ID: 1002599921

View in Genome Browser
Species Human (GRCh38)
Location 5:180348267-180348289
Sequence GCGTGTGCACGTGTGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 3, 1: 19, 2: 23, 3: 80, 4: 481}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002599914_1002599921 20 Left 1002599914 5:180348224-180348246 CCAGTTGAATGTCTGCCTCAATG 0: 1
1: 0
2: 1
3: 6
4: 141
Right 1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG 0: 3
1: 19
2: 23
3: 80
4: 481
1002599917_1002599921 5 Left 1002599917 5:180348239-180348261 CCTCAATGAGGGCTCGTGAAATT 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG 0: 3
1: 19
2: 23
3: 80
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002599921 Original CRISPR GCGTGTGCACGTGTGTGCCT GGG Intronic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900179995 1:1307134-1307156 ACGTGTGCACAAGTGTGCATCGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900358736 1:2277689-2277711 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358745 1:2277760-2277782 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358752 1:2277844-2277866 GTGTGTGCACGTATGTCCGTCGG - Intronic
900358952 1:2278806-2278828 CTGTGTGCACGTGTGCGCATGGG - Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900489176 1:2937957-2937979 GTGTGTGTACATGTGTGCATGGG - Intergenic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900544020 1:3218477-3218499 ACGTGTGCGTATGTGTGCCTTGG - Intronic
900560280 1:3301766-3301788 GTGTGTGCCCCTGTGTGCCTGGG - Intronic
900563694 1:3321663-3321685 GTGGGTGCACGTGTGTGTGTGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900593691 1:3470984-3471006 GCGTGGGCAGGGGTGTGCGTGGG + Intronic
900690661 1:3978419-3978441 GCCTGTGCCCGTGGGAGCCTTGG - Intergenic
900781755 1:4623218-4623240 GACTGTGCATGTGTGTCCCTCGG - Intergenic
900796262 1:4710446-4710468 GAGTGTGTACGTGTGTGACTGGG - Intronic
901205493 1:7492892-7492914 GTGTGTGCACGTGTGTATGTAGG - Intronic
901206038 1:7496463-7496485 GCGTGTGCACATGCGTGCCCAGG + Intronic
901316445 1:8312982-8313004 CAGTGTGCCCGTGTGTGCCCGGG + Intergenic
902291083 1:15435404-15435426 GTGTGTGCATGTGTGCGCGTGGG + Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903634746 1:24804372-24804394 GTGTGTGCATGTGTGTGGGTGGG + Intronic
904915486 1:33967450-33967472 GGGTGTGCACACTTGTGCCTGGG - Intronic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905300486 1:36983320-36983342 GCGTGTGGGAGTGTGTGCATGGG - Intronic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
905446794 1:38032864-38032886 GCCTCTGCATGTGTGTGCATGGG + Intergenic
905887475 1:41499183-41499205 CCGTGTGTCCGTGTGTGCATAGG + Intergenic
906693699 1:47810162-47810184 GCGCGCGCACGTGTGTGTGTTGG + Intronic
907325182 1:53633295-53633317 GCGTGTGAATGAGTGTGACTGGG + Intronic
907325216 1:53633525-53633547 GCGTGTGAATGTGTGTGACGGGG + Intronic
907481428 1:54748029-54748051 GTGTGTGCAAGTGGGGGCCTGGG - Intergenic
909047638 1:70729190-70729212 GTGTGTGCTTGTGTGGGCCTGGG - Intergenic
910437325 1:87218539-87218561 GTGTGTACACGTGTGTGCACGGG - Intergenic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
914914623 1:151811548-151811570 GCGCGTGCATGTGTGTGCCTTGG + Intronic
915558873 1:156675172-156675194 GTGTGTGCCTCTGTGTGCCTGGG + Intronic
915593553 1:156883911-156883933 GTGTTTGCACATGTGTGTCTAGG - Intergenic
916352810 1:163871066-163871088 GTGTGTGAATGTGTGTGCATAGG + Intergenic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
921069784 1:211649436-211649458 GGGTGTGCATGTGTGTCCTTGGG + Intergenic
921343987 1:214162895-214162917 GCGTGTGCATGTGTGTATCCTGG - Intergenic
