ID: 1002596574

View in Genome Browser
Species Human (GRCh38)
Location 5:180327660-180327682
Sequence ATATTAGTTGCATGGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002596569_1002596574 9 Left 1002596569 5:180327628-180327650 CCAGGGCCCAGCACACAGTAAGT 0: 1
1: 1
2: 30
3: 140
4: 625
Right 1002596574 5:180327660-180327682 ATATTAGTTGCATGGTTGGATGG 0: 1
1: 0
2: 3
3: 22
4: 267
1002596568_1002596574 10 Left 1002596568 5:180327627-180327649 CCCAGGGCCCAGCACACAGTAAG 0: 1
1: 3
2: 32
3: 170
4: 749
Right 1002596574 5:180327660-180327682 ATATTAGTTGCATGGTTGGATGG 0: 1
1: 0
2: 3
3: 22
4: 267
1002596570_1002596574 3 Left 1002596570 5:180327634-180327656 CCCAGCACACAGTAAGTGCACAG 0: 1
1: 10
2: 88
3: 558
4: 2264
Right 1002596574 5:180327660-180327682 ATATTAGTTGCATGGTTGGATGG 0: 1
1: 0
2: 3
3: 22
4: 267
1002596567_1002596574 11 Left 1002596567 5:180327626-180327648 CCCCAGGGCCCAGCACACAGTAA 0: 1
1: 3
2: 21
3: 141
4: 735
Right 1002596574 5:180327660-180327682 ATATTAGTTGCATGGTTGGATGG 0: 1
1: 0
2: 3
3: 22
4: 267
1002596571_1002596574 2 Left 1002596571 5:180327635-180327657 CCAGCACACAGTAAGTGCACAGT 0: 1
1: 7
2: 47
3: 242
4: 820
Right 1002596574 5:180327660-180327682 ATATTAGTTGCATGGTTGGATGG 0: 1
1: 0
2: 3
3: 22
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002596574 Original CRISPR ATATTAGTTGCATGGTTGGA TGG Intronic
900838811 1:5030616-5030638 ATAATAGATGGATGGATGGATGG + Intergenic
901342663 1:8509444-8509466 ATATTTGTTGGATGGACGGACGG - Intronic
901863453 1:12089115-12089137 ACATTTGTTGGATGGATGGAGGG + Intronic
902613639 1:17611584-17611606 ATATTTGTTGGATGGGTGAATGG - Intronic
902777380 1:18683421-18683443 ATATTTGTTGCATGAATGAATGG - Intronic
903002077 1:20273718-20273740 ATATTGGGTGGATGGATGGATGG + Intergenic
905225375 1:36475348-36475370 AGAGTAGTTGGATGGCTGGAAGG + Intronic
906098791 1:43242434-43242456 TTATTAGATGAATGGTTGGTTGG + Intronic
906177543 1:43788076-43788098 GTATTACTTGCATTGTTTGAGGG - Intronic
906181494 1:43823757-43823779 ATATTTGTTGCATGGATAAATGG + Intronic
906230816 1:44162473-44162495 ATTTTATTTTCATGGTTGTATGG + Intergenic
906807865 1:48796851-48796873 ATATTTATCACATGGTTGGATGG - Intronic
906863312 1:49386242-49386264 ATATTTTTTGGATGGATGGATGG + Intronic
908425120 1:63999681-63999703 ATATTTGTTAGATGGATGGATGG + Intronic
909270723 1:73620016-73620038 AAATTGATTGCATAGTTGGAAGG + Intergenic
909601104 1:77462290-77462312 ATATTTGTTGGATAGATGGATGG + Intronic
912927298 1:113924730-113924752 AGATTAGATACATGGATGGATGG - Intergenic
913122894 1:115757919-115757941 ATGTTTGCTGGATGGTTGGATGG - Intronic
916857499 1:168765812-168765834 ATATTAGTTACATGAATGAATGG + Intergenic
917514460 1:175695931-175695953 ATAATTGTTGGATGGATGGAAGG + Intronic
