAAATATTTGATGCATGG + Intergenic
1030432324 7:109466240-109466262 CACAGTAACTGATAGTTGCATGG + Intergenic
1031218497 7:118930232-118930254 AACAGTAGCTATTAGTTACATGG + Intergenic
1031761458 7:125717494-125717516 CACAGCAGATATAAGTAGCATGG - Intergenic
1033797273 7:144861720-144861742 CCCAGTAAATATTTGTTGATTGG - Intergenic
1036448820 8:8846981-8847003 CACAATAAATATTTGTTGAATGG + Intronic
1037015007 8:13893100-13893122 CACAATAAATATCATTGGCAAGG - Intergenic
1037095469 8:14981092-14981114 CACAGCAAATATGAGTTGGTAGG - Intronic
1037981455 8:23257471-23257493 CTCAATAAATATTAGTTGAATGG - Intronic
1038675517 8:29619316-29619338 CACAATAAATATTTGTTGAATGG + Intergenic
1039114999 8:34083226-34083248 CACAGTAAATAATAGTAATATGG + Intergenic
1039822936 8:41149780-41149802 TTCAGTAAATATTAGTTGAAGGG + Intergenic
1040460886 8:47647160-47647182 CACAATAAATATTTGTTGAATGG - Intronic
1040936347 8:52785828-52785850 CAAAATAAATATTATTTCCATGG - Intergenic
1041770647 8:61469105-61469127 CTCAGTAAATATTTGTTGAGTGG - Intronic
1042689234 8:71478879-71478901 CTCAGTAAATATTTGTTGAATGG - Intronic
1043164076 8:76881452-76881474 CACAATAAATATCATTTGTAAGG - Intergenic
1043502039 8:80867818-80867840 CTCAGTAAATATTAATTGAATGG - Intronic
1043636082 8:82383939-82383961 CAGAGTGAATAGTAGTTGCCAGG - Intergenic
1044080897 8:87882217-87882239 TACAGTAAATATTATGTGTAAGG - Intergenic
1044458311 8:92414961-92414983 CTCAATAAATATTTGTTGTATGG - Intergenic
1044922954 8:97185302-97185324 AACTGTAAATAATGGTTGCAGGG + Intergenic
1045338614 8:101231997-101232019 CTCAGTAAATATCTGCTGCATGG - Intergenic
1045694489 8:104793178-104793200 CTCAGTAAATATTTGTGGCATGG + Intronic
1046864709 8:119134544-119134566 CCCAACAAATATTAGTTGAATGG + Intergenic
1048503887 8:135003487-135003509 CTCAGTAAATATTTGTAGAATGG - Intergenic
1050988663 9:12117307-12117329 GACAATAAATATTTGTTGAAGGG - Intergenic
1051083652 9:13322170-13322192 CTCAGTAAATATTTGTTGATTGG + Intergenic
1052018470 9:23497988-23498010 CACAATAAATATTTGTGGCATGG + Intergenic
1052599786 9:30610827-30610849 CCCAGTAAATAATAGTGGCATGG + Intergenic
1053570348 9:39298494-39298516 CAAAGTAAATTTCAGTTGAATGG + Intergenic
1053836302 9:42139424-42139446 CAAAGTAAATTTCAGTTGAATGG + Intergenic
1054091970 9:60857503-60857525 CAAAGTAAATTTCAGTTGAATGG + Intergenic
1054113383 9:61133093-61133115 CAAAGTAAATTTCAGTTGAATGG + Intergenic
1054126800 9:61320513-61320535 CAAAGTAAATTTCAGTTGAATGG - Intergenic
1054594316 9:67049075-67049097 CAAAGTAAATTTCAGTTGAATGG - Intergenic
1054818838 9:69501504-69501526 CACAGAAAATATGAGTGGCTGGG + Intronic
1054849425 9:69831587-69831609 CACAGTACATTGTAGTTGCTGGG - Intronic
1055424562 9:76180830-76180852 CTCAGTAAATATTTGTTGAATGG + Intronic
1055832993 9:80405067-80405089 CACAGTAAATATTTGTTCAATGG + Intergenic
1055999506 9:82199913-82199935 CTCAGTAAATATTTATGGCATGG + Intergenic