922765839 1:228156371-228156393 GTGTATGCATGTGTGTGCATGGG + Intronic
922934076 1:229410398-229410420 ATGTGTGCCCCTGTGTGCCTGGG - Intergenic
923280137 1:232435964-232435986 GAATGTGCGTGTGTGTGCCTGGG + Intronic
923337395 1:232982350-232982372 GTGTGTGCACATCTGTGCCTCGG + Exonic
923402456 1:233628409-233628431 ACGTGTGCAGGTGTGTTACTTGG - Intronic
924224891 1:241913380-241913402 GTGTGTGCAAGTGTGTGTCTAGG + Intergenic
924464266 1:244285756-244285778 GTGAGTGCACATGTGTGTCTGGG - Intergenic
1062802835 10:392723-392745 GTGTGTGCGCGTGTGTACCTGGG - Intronic
1062854585 10:773631-773653 CAGTGTGCCTGTGTGTGCCTGGG + Intergenic
1062876712 10:948601-948623 GGGGGTGGACGTCTGTGCCTGGG - Intergenic
1064120673 10:12615438-12615460 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1064170629 10:13029047-13029069 GGGTGTGCAGGTGTGTAACTGGG + Intronic
1064847696 10:19673911-19673933 GCGTGTGCATGTATGTATCTGGG + Intronic
1065286145 10:24189474-24189496 GTGTGTGCACATGTGTGTTTGGG - Intronic
1066528955 10:36315317-36315339 GCGTGTGCGTGTGTGTGTGTTGG + Intergenic
1070676172 10:78413144-78413166 GCGCGTGCACATGTGTGTGTTGG + Intergenic
1070800721 10:79243159-79243181 GCGTGTGCCCGCGTGGGGCTGGG - Intronic
1071271057 10:84008091-84008113 GTGTGTGTATGTGTGTGTCTGGG - Intergenic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073070284 10:100788895-100788917 GGGTGTGCATGTGTGTGTGTCGG - Intronic
1074004247 10:109403620-109403642 GTGTGTGCATGTGTGTATCTAGG - Intergenic
1074267587 10:111920225-111920247 GTGTGTGCATGTGTGTGGATGGG - Intergenic
1074869095 10:117563102-117563124 GGGTGTGCATGTGTGTCCGTGGG + Intergenic
1074869110 10:117563212-117563234 GGGTGTGCATGTGTGTCTCTGGG + Intergenic
1074869137 10:117563422-117563444 GGGTGTGCATGTGTGTTCGTGGG + Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075654889 10:124154709-124154731 GAGTGTGCATGTGTGTGAGTGGG - Intergenic
1075654946 10:124155138-124155160 GAGTGTGCATGTGTGAGCATGGG - Intergenic
1075801691 10:125158908-125158930 GTGTGCGCGCGTGTGTGTCTCGG + Intronic
1076578643 10:131491474-131491496 GGGAGGCCACGTGTGTGCCTGGG + Intergenic
1076612091 10:131732560-131732582 GCATGTGTGTGTGTGTGCCTGGG - Intergenic
1076693121 10:132233774-132233796 GCGGGAGCGCGTGTGGGCCTGGG - Intronic
1076759752 10:132597097-132597119 GTGTTTGCATGTGTGTGCATGGG + Intronic
1076857121 10:133122816-133122838 GCCTGGGGACGCGTGTGCCTGGG - Intronic
1076857125 10:133122832-133122854 GCCTGGGGACGCGTGTGCCTGGG - Intronic
1076857129 10:133122848-133122870 GCCTGGGGACGCGTGTGCCTGGG - Intronic
1076874497 10:133209198-133209220 GCGTGTACACGTGTGTGGTTGGG + Intronic
1076906293 10:133363321-133363343 CTGTGTGCACGTGTGTCCCCAGG + Intronic
1077144588 11:1039249-1039271 GTGTGTGCATGTGTGTGTATAGG + Intergenic
1077227240 11:1443692-1443714 GCGTGTGCCTGTGTGTGCACAGG + Intronic
1077305580 11:1867350-1867372 GTGTGTGCATGTGTGTGTGTGGG - Intronic
1077425059 11:2471594-2471616 GCGTGTGCACCTGTGTATATGGG + Intronic
1078589635 11:12628202-12628224 GCGCGCGCACGTGTGAGCATGGG - Intergenic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1079788189 11:24702009-24702031 GAGTGTGCACGAGTCTGACTGGG - Intronic
1080641446 11:34160771-34160793 GCGTGTGAGTGTGTGTGCGTTGG + Intronic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1081644442 11:44779830-44779852 ATGTGTGCATGTGTGTGCATAGG - Intronic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081837305 11:46166471-46166493 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1081994729 11:47355888-47355910 GTGTGAGCACGTGTGTGAGTGGG - Intronic