918857346 1:189774951-189774973 ATATTTGTTGAATGGATGAAAGG + Intergenic
920615208 1:207485759-207485781 ATATTTGTTGAATGGATGAATGG - Intronic
921568900 1:216754897-216754919 ATATTTGTTGAATGAATGGATGG - Intronic
921689814 1:218135355-218135377 ATATTACTTTCATGCATGGAAGG + Intergenic
923429845 1:233909419-233909441 ATATTTGTTGAATGAATGGATGG + Intronic
924364072 1:243270896-243270918 TTATTAGTTGGAAGGATGGATGG + Intronic
1063651850 10:7945969-7945991 ATATTTGTTGAATGAATGGATGG + Intronic
1063794544 10:9497695-9497717 ATATCAGTTGTATGGATTGAAGG - Intergenic
1063892060 10:10640663-10640685 ATATTTGTTGGATGGATGGATGG + Intergenic
1065860790 10:29870892-29870914 ATAGTAGATGAATGGATGGATGG - Intergenic
1066210594 10:33233506-33233528 ATATTCATTTCATGGCTGGAAGG - Intronic
1068110611 10:52675820-52675842 ATATTTGTTACATGAATGGATGG - Intergenic
1068735618 10:60410454-60410476 ATATTTGTTGGAAGGATGGAGGG + Intronic
1068877054 10:62008203-62008225 ATATTGGTTACATGAATGGATGG + Intronic
1070362107 10:75700750-75700772 GTATTTGTTGGATGGATGGATGG + Intronic
1071964389 10:90837227-90837249 ATTTTAGTTGAATGAATGGATGG - Intronic
1073545409 10:104344303-104344325 ATATTTGTTGAATGAATGGATGG - Intergenic
1077748545 11:4936870-4936892 ATATTAACTGCATATTTGGATGG - Intronic
1078430258 11:11282744-11282766 ATATGTGTTGAATGGATGGAAGG - Intronic
1078487067 11:11733349-11733371 ATAGTTGTTGAATGGGTGGATGG + Intergenic
1079299247 11:19262882-19262904 ATGCTATTTGCATGGTTGGTTGG + Intergenic
1079341859 11:19618195-19618217 ATATTTGTTGCATGGATGGATGG + Intronic
1079758168 11:24292763-24292785 ATATCAATTGAATGGTTGGATGG - Intergenic
1081678978 11:44988624-44988646 ATGTTTGTTGGATGGATGGATGG + Intergenic
1084576529 11:69992183-69992205 ATAGTAGGTGAATGGATGGATGG + Intergenic
1085473581 11:76773699-76773721 ACATTTGTTGGATGGATGGATGG + Intergenic
1086522159 11:87681660-87681682 ATTTTTGTTGGATGGATGGATGG + Intergenic
1087895896 11:103585860-103585882 ATATGGGAAGCATGGTTGGAAGG + Intergenic
1089008417 11:115112750-115112772 ATATTTGTTGGATGGACGGATGG + Intergenic
1089290442 11:117434737-117434759 TGAGTAGTTACATGGTTGGATGG - Intronic
1092095998 12:5842312-5842334 ATATTCATTGGATGGTCGGAGGG + Intronic
1092755000 12:11755077-11755099 ATATTTATTGGATGGATGGATGG + Intronic
1092974232 12:13728718-13728740 AAATTAGATGGATGGATGGAAGG + Intronic
1093179479 12:15950917-15950939 ATATTAGTTGAATGAATGAATGG + Intronic
1097081812 12:56437223-56437245 ATATTTATTGCATGCTTGGCTGG - Intronic
1099370308 12:81820702-81820724 ATATTAGTTTCTTTTTTGGAGGG - Intergenic
1100675560 12:96863146-96863168 ATATTTGTTGGATGGATGGATGG + Intronic
1100925214 12:99537870-99537892 ATAGTAGTTTCATGGTTTGAGGG + Intronic
1101158952 12:101954333-101954355 ATATTTGTTGCATGGAGTGAGGG + Intronic
