ID: 1002596573

View in Genome Browser
Species Human (GRCh38)
Location 5:180327656-180327678
Sequence GTAAATATTAGTTGCATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002596568_1002596573 6 Left 1002596568 5:180327627-180327649 CCCAGGGCCCAGCACACAGTAAG 0: 1
1: 3
2: 32
3: 170
4: 749
Right 1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1002596571_1002596573 -2 Left 1002596571 5:180327635-180327657 CCAGCACACAGTAAGTGCACAGT 0: 1
1: 7
2: 47
3: 242
4: 820
Right 1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1002596564_1002596573 28 Left 1002596564 5:180327605-180327627 CCAGGTCAGATGTCACTAAGTCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1002596567_1002596573 7 Left 1002596567 5:180327626-180327648 CCCCAGGGCCCAGCACACAGTAA 0: 1
1: 3
2: 21
3: 141
4: 735
Right 1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1002596569_1002596573 5 Left 1002596569 5:180327628-180327650 CCAGGGCCCAGCACACAGTAAGT 0: 1
1: 1
2: 30
3: 140
4: 625
Right 1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1002596570_1002596573 -1 Left 1002596570 5:180327634-180327656 CCCAGCACACAGTAAGTGCACAG 0: 1
1: 10
2: 88
3: 558
4: 2264
Right 1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002596573 Original CRISPR GTAAATATTAGTTGCATGGT TGG Intronic
901342664 1:8509448-8509470 TTAAATATTTGTTGGATGGACGG - Intronic
903340646 1:22652320-22652342 CTAAATATTTGTTAAATGGTGGG + Intergenic
904052910 1:27650978-27651000 GTAAATATTTGTTGAATGAATGG - Intergenic
905047523 1:35018620-35018642 GTAAATAATAGTTGCTTCCTAGG - Intronic
905839048 1:41158187-41158209 ATAAATATTTGTTGGATGGATGG - Intronic
906778913 1:48555040-48555062 GTAAATAAAAGTTGCAAGTTAGG + Intronic
907975416 1:59426788-59426810 GTAAATATTTGTTGAATGGATGG + Intronic
908167709 1:61474693-61474715 GTAAATGTTAGTTACAGTGTAGG - Intergenic
909549638 1:76883384-76883406 ATAAATATTTGTTGAATGTTGGG + Intronic
910385365 1:86676923-86676945 GTAAATATTAATTTCTTAGTAGG - Intergenic
910974033 1:92886940-92886962 GTAAATATTTTTTGCTTTGTTGG - Intronic
917719288 1:177770880-177770902 GTAAATATTTGTTGAATGAATGG - Intergenic
918150459 1:181794047-181794069 GAAAATATTTCTTGCATGGCTGG - Intronic
919364156 1:196635882-196635904 GTAAATAGATGTTACATGGTAGG + Intergenic
920738148 1:208554136-208554158 ATAAATATTAATTACATGTTAGG + Intergenic
921454234 1:215348432-215348454 GTAAATATTACTTGGATGAATGG + Intergenic
924091737 1:240508414-240508436 GTAAATATTTGCTGCATGAATGG - Intronic
924308610 1:242717458-242717480 GTAAATATTTGTTGAATGAAGGG + Intergenic
1063892059 10:10640659-10640681 GTAAATATTTGTTGGATGGATGG + Intergenic
1064132371 10:12721548-12721570 GTAAATATTTTTTGGATGGATGG - Intronic
1064724370 10:18262814-18262836 GTAAAAATTTGTTGCTTTGTTGG - Intronic
1065116814 10:22491214-22491236 GTAAATATTAGTTAAATGAATGG + Intergenic
1065804498 10:29382303-29382325 GTAAATATTTGTTGGATGAATGG - Intergenic