1081994783 11:47356423-47356445 GTGTGTGCATGTGTGTGAGTGGG - Intronic
1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG + Intronic
1082160342 11:48882766-48882788 GCTTCTGCAGCTGTGTGCCTGGG + Intergenic
1082162024 11:48897640-48897662 GCTTCTGCAGCTGTGTGCCTGGG - Intergenic
1082969793 11:59007794-59007816 GTGTGTGCACGTGTGTCCCCAGG + Intronic
1083743018 11:64721147-64721169 GCCTGTGTAGGTGTGTGTCTGGG + Intronic
1084009944 11:66342029-66342051 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1084437345 11:69151624-69151646 GAGTGGGCAGGAGTGTGCCTTGG - Intergenic
1084523479 11:69680849-69680871 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1084523480 11:69680903-69680925 GTGTGTGCATGTGTGTGGGTCGG - Intergenic
1084661504 11:70549122-70549144 CCGTGTGCACAGCTGTGCCTGGG - Intronic
1085972540 11:81611120-81611142 GTGTGTGCATGTGTGTGTGTAGG + Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089626223 11:119752783-119752805 GTGTGTGCATGTGTATGCCTGGG - Intergenic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090401338 11:126450317-126450339 ACGTGTGCATGTGTGAGCGTGGG + Intronic
1091770970 12:3151176-3151198 GTGTGTGCATGTGTGTGAGTGGG + Intronic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1093159694 12:15731851-15731873 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1094479153 12:30866845-30866867 GTGTGTGCACATGTGTGATTTGG - Intergenic
1095293201 12:40499805-40499827 GCATGTGTATGTGTGTGCATGGG + Intronic
1096476283 12:51911122-51911144 GCATGTGCAGGTGTGTGTCTGGG - Intronic
1096870035 12:54587509-54587531 GTGTGAGCAAGTGTATGCCTCGG - Intronic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1098890680 12:76007622-76007644 GTGTGTGCATATGTGTGTCTTGG - Intergenic
1099043463 12:77685458-77685480 GTGTGTGCATGTGTATGCGTTGG - Intergenic
1100743662 12:97622494-97622516 GTGTGTGCATTTGTGTGTCTGGG - Intergenic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102902031 12:116646422-116646444 GTGTGTGCACGTGTATGTGTGGG - Intergenic
1103197907 12:119061317-119061339 GCGTGTGCACTTGGGTGTGTTGG + Intronic
1103553543 12:121752229-121752251 GGGTGTGGCCGTGTGTGCCTGGG + Intronic
1103730596 12:123025229-123025251 GCATGTGCATCTGTGTGCCTAGG - Intronic
1103971725 12:124676776-124676798 GTGTGTGTATGTGTGTGCCTGGG + Intergenic
1104112955 12:125721228-125721250 CTGTGTGTACGTGTGTGCATAGG + Intergenic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104944942 12:132411378-132411400 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104944969 12:132411589-132411611 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1105014763 12:132779726-132779748 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105014807 12:132779996-132780018 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105730617 13:23211831-23211853 GTGACTGTACGTGTGTGCCTGGG - Intronic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106488599 13:30194873-30194895 GCGGGTCCACGTGTGTACCCTGG - Intergenic
1106902602 13:34369698-34369720 GCATGAGCACGTGCGTGCATGGG + Intergenic
1107279455 13:38716825-38716847 GCCTGTGCACATGTGTGTTTTGG - Intronic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1108012845 13:46038200-46038222 GCTTGTGAAGCTGTGTGCCTAGG - Intronic
1109192665 13:59344290-59344312 GTGTGTGCATGTGTATGCTTTGG - Intergenic
1109699439 13:66006590-66006612 GCTTTTGCACCTGTGTTCCTAGG - Intergenic
1110408615 13:75179109-75179131 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112491765 13:99872172-99872194 GAGTGTGCCCATGTGTGCATGGG - Intronic