1101513450 12:105413023-105413045 ATGGTAGTTGCAGGGCTGGAAGG - Intergenic
1101667503 12:106832674-106832696 ATATTAGTTGGATGAAGGGATGG + Intronic
1101928084 12:108989863-108989885 TAACTAGTTGCATGGTTTGAGGG - Intronic
1102675283 12:114653871-114653893 ATAATTGTTGGATGGGTGGATGG + Intergenic
1102927686 12:116839290-116839312 ATATTGGATGGATGGATGGATGG + Intronic
1103043517 12:117715773-117715795 ATATTTGTTACATAGATGGATGG - Intronic
1103255946 12:119541394-119541416 TGCATAGTTGCATGGTTGGATGG + Intergenic
1104417137 12:128605012-128605034 ATAATAGATGAATGGATGGATGG + Intronic
1104796523 12:131523855-131523877 ATAGTAGTGCTATGGTTGGAAGG + Intergenic
1105798725 13:23884038-23884060 AAATCAGTTGTATGGGTGGAAGG + Intronic
1107616906 13:42179294-42179316 ATTTTAGTTGCATGATTGTAAGG - Intronic
1109694141 13:65930938-65930960 ATTTTAGTTGAATTGTTGCATGG + Intergenic
1111983057 13:95037378-95037400 ATATTGGATGAATGGATGGAAGG - Intronic
1112208141 13:97346238-97346260 ATAATAGATGGATGGATGGATGG + Intronic
1112445758 13:99463018-99463040 ACATTAATTGCATGGATGGATGG + Intergenic
1112846323 13:103647693-103647715 ATATTAGTTTCAGGATTGGAAGG + Intergenic
1113983699 13:114296866-114296888 ATATTTGTTGAATGGGTGGATGG + Intronic
1117332171 14:54723987-54724009 ATATTGGATGGATGGATGGATGG + Intronic
1117471109 14:56045953-56045975 ATGATACTTGCTTGGTTGGAAGG - Intergenic
1118851638 14:69588262-69588284 ATCTTTGTTGGATGGATGGATGG - Intergenic
1120334997 14:83143340-83143362 ATATTATTTGCATGATGGTAAGG - Intergenic
1122172101 14:99885147-99885169 CTATTTGTTGAATGGATGGAAGG + Intronic
1125398856 15:39278755-39278777 ATATCAGATGGATGGATGGATGG + Intergenic
1127210438 15:56769095-56769117 ATATTAGTTGCCTGTGAGGAGGG + Intronic
1127432501 15:58924279-58924301 ATATAACTTGCATGATTTGAGGG + Intronic
1128706882 15:69843087-69843109 ATATTTGCTGGATGGATGGATGG - Intergenic
1128755684 15:70182158-70182180 ATATTTGTTGGATGAGTGGATGG + Intergenic
1130030807 15:80311799-80311821 ATATTAGTGGCAAATTTGGAAGG + Intergenic
1131135412 15:89931029-89931051 AAATGAGTTCCATGGATGGATGG + Intergenic
1131328380 15:91470664-91470686 ATATTAGTTGCCTGGGGAGAGGG - Intergenic
1131383082 15:91980651-91980673 ATAATAGCTGCATGGTGTGAGGG - Intronic
1131419087 15:92288439-92288461 ACATTAATTGCATGTTTGAAGGG - Intergenic
1132075227 15:98814333-98814355 ATATGATTTGGATGGATGGATGG + Intronic
1133390033 16:5402830-5402852 ATATTGGATGGACGGTTGGAGGG - Intergenic
1133575482 16:7084990-7085012 ATATTAGTGGGATGCATGGATGG - Intronic
1134106990 16:11492329-11492351 ATATTTGTTGCATGGATGGATGG - Intronic
1134320356 16:13157172-13157194 ATCTTAGTGGGATGGATGGATGG - Intronic
1134637087 16:15800590-15800612 AAATGAGTTGGATGGATGGATGG + Intronic