1056125554 9:83533631-83533653 CACATTAAACATCAGTTGAATGG - Intronic
1057922854 9:99112605-99112627 CTCAGTAAATATTTGTTGAGTGG + Intronic
1058532467 9:105920292-105920314 CACAGTAAATAATAGGTTAATGG - Intergenic
1058662786 9:107282272-107282294 CACGGTAAATATTTGTGGAATGG - Intergenic
1059592063 9:115672495-115672517 CAATATAAATATTAGTTGAATGG + Intergenic
1059647488 9:116281745-116281767 CTCAGTAAATATTTATTGAATGG - Intronic
1060562190 9:124555011-124555033 CACAGTAAATATTTATTGGCTGG - Intronic
1186369017 X:8927522-8927544 CCCACTAAATATTTGTTGAATGG + Intergenic
1187428556 X:19201312-19201334 CAGAGTGTATATTAGATGCAAGG + Intergenic
1187456195 X:19443333-19443355 CTCAGTAAAGATTTGTTGAATGG - Intronic
1188274562 X:28183585-28183607 CTCAATAATCATTAGTTGCAGGG - Intergenic
1188702938 X:33287911-33287933 CACATGAAGTATTATTTGCAGGG - Intronic
1188908182 X:35813200-35813222 AACAGTAAATATCAGTTCTATGG + Intergenic
1189114748 X:38331063-38331085 CACAATAAATATCTGTTGAATGG + Intronic
1189177662 X:38974162-38974184 CTCAATAAATATTTGTTGAATGG - Intergenic
1190433958 X:50405048-50405070 CTCAGTAAATATTTGTTTAATGG - Intronic
1192873778 X:75208410-75208432 TACAGTCCATATTAGTTGGATGG + Intergenic
1193379748 X:80805407-80805429 CATAGTAAATAGGGGTTGCATGG - Intronic
1194567513 X:95510711-95510733 CTCAATAAATATTTGTTGAATGG - Intergenic
1194857453 X:98951099-98951121 CACAGTATAAATTAGATTCATGG + Intergenic
1195499567 X:105579148-105579170 GACAGAAAAATTTAGTTGCAGGG - Intronic
1195691204 X:107627188-107627210 CTCAGTAAATATTTGATGAATGG + Intergenic
1195777852 X:108427342-108427364 CTAAATAAATATTAGTTGAAGGG + Intronic
1196142511 X:112279893-112279915 TCCAGTAATTATTAATTGCAGGG + Intergenic
1196417326 X:115485434-115485456 CTCAGTAAATATTTGTTGAAGGG + Intergenic
1196681609 X:118475419-118475441 CTCAGTAAATATTTGTTGAATGG - Intergenic
1196812790 X:119641946-119641968 CTCAGTAAATATTTGTAGAATGG - Intronic
1197922962 X:131615007-131615029 CTCAATAAATATTTGTTGAATGG + Intergenic
1198107996 X:133479222-133479244 CTCAGTAAATATTTCTTGGATGG - Intergenic
1198119650 X:133579386-133579408 CTCAGTAAGTGTTTGTTGCATGG - Intronic
1198426826 X:136529072-136529094 CTCAGTAAATATTTGTTGAATGG - Intergenic
1198495995 X:137194081-137194103 CTCACTAAATATTTGTTGAAAGG + Intergenic
1198565820 X:137904821-137904843 CTCCGTAGATATTTGTTGCATGG + Intergenic
1198567521 X:137919837-137919859 CTCAGTTAATATTTGTTGGATGG + Intergenic
1198677923 X:139150628-139150650 CTCAGTAAATATTTGTTGATAGG - Intronic
1198740718 X:139839460-139839482 CTCAATAAATATTGGTTGAATGG - Intronic
1198815870 X:140589531-140589553 CACAGTAAACTTTTGTTGGATGG - Intergenic
1198979248 X:142376084-142376106 AACTGTAAATATTAGTTCTATGG + Intergenic
1199187651 X:144936076-144936098 CACAATAAAATTAAGTTGCAGGG + Intergenic
1199807589 X:151315807-151315829 CTTACTAAATATTTGTTGCATGG - Intergenic
1200355394 X:155544633-155544655 CACAGAAAGTATTAGTTGGCAGG - Intronic