ID: 1002599601

View in Genome Browser
Species Human (GRCh38)
Location 5:180346657-180346679
Sequence GGCCCCAGGGGCGCACGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002599601 Original CRISPR GGCCCCAGGGGCGCACGCAC TGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900678951 1:3905597-3905619 GGCCCCAGGGGCGCAGGCATTGG - Intergenic
900779910 1:4611443-4611465 GGCCCCAGGGATCCATGCACAGG - Intergenic
901610584 1:10494803-10494825 GGCCCCAGCTGCCCACGCTCAGG - Intronic
903813228 1:26046260-26046282 GGCCCCATGGGCGCAGGCACAGG - Intergenic
906113085 1:43337712-43337734 GGCCCCAGAGGGGCAGGGACAGG + Intergenic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
912505190 1:110151104-110151126 GTCCCCAGCGGCGTACGCACGGG + Intronic
920660569 1:207911052-207911074 GTCCGCAGGGGCGCGCGCGCAGG - Exonic
921390543 1:214609099-214609121 GGCCCCAGGGCCGCACTCCATGG + Intronic
1063623661 10:7669859-7669881 GGCCCCCGGGGTTCACGGACAGG + Intergenic
1065010597 10:21417339-21417361 GGGCCCAGGGGCCCAGGGACAGG - Intergenic
1067055006 10:43045163-43045185 TGCCCCAGGGACACACGCAGAGG + Intergenic
1073381051 10:103078339-103078361 GGCCCCATGGGCCCAGGGACAGG - Exonic
1073542287 10:104323974-104323996 GCCCCCAGGGTACCACGCACGGG + Intronic
1073543403 10:104330014-104330036 GGCCCCAGGGGCTGACACAGAGG + Intronic
1075787644 10:125060967-125060989 GGCCCCAGGGGTGCACGCTAGGG + Intronic
1075801986 10:125159837-125159859 GCCCCCGGGCGCGCACCCACCGG + Intronic
1076612040 10:131732181-131732203 GGCCCCTGAGGCCCACTCACGGG - Intergenic
1084271952 11:68033659-68033681 GGCCTCAGGGGAGCAGCCACTGG - Intronic
1085773218 11:79342855-79342877 GGCGCCAGGGACGCAGGCAGGGG - Intronic
1089687999 11:120169196-120169218 GACCCGAGGGGCGCGCGGACTGG + Intronic
1094169886 12:27480367-27480389 GGCCCCTGGGTGGCATGCACAGG + Intronic
1095098744 12:38161229-38161251 GACCCCAAAGGCGCAGGCACAGG - Intergenic
1097020956 12:56020668-56020690 GGCCCCAGGGGCACAGGAAGGGG + Intronic
1097268327 12:57758703-57758725 GGCCCCAGGAACTCACGGACGGG + Exonic
1101612559 12:106304210-106304232 GGCCCCAGAGGGGGAAGCACAGG + Intronic
1104001554 12:124863716-124863738 GGCCCCAGGCGCGCAGACATGGG - Exonic
1104016358 12:124964929-124964951 GGCCCCAGAGAAGCAAGCACAGG - Exonic
1104755735 12:131268257-131268279 GCCCTCAGGGACGCACGCCCAGG - Intergenic
1104908758 12:132229528-132229550 GGCCCCAGGGCCACACTCGCAGG + Intronic
1105018730 12:132802397-132802419 GGGCACAGGGGTGCACGCCCAGG + Intronic
1113378642 13:109784852-109784874 CGGCTCAGGGGCGCGCGCACCGG + Exonic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118333403 14:64831736-64831758 TGCCCCAGTGGTGGACGCACAGG - Intronic
1122251476 14:100443021-100443043 GGCCCCAGGCGCTCGCACACAGG + Intronic
1122715442 14:103694157-103694179 GGCCCCAGGGCCACAGGCATGGG - Intergenic