1134642546 16:15840736-15840758 TTTTTAGTTGTTTGGTTGGATGG - Intronic
1135089225 16:19499621-19499643 ATATTTGTTGAATGAATGGATGG - Intergenic
1135727308 16:24866148-24866170 ATATTAATTGCATGGTAATATGG + Intronic
1136523853 16:30815062-30815084 ATTTTGGTTGGTTGGTTGGATGG + Intergenic
1137611330 16:49820011-49820033 ATATTTGTTGAATAGGTGGATGG + Intronic
1138697309 16:58826654-58826676 AAATTAGTTGGTTAGTTGGATGG + Intergenic
1138807714 16:60110383-60110405 ATAATAGTTGCATTCTTGAATGG - Intergenic
1139797836 16:69497545-69497567 ATCTGAGTAGCATGGGTGGAGGG + Intergenic
1140087853 16:71812386-71812408 ATTTTAGTTGCATGGAAGAAGGG - Intergenic
1140231872 16:73124042-73124064 GTATTAGTTGGTTGGTTGGTTGG - Intergenic
1140544637 16:75795266-75795288 ACATTAGATGGATGGATGGATGG - Intergenic
1140776538 16:78254251-78254273 AGATTGGTGGCAGGGTTGGAGGG + Intronic
1141121332 16:81360008-81360030 ATATATGTTGGATGGATGGATGG + Intronic
1141421503 16:83920872-83920894 ACATTAGATGGATGGATGGAAGG + Exonic
1143356657 17:6334757-6334779 ATATTTGTTGAATGGATGTAAGG + Intergenic
1143854768 17:9840447-9840469 ATATTAGTTGAATGAGTGAATGG - Intronic
1143913296 17:10269998-10270020 ATATTTGTGGCATGGATAGATGG + Intergenic
1144100690 17:11939797-11939819 ATGTTAGATACATGGATGGATGG + Intronic
1145078270 17:19873367-19873389 ATGTAAGGTACATGGTTGGATGG + Intergenic
1149375641 17:56041490-56041512 ATATTTCTTGAATGGATGGATGG - Intergenic
1149551832 17:57546322-57546344 ATACTAATTGATTGGTTGGAGGG + Intronic
1149854297 17:60066697-60066719 ATATTCGTTGAATGGATGGATGG - Intronic
1150851657 17:68709130-68709152 GTATTTGTTGGATGGATGGATGG + Intergenic
1151095383 17:71491510-71491532 ATACTAATTGTATGGTTTGAAGG + Intergenic
1152723842 17:81935734-81935756 AGATTGGTGGCATGGATGGAGGG - Intronic
1153481777 18:5554537-5554559 AAATTAGTTCCATGGTTGGAGGG - Intronic
1153944709 18:10008596-10008618 ATATTGGATGGATGGATGGATGG - Intergenic
1154010353 18:10568901-10568923 AGAATAGATGCATGGATGGATGG - Intergenic
1154952213 18:21221397-21221419 ATATTCATTGGATGGATGGATGG - Intergenic
1155647685 18:28100013-28100035 ATATTGGATGGATGGGTGGATGG - Intronic
1156477635 18:37416234-37416256 ATATTGGATGGATGGATGGATGG - Intronic
1157140895 18:45105127-45105149 ATGTTAAATGCATGGGTGGATGG - Intergenic
1158572134 18:58605432-58605454 ATATTTGTTGAAAGGATGGATGG - Intronic
1158800753 18:60905798-60905820 ATATTAGGTGAATGAATGGATGG - Intergenic
1164950467 19:32332441-32332463 ATATTTGTTGCATGAATGAATGG + Intergenic
1167169633 19:47822494-47822516 ATATGTGTTGCATAGATGGATGG + Intronic
1167646966 19:50711175-50711197 ATATCTGTTGGATGGATGGATGG + Intronic
925216757 2:2103196-2103218 ATATTTGTTTCATTGCTGGATGG - Intronic
927397933 2:22675845-22675867 ATATTATTGGCATGCATGGAAGG + Intergenic