1068305020 10:55197805-55197827 ATAAATATTAGATGCATAATGGG - Intronic
1068557325 10:58473651-58473673 GTAAATTTTGATTGCATGCTGGG + Intergenic
1068877053 10:62008199-62008221 GTAAATATTGGTTACATGAATGG + Intronic
1069285246 10:66706271-66706293 ATAAATATTTGTTGAATGGAAGG - Intronic
1070584535 10:77752475-77752497 GTATATATTAACAGCATGGTGGG - Intergenic
1071376493 10:85010764-85010786 GTAAAAATGAGTTGCATAGATGG + Intergenic
1071480110 10:86058742-86058764 GAAAATATTTGCTGCATGTTTGG - Intronic
1073624404 10:105082010-105082032 GTAAATATTTGTTGAATGAACGG - Intronic
1074941844 10:118244078-118244100 GTAAATATTTGTTGAATGAATGG - Intergenic
1074943821 10:118261051-118261073 GTAACTATTTGTTGGATGGATGG - Intergenic
1075509076 10:123054459-123054481 GGAAATATTTGTTACATAGTAGG + Exonic
1077621354 11:3727574-3727596 GTAAATAAAGGTGGCATGGTGGG + Intronic
1077968192 11:7158503-7158525 ATAAATATCAGTTGCATGTTAGG - Intergenic
1079341858 11:19618191-19618213 TTCAATATTTGTTGCATGGATGG + Intronic
1079758169 11:24292767-24292789 GGAAATATCAATTGAATGGTTGG - Intergenic
1079852951 11:25560732-25560754 GTAAATTTTAGTTGCTGGGCTGG + Intergenic
1081286542 11:41277131-41277153 ATAAATATTTGTTGAATGGGTGG + Intronic
1085473580 11:76773695-76773717 GTAAACATTTGTTGGATGGATGG + Intergenic
1085646853 11:78229606-78229628 GTAAATATTAGTAGGATGGAAGG - Intronic
1086853607 11:91840154-91840176 GTAAATCTTTCTTGCATGGATGG + Intergenic
1088671617 11:112146747-112146769 ATAAATATTAGTTGGAGGGGGGG - Intronic
1088993417 11:114974240-114974262 GTAAATATTTGTTGAATGAATGG + Intergenic
1089008416 11:115112746-115112768 ATAAATATTTGTTGGATGGACGG + Intergenic
1090620157 11:128553479-128553501 GTGGATATTAGTAGCATGGTAGG - Intronic
1090735972 11:129612516-129612538 ATAAATATTATTTGCCTGGGAGG + Intergenic
1092095996 12:5842308-5842330 ATAAATATTCATTGGATGGTCGG + Intronic
1092754999 12:11755073-11755095 GTAAATATTTATTGGATGGATGG + Intronic
1095241692 12:39867393-39867415 ATAAATATTGGTTGAATGGATGG + Intronic
1097081813 12:56437227-56437249 GCAAATATTTATTGCATGCTTGG - Intronic
1098983812 12:76988258-76988280 GTAAATATTAATTATATTGTAGG + Intergenic
1099467037 12:83000777-83000799 GCAAAAATTTGTTGCATGGGTGG - Intronic
1100955807 12:99906793-99906815 ATAAATATTTGTTGAATGGAAGG - Intronic
1101667502 12:106832670-106832692 ATAAATATTAGTTGGATGAAGGG + Intronic
1102209938 12:111119132-111119154 GTAAATATTTTTTACATTGTGGG + Intronic
1102927685 12:116839286-116839308 GTAAATATTGGATGGATGGATGG + Intronic
1103784004 12:123418588-123418610 GTAAATATTTGTTGAATGAATGG + Intronic
1109128401 13:58547859-58547881 GTATATATTATTTCCATGATTGG + Intergenic
1109168095 13:59060583-59060605 GTAAATATTATTAGGATGGAAGG - Intergenic
1109383156 13:61591847-61591869 GTAACTATTACTTCCACGGTAGG + Intergenic
1109965021 13:69680879-69680901 ATAAATAAAAGTTGCATGGATGG + Intergenic
1110564309 13:76942585-76942607 GTTGATATTAATTGCATGGTTGG - Intergenic