1112877785 13:104066692-104066714 GCATGTGCACGGGTGCGCTTAGG - Intergenic
1113327138 13:109293268-109293290 GCGTGTGTAGGTGTGTGTATAGG - Intergenic
1113465594 13:110510573-110510595 ACTTATGCACGTGTGTGCATAGG + Intronic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113752568 13:112786478-112786500 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113752585 13:112786601-112786623 GCCCGTCCACGCGTGTGCCTGGG - Intronic
1113893854 13:113751273-113751295 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1113893857 13:113751314-113751336 GTGAGTGCATGTGTGTGCATGGG + Intergenic
1116521672 14:45855699-45855721 GTGTGTGTACGTATGTGTCTAGG - Intergenic
1116768798 14:49103270-49103292 GTATGTGCAAATGTGTGCCTTGG - Intergenic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1119282378 14:73420463-73420485 GTGTGTGCATGTGTGTGTATAGG + Intronic
1120837757 14:89056624-89056646 CCTTGGGCACTTGTGTGCCTGGG + Intergenic
1121270806 14:92636927-92636949 GTGTGTGTGCGTGTGTGCTTGGG + Intronic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122792401 14:104189768-104189790 GTGTGTACATGTGTGTCCCTAGG - Intergenic
1123126817 14:105952743-105952765 GCGTTTACAGGTGTGTGCCAAGG + Intergenic
1123984325 15:25631606-25631628 GCATGTGCAGGTATGTGCGTGGG + Intergenic
1124200184 15:27672731-27672753 GCATGTGCATGTGTGTGTATGGG - Intergenic
1124200186 15:27672757-27672779 GCATGTGCATGTGTGTGTGTGGG - Intergenic
1124631686 15:31341350-31341372 GTGTGTGTACGTGTGTGTGTCGG + Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1126110680 15:45172966-45172988 GCACGTGCGCATGTGTGCCTGGG - Intronic
1129521176 15:76187226-76187248 ACGTCTGCACATGTGGGCCTGGG + Intronic
1130995955 15:88904338-88904360 ACGTGTGCATGTGTGTGGGTGGG - Intronic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132576242 16:665738-665760 GAGTGTGCGGGTGTGGGCCTTGG + Exonic
1132649267 16:1013119-1013141 GCGTGTGCGCATGTGTGTCCTGG - Intergenic
1132649751 16:1015096-1015118 GTGTGTGCGTGTGTGTGTCTGGG - Intergenic
1133216788 16:4297411-4297433 GTGTTTGCATGTGTGTGCGTGGG - Intergenic
1133222196 16:4323562-4323584 GAGTGTGCGTGTGTGTGCCGGGG + Intronic
1133925910 16:10192340-10192362 GGGTGTGCTCGTGTGTGTCTGGG + Intergenic
1134004240 16:10807223-10807245 GTGTGTGCATGTCTGTGCGTGGG + Intronic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1134782367 16:16909830-16909852 GTGTGTGCGCGTGTGTGGCTGGG + Intergenic
1134853263 16:17499219-17499241 GCATGTGCACATGTGTGTATCGG - Intergenic
1136537891 16:30911046-30911068 CTGTGTGCACGCGTGTGTCTGGG - Intergenic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137592326 16:49701248-49701270 GCATGCGCACGTGTGTGTGTAGG + Intronic
1137788570 16:51155519-51155541 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1137793570 16:51195914-51195936 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1138522376 16:57578224-57578246 GTGTGTGCATGTGTGTGTATGGG + Intronic
1138708858 16:58946180-58946202 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1139719731 16:68842909-68842931 GCGTGTGTACGTCTGTACTTAGG + Intergenic
1139831203 16:69799720-69799742 ATGTGTGCACGTGTGTGTCTGGG + Intronic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1141395356 16:83699612-83699634 GTGTGTGCATATGTGTGCCAAGG - Intronic
1141481541 16:84309835-84309857 GCGTGTGTACATGTGTGTGTGGG + Intronic
1141928971 16:87188132-87188154 GTGTGTGTACATGTGTGCGTGGG + Intronic
1142003798 16:87679669-87679691 GTGTGTGCACGTGTGGGTCTGGG + Intronic