930845879 2:55903415-55903437 ATATCAGTTTCTTGGTAGGAAGG + Intronic
930848405 2:55931390-55931412 ATGTGAGTTGGATGGATGGATGG - Intergenic
933296254 2:80494467-80494489 GTATTAGATGCATGGTGGGGGGG + Intronic
934018395 2:87916331-87916353 ATATTTGTTGAATGATTGAAAGG - Intergenic
934618997 2:95792694-95792716 GTATTGGTTGTATGGTTGGGCGG + Intergenic
934641894 2:96031863-96031885 GTATTGGTTGTATGGTTGGGCGG - Intronic
936955479 2:118017948-118017970 ATATTTGTTGGATGGATGGATGG - Intergenic
939449773 2:142358480-142358502 ATATTAGCTTCATGGTTTGAGGG - Intergenic
939839816 2:147173359-147173381 ATATTTGTTGAATGAGTGGATGG - Intergenic
939878930 2:147608115-147608137 AGATTAGATGGATGGATGGATGG + Intergenic
942244630 2:173995940-173995962 ACATTTGTTGAATGATTGGATGG - Intergenic
943505064 2:188744955-188744977 ATATTATCTTCATGTTTGGATGG - Intronic
943629634 2:190236655-190236677 ATATTAGTGCCATGTTTTGAAGG - Intronic
943931078 2:193854176-193854198 ATATAAGATGCCTGGTGGGAAGG - Intergenic
944969557 2:204976901-204976923 ATATCAGTTGCATGGCTAGGTGG - Intronic
945635742 2:212347984-212348006 ATATATGTTGGATGGATGGAGGG + Intronic
947154641 2:227149840-227149862 ATTTTAATTGGATGGATGGATGG + Intronic
1168848725 20:962036-962058 ATATTTGTTGGATGAGTGGATGG - Intronic
1168949098 20:1784412-1784434 ATGTTTGTTGGATGGATGGATGG + Intergenic
1169413091 20:5391437-5391459 TTATGAGTTGCGTGGTTGCAAGG - Intergenic
1170814741 20:19704136-19704158 ATATTTGTTGGATGGATGGATGG + Intronic
1172216510 20:33239453-33239475 ATATTAGTTGACTGGATTGATGG - Intronic
1172899042 20:38320816-38320838 TTATTTGTTGGATGGGTGGATGG + Intronic
1173084952 20:39907001-39907023 ATTTCAGTTGCATGGTGTGATGG + Intergenic
1173461681 20:43248097-43248119 ATAGTTGATGCATGGATGGAAGG + Intergenic
1173844720 20:46180718-46180740 AGATTTGTTGGATGGTTGGAAGG - Intronic
1173974847 20:47179374-47179396 ATATTGGGTGGATGGATGGATGG + Intronic
1173976596 20:47191471-47191493 ATAGTAGATGGATGGATGGATGG + Intergenic
1174305164 20:49609808-49609830 ATATTTGTTGAATGAATGGATGG - Intergenic
1174306774 20:49619047-49619069 ATATTGGATGGATGGATGGATGG + Intergenic
1175016019 20:55791527-55791549 ATATCTGTTGGATGGATGGATGG - Intergenic
1175325900 20:58128433-58128455 ACATTTGTTGGATGGATGGATGG + Intergenic
1176275099 20:64261037-64261059 AAATTAGTTTCAGGGATGGAAGG + Intronic
1177544708 21:22541424-22541446 ATATAAATTGCATGGTGTGAGGG - Intergenic
1179107961 21:38420557-38420579 ATATTAGCTGGATGGATGCAAGG - Intronic
1179318516 21:40268559-40268581 ATTTTAGTTGCTTGGTAGAAGGG + Intronic
1179549158 21:42132429-42132451 ATGATAGTTGAATGGATGGATGG - Intronic
1179899486 21:44381567-44381589 AGATTAGATGGATGGATGGATGG + Intronic
1181755991 22:25025339-25025361 CTGTGAGTTGCATGGTTGCAGGG + Intronic