1114128645 14:19762180-19762202 GTTAATAGTAGTTGGTTGGTGGG + Intronic
1115779142 14:36750071-36750093 GTAAATATTTGTTGACTGGAAGG + Intronic
1115804074 14:37031393-37031415 TTAAATATTATTTTCATGTTAGG + Intronic
1116350479 14:43855995-43856017 TTAAATATTAATTGCATACTGGG - Intergenic
1116772055 14:49138195-49138217 GTAAATACTACTTGGTTGGTGGG - Intergenic
1120127650 14:80765011-80765033 GTAAATATTTGTTGGATGAGGGG - Intronic
1121506785 14:94483747-94483769 GTGAATATTTGTTGAATGGATGG + Intergenic
1123571585 15:21616422-21616444 GTTAATAGTAGTTGGTTGGTGGG + Intergenic
1123608202 15:22059013-22059035 GTTAATAGTAGTTGGTTGGTGGG + Intergenic
1125281723 15:38048641-38048663 GTAAATAATAATTTCTTGGTGGG - Intergenic
1125840156 15:42793033-42793055 GTAAATATTAGTGGCAGAGCTGG - Intronic
1128585738 15:68848697-68848719 AAAAATATTAGTTGCTTGCTAGG - Intronic
1128922951 15:71628912-71628934 ATAAATATTAGTTAGATGGCTGG - Intronic
1129825759 15:78634156-78634178 GGAAATATAACTTGCATGGGTGG + Intronic
1131940863 15:97563368-97563390 GAAGGTATTAGTTGCATGGGCGG + Intergenic
1202980439 15_KI270727v1_random:350811-350833 GTTAATAGTAGTTGGTTGGTGGG + Intergenic
1133462647 16:6000610-6000632 TTAAATATTTGTTGAATGGATGG + Intergenic
1134106991 16:11492333-11492355 GTTAATATTTGTTGCATGGATGG - Intronic
1136984818 16:35090980-35091002 GTAAATATTTGTTGAATGAATGG + Intergenic
1137243600 16:46683115-46683137 GTAAATATTTGTTGAATGAATGG - Intronic
1137536205 16:49328339-49328361 GTAAAAATGGGTTGCATGATGGG + Intergenic
1137810200 16:51345285-51345307 GTAAATATTATCTGGATGGACGG + Intergenic
1138081631 16:54096096-54096118 GTAAATATTTGTTGAATGAATGG + Intronic
1139133186 16:64170432-64170454 ATAAAAATTAGTTGGATGGGTGG + Intergenic
1140945699 16:79766387-79766409 GTAAATATTTGCTGGATGGATGG + Intergenic
1143143526 17:4757411-4757433 GTAAATATTTGTTGAATGAGAGG + Intergenic
1143675018 17:8426227-8426249 TTAAATATTTGTTGAATGGTTGG + Intronic
1149357584 17:55858461-55858483 ATAAATATTATTTGCATAATTGG - Intergenic
1149854298 17:60066701-60066723 GTAGATATTCGTTGAATGGATGG - Intronic
1150608886 17:66717337-66717359 GTAAATATTTGTGGCTTTGTGGG - Intronic
1151039089 17:70837547-70837569 ATAAATATTTGTTTAATGGTCGG + Intergenic
1154223750 18:12481319-12481341 GTAAATATTACTTGCTAGGGGGG - Intronic
1154459673 18:14568405-14568427 GTAAATATTACTTTCACGGCCGG - Intergenic
1155647686 18:28100017-28100039 GTAAATATTGGATGGATGGGTGG - Intronic
1156796062 18:41047693-41047715 GTAATTATTATTTGCATTTTGGG + Intergenic
1161372898 19:3923681-3923703 GTAAATGGTAGATGAATGGTTGG + Intronic
1162227269 19:9233832-9233854 GTAAATATTTTCTGCATGGACGG - Intergenic
1166103351 19:40584156-40584178 GTAAATATTTGTTGAATGACTGG - Intronic
1167646965 19:50711171-50711193 GTAAATATCTGTTGGATGGATGG + Intronic
1167673132 19:50867330-50867352 TTAAACATTTGTTTCATGGTGGG - Intronic
927969107 2:27293273-27293295 TTAAATATAAGCTGCCTGGTTGG + Intronic
931182873 2:59920839-59920861 GAAAATTTTAATTGCATGATGGG + Intergenic