1123997311 15:25727949-25727971 GGCCCCAGGGGCCAGAGCACAGG + Intronic
1126480315 15:49111261-49111283 GGCCCCAGGACAGCATGCACTGG - Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129710725 15:77819210-77819232 GGCCGCAGGGGCGCAGGCCGGGG - Intronic
1130510014 15:84581724-84581746 GGCCCCAGTGGGGCACACATGGG - Intergenic
1131257019 15:90869729-90869751 GGCCCCAGGGGAGCCCGCAGTGG - Intronic
1132149070 15:99447082-99447104 CGCCCCAGGCGCGCAGGCAGCGG - Intergenic
1132552768 16:560233-560255 GCCCCCTGGCGCGCACTCACCGG - Intergenic
1132849889 16:2020232-2020254 GGGCTCCGGGGCGCACGGACGGG - Exonic
1132954411 16:2583869-2583891 GGCCCCGGGGTCCCACGTACGGG + Intronic
1132959934 16:2616294-2616316 GGCCCCGGGGTCCCACGTACGGG - Intergenic
1133216183 16:4293885-4293907 GGCACCAGGGGCTCAAGCTCTGG - Intergenic
1137566861 16:49538663-49538685 GGCCCAAGGGCTGCACTCACAGG + Intronic
1137655026 16:50152706-50152728 GGACCCCGGGGCACACGCTCGGG + Intergenic
1139372609 16:66478207-66478229 GGCCCCAGGTGCACTCGCTCTGG + Intronic
1139465043 16:67149992-67150014 GTGCCCAGGGGCGCAGGCTCGGG - Exonic
1139595484 16:67955311-67955333 GGCCCCAGGGTGACAAGCACAGG + Intronic
1139719880 16:68843788-68843810 GGCCTAAGGGGCGCACGCTGCGG - Intronic
1140481647 16:75265675-75265697 GGCCCCGGGGGAGAGCGCACCGG - Intronic
1142010597 16:87711914-87711936 GGCCCAAGGGGGGCTGGCACAGG - Intronic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1142753078 17:1999919-1999941 GTCCCCAGGGGGGCAGGCAGTGG + Intronic
1143184120 17:5000350-5000372 GGCCCCGGGGACTCACTCACAGG - Exonic
1144991652 17:19237648-19237670 GGCGGCAGGGGCGCATGCCCTGG - Intronic
1147994526 17:44353665-44353687 GGCCCCCGGGGCGCGCACCCTGG + Exonic
1148241558 17:46002498-46002520 GGGCCCAGGGGCCCAAGCATGGG + Intronic
1148454918 17:47806069-47806091 GGCCCCAGGGGCGAGGGCAGCGG + Intergenic
1148680528 17:49470970-49470992 GGACCCAGGAGGGCAGGCACTGG - Intronic
1148848367 17:50541951-50541973 GAGCCCAGGGGCGCCCCCACAGG - Exonic
1151785423 17:76272695-76272717 GGGCCCAGGGGTGCCCGCCCGGG + Intergenic
1152208686 17:78991122-78991144 GGCGCCAGGGAGGCAGGCACTGG - Intergenic
1152759067 17:82098821-82098843 GGCGCCAGGGGTGTTCGCACCGG + Intergenic
1152809503 17:82374915-82374937 GGCCCCAGGCGGGCAGGCACAGG - Exonic
1153137323 18:1930658-1930680 GGCCCCAGGGCAGCACACTCTGG - Intergenic
1153688319 18:7567630-7567652 GGCTCCAGGGGCGCGGGCACAGG - Exonic
1155263800 18:24072223-24072245 GGGGCCAGGGGCACACACACAGG + Intronic
1158951462 18:62499267-62499289 GGGCCCAGAGGTGCACACACCGG + Intergenic
1160838010 19:1133484-1133506 GGCCCCAGTGGGGCTGGCACAGG - Intronic
1160858912 19:1229444-1229466 CGCCGCAAGGGCGCACGCGCGGG + Exonic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1162096394 19:8312296-8312318 CGCCCCAGGGGTGGAGGCACAGG + Intronic
1162445236 19:10718602-10718624 GGCCCCAGGGGCGGTGTCACGGG + Intronic