1183078147 22:35439531-35439553 GTATTTGTTGGATGGATGGATGG - Intergenic
1183246854 22:36700504-36700526 ATTTTAGTTAGATGGATGGAGGG - Intronic
1184731110 22:46371667-46371689 ATATGAATAGGATGGTTGGAGGG - Intronic
949102789 3:165980-166002 ATATATGTTGGATGGATGGACGG + Intergenic
949220480 3:1627500-1627522 ATATTAGTTGCAGTGATGGTTGG - Intergenic
951143945 3:19203655-19203677 ATATTAGTGACATGGTAGTAGGG + Intronic
952858974 3:37796452-37796474 ACATTTGTTGGTTGGTTGGATGG + Intronic
953944640 3:47136022-47136044 CTATTAGTTGGATGGGTGGGAGG - Intronic
956586206 3:70867768-70867790 ATATTTGTTGAATGGGTGAATGG - Intergenic
958613661 3:96461123-96461145 CTATTAGTTTCATGGTTTTAGGG - Intergenic
958986811 3:100789859-100789881 AGATTAGATGGATGGATGGATGG - Intronic
961671087 3:128532036-128532058 ATATTAATTGCAAGTTTGGGGGG - Intergenic
961921489 3:130430941-130430963 ATATTTGTTGCATAAGTGGATGG + Intronic
962300458 3:134237430-134237452 ATATTAGATGCATGAATGGCTGG + Intronic
965283455 3:166783963-166783985 AAAATAGTTGCATAGTTGGTTGG + Intergenic
966415804 3:179688225-179688247 ATATTTGTTGGATGGATGGATGG - Intronic
967370256 3:188736666-188736688 ATATCAGATGGATGGATGGATGG + Intronic
967811436 3:193764465-193764487 ATATTTGTTGCATGGTCAAAAGG + Intergenic
967983388 3:195078581-195078603 ATATTAGTAGGAGGCTTGGAGGG - Intronic
968761888 4:2446751-2446773 ATACCAGTTGGATGGATGGATGG + Intronic
969368569 4:6715864-6715886 ATAGAAGATGCATGGTTGTATGG + Intergenic
969462901 4:7338154-7338176 ATGTTGGTTGGATGGATGGATGG + Intronic
969462910 4:7338199-7338221 ATGTTGGTTGGATGGATGGATGG + Intronic
969462942 4:7338347-7338369 ATGTCAGTTGGATGGATGGATGG + Intronic
970215240 4:13751947-13751969 AAAGTAGATGGATGGTTGGATGG - Intergenic
972261927 4:37417485-37417507 AAAATAGTTGCATCTTTGGAAGG + Intronic
972404718 4:38734722-38734744 ATACTTGTTGCATGGATGAATGG + Intergenic
974684104 4:65201782-65201804 ATATTTGTTGCATAGTAGGTGGG + Intergenic
975642707 4:76516324-76516346 ATATTACTTTCCTAGTTGGAAGG - Intronic
978122294 4:105094311-105094333 TTCTTAGTTGCAAGGTTGCAAGG - Intergenic
979436596 4:120700614-120700636 ATATTAGTTGCATTTTTTAATGG - Intronic
979680128 4:123450209-123450231 GTATTATTTGGATGGATGGATGG + Intergenic
984761135 4:183363938-183363960 ATATTAGTTGTATGAATGAATGG - Intergenic
985045480 4:185936306-185936328 ATATTTGTTGCAGGGATGGAGGG - Intronic
985951323 5:3223381-3223403 ATATTAGTTGAATGAATGAAAGG - Intergenic
988142152 5:27257036-27257058 ATTTTAATTGCATGGTCTGAAGG - Intergenic
990908173 5:60825605-60825627 ATATTTGTTGAATGAATGGATGG + Intronic
991339361 5:65590486-65590508 TTATTAGTTGAATTGTTGTAAGG - Exonic
991570738 5:68050802-68050824 ATATTAATTGGTTGGATGGAAGG + Intergenic
992481240 5:77154416-77154438 ATATTTGTTGCATGAATGAATGG + Intergenic