931590651 2:63879973-63879995 GTAAATATTAGGTCCTTGCTAGG + Intronic
931831738 2:66059485-66059507 GTAAATATTTGTTGATTGGTTGG + Intergenic
936265491 2:111002200-111002222 GCATATCTTGGTTGCATGGTTGG - Intronic
936374957 2:111932750-111932772 GTATATATTAGTTTCAGGGTAGG + Intronic
938169833 2:129065332-129065354 GTAAATATTGGTGGAATGGAGGG + Intergenic
939010229 2:136837822-136837844 TTGAATATTAATTGCAAGGTAGG - Intronic
939866872 2:147482522-147482544 CCAAGTATAAGTTGCATGGTAGG + Intergenic
940162916 2:150733109-150733131 GTTAATATAGGTTGCATGCTTGG + Intergenic
941598630 2:167510500-167510522 GTAAATACTATTTGTATGTTTGG + Intergenic
941921890 2:170859343-170859365 ACAAATATTTGTTGAATGGTTGG - Intronic
942244631 2:173995944-173995966 GTAAACATTTGTTGAATGATTGG - Intergenic
943137464 2:183932654-183932676 GTAAATATAATTTAGATGGTGGG - Intergenic
943422695 2:187687890-187687912 ATAAATTTTAGCTGAATGGTGGG + Intergenic
944816518 2:203382454-203382476 GTAAATATTTGTTGAATGAATGG + Intronic
946537761 2:220649807-220649829 CTAAATATTAGTTGAATGGACGG + Intergenic
948736681 2:240012690-240012712 GTAAATATTCTTTGAATGATAGG - Intronic
1170459816 20:16566970-16566992 GTAAGAATTAGTTGCAAGGCAGG - Intronic
1170527894 20:17259691-17259713 GTAAATACCAGTTGGATGGCAGG - Intronic
1173255511 20:41392056-41392078 GTAAATATCTGTTGAATGGAAGG + Intergenic
1175265106 20:57697997-57698019 TTAAACATTTGTTTCATGGTAGG + Intronic
1178065042 21:28895392-28895414 ATAAATATTAGATGCATGCTTGG - Intergenic
1178179805 21:30146840-30146862 GAACATCTTAATTGCATGGTTGG - Intergenic
1179175266 21:39003472-39003494 ACAATTATTGGTTGCATGGTTGG + Intergenic
1180746488 22:18092535-18092557 GAAAATATTAATTGCATAGAAGG + Exonic
1182764317 22:32747682-32747704 TTAAATCTTAGCAGCATGGTGGG - Intronic
1183154124 22:36061570-36061592 GTAAAGGTTAGTTGCAATGTGGG - Intergenic
1184949574 22:47831546-47831568 GAAAATATTTGCTGCATAGTTGG - Intergenic
949151130 3:768470-768492 GTAAAAATTAGTTGCTTCGAAGG - Intergenic
950249187 3:11449799-11449821 ATATATATTAGTTGAATGATAGG + Intronic
952173460 3:30835383-30835405 GTAAAAAGAAGTGGCATGGTTGG + Intronic
952182043 3:30927200-30927222 GAAAAAATTTGTTGCATGCTAGG - Intergenic
953634412 3:44650547-44650569 ATAATTATTAGTAGTATGGTTGG + Intronic
953944643 3:47136026-47136048 GTACCTATTAGTTGGATGGGTGG - Intronic
955205241 3:56889763-56889785 TTAAATATTTGTTTCATGGCTGG + Intronic
958120527 3:89281565-89281587 GTAAATATTTGTTGAAAGGAAGG - Intronic
959683425 3:109121577-109121599 GTAAACATTCTTTTCATGGTTGG + Intergenic
959851820 3:111096848-111096870 GCAAATGTTTGTTGCAGGGTTGG + Intronic
960331739 3:116368078-116368100 GAAAATATTAGCTGCTTGATAGG + Intronic
962300457 3:134237426-134237448 TTAAATATTAGATGCATGAATGG + Intronic
963186986 3:142429471-142429493 GGAAATTTTAGTGGCATGGTGGG + Intronic
966212298 3:177466009-177466031 TTATGTATTAGTTGCATGCTGGG + Intergenic