1142257735 16:89023427-89023449 GTGTGTGTATGTGTGTGACTGGG - Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142627600 17:1202490-1202512 GAGTGGGCACGTGTGTGTTTGGG - Intronic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1142975601 17:3642067-3642089 GTGTGTGTGTGTGTGTGCCTGGG + Intronic
1143167404 17:4903789-4903811 ATGTGTGCACGTGTGTGTTTAGG - Intergenic
1143390896 17:6558629-6558651 GTGTGTGCTTGTGTGTGCTTAGG + Intergenic
1143483021 17:7238199-7238221 GCGTGTGCCTGTGTGTGTCTGGG - Intronic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1146913303 17:36661741-36661763 GCAGGTGCATGTGTGTGTCTGGG - Intergenic
1146913322 17:36662017-36662039 GCATGTGCATGTGTGTGTCTGGG - Intergenic
1146928383 17:36760852-36760874 GTGTGTGCATGTGTGTGGATGGG + Intergenic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147686138 17:42287990-42288012 GTGTGTGCGCATGTGTGTCTTGG - Intronic
1147985946 17:44308093-44308115 GCATCTGCATGTCTGTGCCTGGG - Intergenic
1148210154 17:45803790-45803812 GTGTGTGCATGTGTGTGTGTTGG + Intronic
1148791947 17:50178205-50178227 GCCTCTGGACGTGTGTGCCCAGG - Intergenic
1150540178 17:66088815-66088837 GAGTGTGCAGGGGTGGGCCTGGG - Intronic
1151212306 17:72553775-72553797 GTGTGTGTGCGTGTGTGCCCAGG - Intergenic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151512394 17:74569254-74569276 GTGTGTGCATGTGTGGGCGTGGG + Intergenic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1151975671 17:77482481-77482503 GCGTGTGCATGCATGCGCCTGGG + Intronic
1151979382 17:77499560-77499582 GCGGGGGCACGTGTGGGCCGTGG + Exonic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191881 17:78893081-78893103 GCGTGTGCAGGGGTGTGTGTGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152306012 17:79520514-79520536 GTGTGGGAACGTGTGTGTCTGGG - Intergenic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152575437 17:81138366-81138388 ACGTGTGCCCGTGTGTCCATGGG - Intronic
1152582009 17:81169978-81170000 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1152733475 17:81985057-81985079 GTGTGTACAGGTGTGTGCGTGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737865 17:82006158-82006180 GTGGGTGCACGTGTGTGCACGGG + Intronic
1152737880 17:82006277-82006299 GCGGGTGCACGTGCGTGTTTGGG + Intronic
1152859900 17:82690313-82690335 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859919 17:82690472-82690494 GAGTGTGCACGTGTGTTGCCGGG + Intronic
1152859929 17:82690552-82690574 GAGTGTGCACGTGTGTTGCCGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859941 17:82690632-82690654 GAGTGTGCACATGTGTTCCCGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859953 17:82690711-82690733 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859964 17:82690790-82690812 AAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154227451 18:12519329-12519351 GTGTGTGCACATGTGTGTATAGG - Intronic
1154405550 18:14086658-14086680 GGGTTTGCACGTTTCTGCCTGGG - Intronic
1155360896 18:25000986-25001008 GTGTGTGCACGTGTGTATTTAGG + Intergenic
1155618736 18:27751310-27751332 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157732054 18:50012561-50012583 GCTTGTGCATCTGTGTACCTCGG - Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158861112 18:61593332-61593354 GTGTGTGCATGTGTGTGACAGGG - Intergenic
1160662768 19:308730-308752 GGGTGGGCACGTGGGCGCCTGGG - Intronic
1161086270 19:2337018-2337040 GTGTGTGTGCGTGTGTGTCTTGG + Intronic
1161322777 19:3648967-3648989 GTGTGTGCATGTGTGTGTCCAGG - Intronic
1161375231 19:3936541-3936563 GCGTGTGCATGAGACTGCCTGGG - Intronic
1161933885 19:7359111-7359133 GGGTGTGCATGTGTGTGACAGGG + Intronic
1162015320 19:7843328-7843350 GAGTGTGCATGTGTGTGTATAGG + Intronic