1163687032 19:18717548-18717570 GGCCCCAGTGCCCCACACACAGG - Intronic
1164577333 19:29413229-29413251 GGCCCCAGGGGCCCAGCCAAGGG + Intergenic
1166039106 19:40191567-40191589 GGCCCCTGGGGCGGCCGCCCCGG - Intergenic
1166802976 19:45469394-45469416 GGCCGCCGGGGCGCACGCCTTGG + Intronic
1166903589 19:46087042-46087064 GGCCCCAGGGTGGCATACACTGG + Intergenic
926218376 2:10919434-10919456 GCCCTCAGGGCCGCAGGCACAGG - Intergenic
926272085 2:11374556-11374578 GGCCCCAGGGGCGAGGGCAGGGG - Intergenic
927499916 2:23575790-23575812 GGCCCCAGCAGCTCACCCACCGG + Intronic
927648753 2:24898256-24898278 GGCCTCTGTGGCGCACGAACTGG - Intronic
930044290 2:47155321-47155343 GGTCCCAGGCGCGCGCGCTCGGG - Exonic
932704794 2:74015111-74015133 GGCCCAAGGGTCGCACCCAAGGG + Intronic
934846392 2:97663784-97663806 GCCCCCGGGGGCGCACGCGGCGG - Intronic
936072541 2:109380879-109380901 GGCCCCAGCAGGGCACGCACTGG + Intronic
936713844 2:115162202-115162224 GGGCCCCGGAGCGCACGCAGAGG - Intronic
940037956 2:149330177-149330199 GGCGCCAGGGGGTCGCGCACAGG + Intronic
945174107 2:207023995-207024017 GGCCCCAGGGGGCCACACTCAGG - Intergenic
1170226315 20:13995364-13995386 GGGCCCCAGGGCGCACGCGCAGG - Exonic
1171223517 20:23421477-23421499 GGCCGCAGGGACGCAGGCGCAGG + Exonic
1171473361 20:25389980-25390002 AGCCCGAGGGGCGCCCGCCCGGG + Intronic
1171823251 20:29874399-29874421 GACCCCGAGGGCGCAGGCACGGG + Intergenic
1171866129 20:30488516-30488538 GGTCCCAAAGGCGCACGCCCGGG + Intergenic
1173160139 20:40646481-40646503 GGCCCCAGGGGCTCAGGGCCAGG + Intergenic
1174611666 20:51802288-51802310 GGCCCCAGCGGCGCCCGCGGCGG - Exonic
1175545241 20:59773699-59773721 GTCCTGAGGGGCTCACGCACAGG - Intronic
1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG + Intronic
1181306060 22:21917976-21917998 AGCCCCAGGATAGCACGCACAGG - Intergenic
1183831472 22:40420483-40420505 GGGCCCAGGGGCGCCCGAGCTGG + Exonic
1184043480 22:41958041-41958063 GGCCCCAGGTGCGCTGGCAGTGG + Intergenic
1184079998 22:42212650-42212672 GGACCCAGGGGCTCACTCACTGG - Exonic
950012331 3:9732136-9732158 GGTCCCAGGCCCGCACTCACCGG - Exonic
950366461 3:12488663-12488685 GGCCCCAGAGGGACACGTACTGG + Intronic
953399473 3:42600559-42600581 GGCAGCGGGGGCGTACGCACGGG - Intronic
954025886 3:47782431-47782453 TGCCCCAGGGGCCCTTGCACTGG + Intergenic
954428079 3:50454132-50454154 GGCCACACAGGCGCACCCACAGG + Intronic
955425019 3:58778688-58778710 GGCCCCAGGGCAGCATACACTGG - Intronic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
962498531 3:135966118-135966140 TGCCCCAGGGGCGCCCGCGGAGG + Intronic
967818020 3:193815447-193815469 GGACCTAGGGGTGCACACACTGG + Intergenic
968208094 3:196822600-196822622 GGCCCAAGTGACCCACGCACTGG - Intronic
968583636 4:1406098-1406120 AGCGCAAGGGGCGCACGCAGCGG + Exonic
968584439 4:1409590-1409612 GGCCCCAGGTGGGCACTGACAGG + Intergenic