992671758 5:79068570-79068592 ATATTTGTTGAATGGATAGATGG + Intronic
993518425 5:88866240-88866262 AGATTATTTGCATGCTTGCATGG + Intronic
993821423 5:92621807-92621829 ATATCAGTGGCATGGTTGCATGG + Intergenic
993858862 5:93109425-93109447 TTATTAGTTGCATGGTTCTGAGG + Intergenic
994071356 5:95606458-95606480 ATATTAGAATCATGGCTGGAGGG - Intergenic
995438486 5:112163729-112163751 ATCTTAGTTGCTTGGCGGGAGGG + Exonic
997221644 5:132171820-132171842 ATATTAGTTGCCTGCTTTGTTGG - Intergenic
997675644 5:135710985-135711007 ATATAAGTTGGATGGTTACATGG + Intergenic
998569900 5:143247648-143247670 ATAGTAGGTGGATGGGTGGATGG + Intergenic
999631547 5:153576923-153576945 ATATTGGATGGATGGATGGATGG + Intronic
1001029232 5:168249925-168249947 ATATTTGTTGAATGGGTGAATGG - Intronic
1001272973 5:170329679-170329701 AGAGTAGATGGATGGTTGGATGG - Intergenic
1001531034 5:172461896-172461918 ATCTTTGTTGAATGGATGGATGG + Intergenic
1002596574 5:180327660-180327682 ATATTAGTTGCATGGTTGGATGG + Intronic
1002987452 6:2204399-2204421 ATATTAGTTGAATGAGTGAAAGG - Intronic
1003287751 6:4749434-4749456 ATATGAGATGGATGGATGGATGG + Intronic
1003363694 6:5452638-5452660 ATATTTATTGAATGTTTGGATGG + Intronic
1006196674 6:32247258-32247280 ATATAAGTTTCATGGTGGTAGGG - Intergenic
1008127709 6:47687673-47687695 ATCTTAGCTGCAAGGTTGGGTGG + Intronic
1009571828 6:65394928-65394950 ATATGGGTAGCATGGTTTGATGG - Intronic
1011335953 6:86259870-86259892 ATTTTTGTAGCAAGGTTGGATGG - Intergenic
1012012008 6:93800561-93800583 ATTTTAGATGGATGGATGGATGG - Intergenic
1012982010 6:105840828-105840850 ATTTTTGTTGGATGGATGGATGG + Intergenic
1013657801 6:112263670-112263692 ATATTTGTTGAATGAATGGATGG - Intergenic
1016792675 6:148082082-148082104 ATATTTGTTGGATGGATAGATGG + Intergenic
1018299197 6:162382218-162382240 ATATTATTTGCCTGGTTTTAAGG - Intronic
1018364379 6:163103008-163103030 ATATTTGCTGAATGGGTGGATGG + Intronic
1018913146 6:168115564-168115586 ATAATAGATGGATGGATGGATGG - Intergenic
1022362147 7:29671265-29671287 ATTTTAGTAGGATGTTTGGACGG - Intergenic
1023037161 7:36142103-36142125 AAATCTGTTCCATGGTTGGAAGG - Intergenic
1023185496 7:37528882-37528904 ATACTTGTTGCATGGGTGGGTGG - Intergenic
1023574909 7:41617405-41617427 ATATTTGTTGAATGGATGAATGG - Intergenic
1028293704 7:89100341-89100363 GTAGTAGTTTCATAGTTGGATGG - Intronic
1030070457 7:105693567-105693589 AAATTAGATGGATGGATGGATGG - Intronic
1031459192 7:122025061-122025083 ATATTTGTTGAATGATTAGATGG - Intronic
1031922496 7:127612304-127612326 ATATTGGATGGATGGGTGGATGG + Intronic
1032392090 7:131561839-131561861 ATCTGAGTGCCATGGTTGGAGGG + Intergenic
1034112286 7:148548592-148548614 TGATTAGTTGCATGAGTGGAGGG - Intergenic
1036505502 8:9351246-9351268 ATATTTATTGGATGGTTGGAGGG + Intergenic