1162015345 19:7843646-7843668 GTGTGTGCATGTGTGTGTATAGG + Intronic
1162057333 19:8072376-8072398 GGGTGTGCATGTGTGTCCCTTGG + Intronic
1163369253 19:16892888-16892910 GTGTGTGCATGTGTGTGTCCCGG - Intergenic
1163502462 19:17684813-17684835 GAGTCTGCACATGTGTGTCTAGG + Intronic
1164519482 19:28967634-28967656 GAGTGTGCATGTGTGTGGGTGGG + Intergenic
1164521720 19:28984787-28984809 GCGTGTGCAGGTTTGTGACCTGG - Intergenic
1164707885 19:30333714-30333736 GCTGGTGCACGGGTGTTCCTAGG - Intronic
1165153743 19:33775310-33775332 GCGTCTGCATGTGTGTGTCGGGG + Intergenic
1165305746 19:35001519-35001541 GTGTGTGTACAAGTGTGCCTGGG + Intronic
1166521373 19:43482399-43482421 ACGTGAGCAAGTGTGTCCCTGGG - Intronic
1167513683 19:49910400-49910422 GAGAGTGCAGGTGTGGGCCTGGG - Intronic
924991855 2:319291-319313 GTGTGGGCACGTGTGTGCCTGGG + Intergenic
925126629 2:1461699-1461721 CTGTGTGCACGTGTGTGTATGGG - Intronic
925126633 2:1461756-1461778 GTGTGTGCAGGTGTGTGTGTGGG - Intronic
925461881 2:4070312-4070334 GAGTGTGCACATTTGTGCTTGGG + Intergenic
925542930 2:4985569-4985591 GCGTGCTCACGTGTGTGTTTTGG - Intergenic
927277780 2:21276259-21276281 ACGTGTGAACGTGGGTGCCCAGG - Intergenic
927477424 2:23424278-23424300 ACGTGTGCATGTGTGTGCGTGGG + Intronic
927495361 2:23548266-23548288 GTGTGTGCGCCTGTGTGTCTGGG - Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927711629 2:25329779-25329801 GTGTGTGAACCTGTGCGCCTGGG - Intronic
928171307 2:29005288-29005310 GTGTGTGCATGTGTGTGTGTGGG + Intronic
928592058 2:32827386-32827408 GAGTGTGCACATGTGTACTTGGG - Intergenic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929360185 2:41078797-41078819 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929783956 2:44975843-44975865 GTGTGTGCGTGTGTGTGCGTAGG - Intergenic
929825939 2:45309823-45309845 GCATGTACACATGTGTGCATGGG + Intergenic
931235819 2:60411917-60411939 GAGTGTGCATGTGTATGTCTGGG + Intergenic
931960474 2:67476941-67476963 GTGTGTGCGCCTGTGTGCCTGGG + Intergenic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
932825987 2:74940639-74940661 GCATGCGCACGTGTGTGTATGGG - Intergenic
933947730 2:87301358-87301380 GCGCATGCATGTGTGTGTCTTGG + Intergenic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934971824 2:98770318-98770340 GCGTGGGCATGTGTGAGGCTGGG - Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
936332473 2:111560215-111560237 GCGCATGCATGTGTGTGTCTTGG - Intergenic
937216174 2:120315042-120315064 GTGTGTGGACGAGTGTGCCGGGG - Intergenic
937292782 2:120791615-120791637 GTATGTGCATGTGTTTGCCTGGG + Intronic
937359561 2:121219350-121219372 GCGTGTTTACATGTGTACCTGGG - Exonic
937512225 2:122608954-122608976 GTGTGTGCATGTGTGTGTGTAGG - Intergenic
938400330 2:130986177-130986199 GCACGTGCATGTGTGTGCATAGG + Intronic
940567299 2:155383257-155383279 ATGTGTGCACTTGTGTGCGTAGG - Intergenic
941977094 2:171417455-171417477 GTGTGTGCATGTGTATGACTTGG - Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
943876227 2:193071308-193071330 GAGTTTGCACCAGTGTGCCTGGG + Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
946400481 2:219465879-219465901 GCGTGTGCATGTGTGCGTATGGG + Intronic
946449459 2:219767355-219767377 GTGTGTGCATGTGTGTGGGTGGG + Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
948183680 2:236002417-236002439 GCATGTGCACATGTGTGAGTAGG + Intronic
948569104 2:238906237-238906259 GTGTGTGCATCTGTGTGCGTGGG - Intronic
1168803928 20:662062-662084 GCGCGTGGAGGTGTGTGCTTCGG + Exonic
1169000130 20:2162584-2162606 GCGCGTGCACGTGTGTCAGTTGG + Intronic
1169258108 20:4114273-4114295 GTGTTTGCACGTGTGAGCCTGGG + Intergenic