966415805 3:179688229-179688251 GTAAATATTTGTTGGATGGATGG - Intronic
967457425 3:189704405-189704427 GTAGATATTATTTAAATGGTGGG - Intronic
968761887 4:2446747-2446769 GTAAATACCAGTTGGATGGATGG + Intronic
970351443 4:15205663-15205685 TAAAATATTTGTTGCATGATTGG - Intergenic
970488883 4:16551999-16552021 GCAAATATTTGTTGGATAGTTGG - Intronic
970584159 4:17499480-17499502 GTAAATGTTAGCTGTCTGGTTGG - Intronic
970755536 4:19421576-19421598 ATAAATAGGAGTTGGATGGTTGG + Intergenic
971315356 4:25563450-25563472 GTAAATATTTGTTGAATGTCTGG + Intergenic
971622795 4:28877475-28877497 GAAAATATTTGTTGAATGATTGG - Intergenic
971800531 4:31284777-31284799 GTAAATATCCATTGCTTGGTAGG + Intergenic
972556878 4:40190269-40190291 GTAAATATTTGTTGAATGAAAGG + Intergenic
973085069 4:46048539-46048561 GTAAAGAGTCGGTGCATGGTGGG - Intronic
973902668 4:55493988-55494010 ATATATATTAGTTGAATCGTTGG - Intronic
974403720 4:61438638-61438660 TTAAATATTAGTTGAATGAATGG + Intronic
977232811 4:94472243-94472265 GTAAATATTTGTTGAATGAGTGG + Intronic
978848092 4:113298936-113298958 TTAAATATTTGTTGAATGGATGG - Intronic
979291086 4:118979622-118979644 GTAAATATTTGTTCACTGGTTGG + Intronic
979680127 4:123450205-123450227 GTAAGTATTATTTGGATGGATGG + Intergenic
980524995 4:133978310-133978332 GTAAAAATCAGTTGCAGGATGGG + Intergenic
982018456 4:151179687-151179709 TTAAATATAAATTGCATGGCTGG + Intronic
982381003 4:154747086-154747108 GTTAATATTAGTTGCATATATGG - Intronic
983370654 4:166853580-166853602 CTAAATAACAGTTGTATGGTGGG + Intronic
984058271 4:174957015-174957037 TTAAGTATTATTTGCATGTTTGG - Intronic
984062973 4:175014797-175014819 GTAAATATTATTGGCATAATTGG + Intergenic
985045482 4:185936310-185936332 ATAAATATTTGTTGCAGGGATGG - Intronic
985815035 5:2121402-2121424 CCAGTTATTAGTTGCATGGTTGG + Intergenic
988617288 5:32786959-32786981 GTAAATATTAGTGAGATGGGAGG + Exonic
989664880 5:43842350-43842372 GTAAATATTTGTTGAATGAATGG - Intergenic
991508001 5:67344550-67344572 GTAAATATTAATAGCATTCTTGG + Intergenic
991572833 5:68073770-68073792 GTAAATATTTGTTGAATGAAAGG + Intergenic
992075330 5:73187558-73187580 GAAGATTTTAGTTGCAGGGTGGG - Intergenic
992537968 5:77730727-77730749 GTAAATATTGGATGGATGGATGG - Intronic
995300349 5:110573475-110573497 GTAAATATTAGTTAAATGCATGG - Intronic
995438484 5:112163725-112163747 GAAAATCTTAGTTGCTTGGCGGG + Exonic
997100618 5:130964959-130964981 GTAAATATTTGTTGAGTGATAGG + Intergenic
1002596573 5:180327656-180327678 GTAAATATTAGTTGCATGGTTGG + Intronic
1002809893 6:617564-617586 ATAAATATTTGTTGCAGAGTAGG - Intronic
1006555709 6:34864472-34864494 GTCAGGATTAGTTTCATGGTTGG + Intronic
1007849789 6:44792057-44792079 GTAAATATTTATTGAATGCTGGG + Intergenic
1010333746 6:74656202-74656224 GTAAATCTGAATTGCATGTTAGG - Intergenic
1011013794 6:82732438-82732460 GTAGATATTATTTGCAGGATAGG + Intergenic
1012036401 6:94146529-94146551 TTAAGTATTAATTGCATGATTGG + Intergenic
1012166904 6:95966650-95966672 GTAAATTTTACTTACATGTTTGG - Intergenic