1038182808 8:25244748-25244770 AAATTATCTGCATGGTTGCATGG + Intronic
1038505453 8:28080734-28080756 ATATTTGTTGAATGAATGGATGG - Intronic
1040956594 8:52986040-52986062 ATATTAGTAAGATGGCTGGATGG - Intergenic
1042964329 8:74334587-74334609 ATGGTAGATGCATGGATGGATGG - Intronic
1043787282 8:84419158-84419180 TTAATAGTAGCATGGCTGGAGGG - Intronic
1046544476 8:115631624-115631646 TTATTAGATGCATGGATGGATGG + Intronic
1047515769 8:125553499-125553521 ATAGTAGTGGGATTGTTGGATGG + Intergenic
1048234795 8:132679304-132679326 ATATTTGTTGAATGATTGAATGG + Intergenic
1048459607 8:134610694-134610716 ATATCAGTGGCAGAGTTGGAGGG + Intronic
1048989388 8:139752413-139752435 ATGTTAGATGGATGGATGGATGG - Intronic
1050565475 9:6877522-6877544 ATACAAGTTGCAGGGCTGGAAGG - Intronic
1051454200 9:17234800-17234822 ATATTAGTTGAAAGAATGGATGG + Intronic
1052984142 9:34473686-34473708 ATATTGGTTGGTTGGTTGGTTGG + Intronic
1055591318 9:77817379-77817401 ATATTTGTTGGTTGGTTGGAAGG + Intronic
1055661330 9:78506870-78506892 ATATTGGATGGATGGATGGATGG - Intergenic
1056103985 9:83328766-83328788 ATATTAGTGGTATGAATGGATGG + Intronic
1057852584 9:98576897-98576919 ATATTTGTTGGATGGATGGATGG + Intronic
1058596346 9:106619925-106619947 TTATTAGTTGCAATCTTGGAAGG + Intergenic
1059876202 9:118637811-118637833 ATATAATTTGCAGGGTTTGATGG + Intergenic
1060989015 9:127837802-127837824 ATATCTGTTGGATGGATGGATGG - Intronic
1062520707 9:136956720-136956742 ATAATGGTTGCGTGGGTGGATGG + Intronic
1062520747 9:136956917-136956939 ATATTGGGTGGATGGATGGATGG + Intronic
1185840508 X:3385292-3385314 ATAATAGATGAATGGGTGGATGG + Intergenic
1186518138 X:10182343-10182365 AGGTTGGCTGCATGGTTGGATGG + Intronic
1186736520 X:12470941-12470963 ATATTTGTTGCTTGGATAGATGG - Intronic
1188251797 X:27905074-27905096 ATATTTGTTGAGTGGATGGATGG + Intergenic
1192576474 X:72246990-72247012 ATAGTTGTTGGATGGATGGATGG + Intronic
1193202919 X:78713626-78713648 ACATTAGTTGAATGGTAGCATGG + Intergenic
1193475185 X:81955426-81955448 ACATTTGTTGAGTGGTTGGATGG + Intergenic
1193603362 X:83536098-83536120 ATATAAGTTGCACGGATAGATGG + Intergenic
1196650118 X:118159880-118159902 ATATTGGATGGATGGATGGATGG + Intergenic
1196802787 X:119558621-119558643 ATATTTGTTGCATGAATGGATGG + Intronic
1196812210 X:119637685-119637707 ATATTGATTGGATGGATGGATGG - Intronic
1197116481 X:122839644-122839666 ATATTTTTTGAATGGATGGAGGG - Intergenic
1198567523 X:137919845-137919867 ATATTTGTTGGATGGATGGATGG + Intergenic
1199126138 X:144122807-144122829 ATATTTGTTGAATGATTGAAAGG + Intergenic
1199851700 X:151728437-151728459 GTATTTGTTGGATGGATGGAAGG - Intergenic
1201241697 Y:11963214-11963236 ATATTAGATACATAGATGGATGG + Intergenic
1201946005 Y:19510825-19510847 GTAGTAGTTTCATGGTTTGAAGG - Intergenic