1169520641 20:6369077-6369099 GTGTGTGTACGTATGTGTCTAGG - Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1171295594 20:24014211-24014233 GTGTGTGCAGGTGTCTGCGTTGG + Intergenic
1173292784 20:41729140-41729162 CCGTCTGCTCGTGTGTTCCTAGG + Intergenic
1173585918 20:44183010-44183032 GCGTGTGTATGTGTGTGTTTTGG - Intronic
1173658163 20:44715293-44715315 GCGTGTGCCTGTGTGTGCCTGGG + Intronic
1173742037 20:45407906-45407928 GCGTGTGTACGTGTTTGTGTGGG + Intronic
1173838313 20:46139817-46139839 GTGTGTGTATGTGTGTCCCTCGG + Intergenic
1173963896 20:47097084-47097106 GCGTGTGTTCGTGTGGGACTTGG + Exonic
1174412283 20:50343851-50343873 GTGTGTGCATGTGTGTGGCTGGG + Intergenic
1174541804 20:51295777-51295799 GCGTGTGCGTGTGTGTGTCAAGG - Intergenic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175219967 20:57411316-57411338 GTGTGTGCACATGTGTGTCTGGG - Intergenic
1175314938 20:58040545-58040567 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1175793859 20:61758953-61758975 GAGTGTGCACATGTGCGCATGGG + Intronic
1175850413 20:62087789-62087811 GCGTGTGCAGGTGAGTGTATAGG - Intergenic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1176064024 20:63185005-63185027 GCGTGTGTGCGTGCATGCCTGGG + Intergenic
1176110661 20:63409313-63409335 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1176207624 20:63898200-63898222 AGGTGCTCACGTGTGTGCCTGGG + Intronic
1176302790 21:5106685-5106707 GCGTGTGCAGGTGTGCACATAGG - Intergenic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1176974267 21:15301075-15301097 GCATGAGCAAGTGTGAGCCTGGG + Intergenic
1178200681 21:30400490-30400512 GCATGTTCACGTGTGTTCCCAGG - Intronic
1178514162 21:33231602-33231624 GAGTGTGCAAGTGTGAGCCATGG - Intronic
1178589261 21:33895457-33895479 ACGTGTGCGTGTGTGTGCATGGG + Exonic
1178844728 21:36165424-36165446 GTGTGTGCATGTGTGTGTATGGG + Intronic
1179144883 21:38759250-38759272 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1179153926 21:38833076-38833098 GTGTGTGCATGTGTGTTCTTGGG - Intergenic
1179707932 21:43193140-43193162 GCGTGTGTGTGTGTGTGTCTGGG - Intergenic
1179707945 21:43193384-43193406 GCGTGTGTGTGTGTGTGTCTGGG - Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1179854234 21:44155238-44155260 GCGTGTGCAGGTGTGCACATAGG + Intergenic
1180172829 21:46068916-46068938 GTGTGTGTGCATGTGTGCCTGGG + Intergenic
1180172857 21:46069258-46069280 GTGTGTGCGCATGTGTGTCTGGG + Intergenic
1180172863 21:46069370-46069392 GTGTGTGAGCATGTGTGCCTGGG + Intergenic
1180172871 21:46069500-46069522 GTGTGTGTGCATGTGTGCCTGGG + Intergenic
1180195871 21:46193966-46193988 GCATGCGTACGTGTGTGCATAGG + Intronic
1180885846 22:19242697-19242719 GGGTGTGCGTGTGTGTGGCTGGG - Intronic
1182012647 22:27013310-27013332 GTGTGTGCACGAGTGTGACAGGG + Intergenic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1183694029 22:39409464-39409486 ATGTGTGCACGTATGTGCCTGGG - Intronic
1183730950 22:39618097-39618119 CTGTGTGCAGGTGTGTGACTGGG + Intronic
1184250135 22:43255419-43255441 GTGTGTGCACATGTGTGTCTCGG - Intronic
1184856761 22:47150568-47150590 GCCTCTGCACCTGGGTGCCTGGG + Intronic
1184923094 22:47619603-47619625 GCGTGTGTGTGTGTGTTCCTGGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185285604 22:49998446-49998468 GGCTGTGCACGTGTGTGCATGGG + Intronic
1185299251 22:50070968-50070990 GTGTGTGCAAGAGTGTGCCCTGG - Intronic
950425856 3:12924417-12924439 GCATCTGCATGTGTGTGTCTAGG + Intronic
950678861 3:14571206-14571228 GTGTGTGTCTGTGTGTGCCTGGG + Intergenic
951649753 3:24938029-24938051 GTGTGTGCGCATGTGTGCATAGG - Intergenic