1012244915 6:96915255-96915277 GTAAATATTTGTTGGATGATGGG - Intergenic
1012914325 6:105152450-105152472 GTAAATATTCATTGCATAGAAGG - Intergenic
1014470427 6:121807336-121807358 TTAAAGATTAGTTGCAATGTGGG - Intergenic
1018158830 6:161016871-161016893 GTAAATATTTATTGCATGGATGG + Intronic
1020558945 7:9704954-9704976 GTAGTAATTAGTTGCGTGGTAGG - Intergenic
1020701466 7:11489171-11489193 GTAAATATTTGTTGGATGAGGGG + Intronic
1021367659 7:19800888-19800910 GTAAATGTATGTTGGATGGTGGG - Intergenic
1023057982 7:36304906-36304928 GTAAATATGAGTTGGATGGATGG - Intergenic
1023185498 7:37528886-37528908 GTAAATACTTGTTGCATGGGTGG - Intergenic
1026584440 7:71644885-71644907 GTAAAAATATGTTCCATGGTTGG + Intronic
1029132257 7:98340581-98340603 GTAAATATTACTTACATAGCCGG - Intronic
1029263221 7:99318394-99318416 GTACATGTTAGTTGCAGGTTGGG - Intergenic
1030007936 7:105136826-105136848 GTAAATATTTGTTGCACGAATGG - Intronic
1031922495 7:127612300-127612322 GTAAATATTGGATGGATGGGTGG + Intronic
1032743088 7:134759198-134759220 GTAAATATTTGTGGAATGATTGG - Intronic
1035433256 7:158838264-158838286 GTAAATGTTACTGACATGGTTGG - Intergenic
1037913514 8:22758351-22758373 GTAAATATTTGAGGCCTGGTGGG + Intronic
1038050270 8:23802580-23802602 TTAAAAATCAGTTGCATGGGAGG - Intergenic
1040631385 8:49216839-49216861 GTAAGTTTTAATTGCATGCTGGG + Intergenic
1040728839 8:50418026-50418048 GGAAATTATAGTTGCTTGGTTGG - Intronic
1040766153 8:50913658-50913680 GTAAATATTTGAGGCATTGTGGG + Intergenic
1042689233 8:71478875-71478897 GTAAATATTTGTTGAATGGATGG - Intronic
1052104666 9:24498170-24498192 AAAAATATTAGTTGTGTGGTAGG + Intergenic
1052149121 9:25090881-25090903 TTAAATATTAATTATATGGTGGG + Intergenic
1052432490 9:28385013-28385035 GTAAATATTAATTGAATGAAAGG - Intronic
1055452686 9:76444998-76445020 GTAAATATTTGAAGTATGGTGGG - Intronic
1055591317 9:77817375-77817397 ATAAATATTTGTTGGTTGGTTGG + Intronic
1056336987 9:85581535-85581557 GTAAATATTTGTTGAATGGATGG - Intronic
1059340977 9:113597383-113597405 TTAAATAGTAGTTGGATGCTTGG + Exonic
1059855615 9:118394035-118394057 GTAAATATTCGTTATATGTTGGG + Intergenic
1186741966 X:12528109-12528131 GTTAATATTAGTTGAATGAATGG - Intronic
1188106840 X:26156519-26156541 GTAAAAATTGGTTTCATGGGCGG - Intergenic
1192576473 X:72246986-72247008 GTAAATAGTTGTTGGATGGATGG + Intronic
1193473252 X:81932827-81932849 GTAAATATTATTTGCTGGGATGG + Intergenic
1195044329 X:101042605-101042627 CTAAATATTAGCTGCTTGATTGG - Intronic
1195739323 X:108046576-108046598 GTAAAAATTACTTGTATGTTAGG - Intronic
1196501568 X:116389246-116389268 GTAAATATTTGTTGAATTATTGG - Intergenic
1196720139 X:118846316-118846338 GTAAATATTTGTGGCTTTGTAGG - Intergenic
1196796435 X:119505644-119505666 ATAAATATTAGTTGGATGAATGG - Intergenic
1198567522 X:137919841-137919863 GTTAATATTTGTTGGATGGATGG + Intergenic
1201245113 Y:11995869-11995891 ATAAATAGAAGATGCATGGTTGG + Intergenic