968739147 4:2318653-2318675 GGACCCAGGTGTGCACCCACAGG - Intronic
969084218 4:4643356-4643378 GGCCCCAGAGGCACAGACACTGG - Intergenic
969605442 4:8200041-8200063 GGCTCCTGGGGATCACGCACAGG - Intronic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
974987175 4:69042273-69042295 GAGCCCAGGGGCGCTCGCCCAGG + Intronic
977972432 4:103227764-103227786 GGCCTCAGGGGCTGACCCACAGG - Intergenic
979221837 4:118235429-118235451 GGCCCCAGGGGCTCATGGAGAGG - Intronic
985514619 5:335111-335133 TGCCCCAGGGTGGCACACACTGG + Intronic
985539074 5:479456-479478 GCCCACAGGTGCACACGCACAGG - Intronic
997606355 5:135178005-135178027 GGCCCCATGGGGACACACACAGG - Intronic
998253392 5:140567396-140567418 GGCCCCAGGGGCCCCCACCCTGG + Exonic
999248345 5:150167174-150167196 GGCCCAGGGGGCGCCGGCACCGG - Exonic
1002599601 5:180346657-180346679 GGCCCCAGGGGCGCACGCACTGG - Intronic
1003962778 6:11224465-11224487 TGCCCCAGGGGAGCATGCAAGGG + Intronic
1005798166 6:29390628-29390650 GGCCCCAGGGCAGCATACACTGG + Intronic
1006366329 6:33618250-33618272 AGCCACAGGAGCGCAGGCACAGG + Intergenic
1007419786 6:41712628-41712650 GGGCCCAAGGGCTCAAGCACTGG + Intronic
1013964159 6:115935369-115935391 GGCCCCAGTGGCGTAGGCACCGG - Exonic
1016825330 6:148382870-148382892 GCCCCCAGGGGCACACCCATAGG - Intronic
1019531308 7:1504713-1504735 GGCGGCCGGGGCGCAGGCACTGG + Intergenic
1019681942 7:2355239-2355261 GGCCCCAGGAGAGCAGGCTCGGG + Exonic
1019733581 7:2639917-2639939 AGCCCCAGGGGTGCAGCCACGGG - Intronic
1025069651 7:55887523-55887545 GGCCCCAGGAGCCCAGTCACCGG + Intronic
1026132473 7:67631781-67631803 GGAGCCAGGGGCTCTCGCACAGG - Intergenic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1026830465 7:73607212-73607234 GGCCCGAGGGGCGCAAGCTCGGG + Intronic
1029485653 7:100838398-100838420 GGCCCTAGTGGGGCACGCGCAGG + Intronic
1029537335 7:101164170-101164192 GGCGGCAGGGGCGCGCGCTCCGG + Exonic
1030184869 7:106751610-106751632 AGACTCAGGGGCGCATGCACAGG + Intergenic
1039608543 8:38901557-38901579 GGCGCGAGGGGCGCGCGCGCAGG + Intronic
1046277766 8:111985611-111985633 GGCCCCGGTGGCGTAGGCACCGG - Intergenic
1047961747 8:130016308-130016330 GGATCCAGGGGCGCGCGCGCGGG + Intronic
1048886778 8:138915263-138915285 GTGCCCAGAGGCGCACGCGCTGG - Intergenic
1049312885 8:141942795-141942817 GGGCTCAGGGACGCACGGACAGG + Intergenic
1049509252 8:143019285-143019307 GGCCCCAGGGGCGCCCCCCACGG + Intronic
1059434525 9:114267999-114268021 GGGCCCAGGGGAGCCCGCAGAGG + Intronic
1060096213 9:120793148-120793170 GGGCCCCGGGGCGCTCGCTCAGG - Exonic
1060979994 9:127786270-127786292 GGCCCTAGGGGTGCAGGCCCAGG - Intronic
1061955437 9:133959042-133959064 AGCCCCAGGGGCCCAGGCCCAGG + Intronic
1200690712 Y:6305059-6305081 GGCCCTCAGGGCGCATGCACTGG + Intergenic
1201044560 Y:9869657-9869679 GGCCCTCAGGGCGCATGCACTGG - Intergenic