952384433 3:32829654-32829676 GTGTGTGCGTGTGTGTGCATTGG + Intronic
953173792 3:40530873-40530895 GTGTATGCATGTGTGTGCGTAGG - Intronic
953541680 3:43824700-43824722 GTGTGTGCACAGGTGTGCTTAGG + Intergenic
953847016 3:46435766-46435788 GCACGTGCATGTATGTGCCTGGG - Exonic
953881621 3:46693952-46693974 GAGTGTGCGCGTGGGTGCGTAGG - Intergenic
954137427 3:48588461-48588483 GCGTGTGCCAGGGTGGGCCTGGG - Intronic
956456512 3:69426336-69426358 GTGTGTGCATGTGTGTGTGTTGG + Intronic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
959959195 3:112277006-112277028 GTGTGTGCAAATGTGTGCATGGG + Intronic
962385328 3:134928147-134928169 GAGAATGCACGTGTGTGCGTGGG - Intronic
965892878 3:173536765-173536787 GCGTGTGTGTGTGTGTGCGTAGG + Intronic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
968490415 4:887980-888002 GCGTCTGCACATGTGAGCGTGGG - Intronic
968493210 4:901458-901480 GCGTCTGCTCGTGGGTGCCTAGG - Intronic
968522725 4:1041331-1041353 GTGTGTGCATGTGTGTGTGTCGG + Intergenic
968618925 4:1594969-1594991 GCCTGTGCACGGCTTTGCCTGGG - Intergenic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969373139 4:6746819-6746841 GTGTGTGCACCTGTCGGCCTGGG + Intergenic
969584031 4:8081599-8081621 GCATGTGCATCTGTGTGCATAGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970050875 4:11913543-11913565 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974714116 4:65644221-65644243 GAGTGTGTATGTGTGTGCATGGG - Intronic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
974889196 4:67858669-67858691 GGGTGTGCAGGTGTGTACATGGG - Intronic
975973896 4:80073224-80073246 GCGTGTGTCAGTGTGCGCCTGGG + Intronic
976349945 4:84049829-84049851 GCGTGTGTATGTGTGTGTGTGGG + Intergenic
977713055 4:100149359-100149381 GAGTGTGCATGTTTGTGCATAGG + Intergenic
978620165 4:110629490-110629512 GCGTGTGAAGGTGTGTGTCGCGG + Intronic
978967383 4:114757301-114757323 ACGTGTGCATGTCTGTGCCTTGG + Intergenic
980113320 4:128655211-128655233 GCTTGGGCACGTGAGTGACTAGG + Intergenic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
983937518 4:173512475-173512497 GCGTGTGCACTTGAGTGCCAGGG - Intergenic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985509108 5:302092-302114 GTGTGTGTGTGTGTGTGCCTTGG + Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985581367 5:697004-697026 GCGTGTGCCTGTGTGTGCATGGG + Intergenic
985595996 5:788330-788352 GCATGTGCCTGTGTGTGCATGGG + Intergenic
985656896 5:1136984-1137006 GTGTGTGCACATGTGTGTCCTGG - Intergenic
985748446 5:1660860-1660882 GTGTGTGTACGTGTGAGGCTGGG + Intergenic
985994140 5:3587288-3587310 TCCTGTCCACCTGTGTGCCTTGG - Intergenic
986126124 5:4883748-4883770 GCGTGTACAAGGGTGTTCCTGGG + Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
987576983 5:19742379-19742401 GCGTGTGCATTTGTGTGTTTTGG - Intronic
987872283 5:23636443-23636465 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
988458740 5:31413040-31413062 GTGTGTGCTCATGTGTGCGTTGG - Intronic
988520876 5:31944733-31944755 GCGTGTGCACGTGTGTCCCCAGG + Intronic
988935767 5:36081582-36081604 GTGTGTGCATGTGTGTGGGTGGG - Intergenic
989740504 5:44765679-44765701 GTGTGTGCACATGTGTGTATCGG - Intergenic
991069305 5:62458681-62458703 GCCTGTGCATGTGTGTGTCTAGG + Intronic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
994838529 5:104889853-104889875 GTGTTTGTACATGTGTGCCTGGG - Intergenic
995495842 5:112742084-112742106 GGGTGTGCAAGTGTCTGCTTGGG + Intronic
996163660 5:120197994-120198016 ACGTGTGCATGTGTGTGTTTTGG - Intergenic
997258777 5:132449477-132449499 GCTTGTGCCCGTGTCTGCCCTGG + Intronic
998176900 5:139907003-139907025 GCATGTGCACATGTGTGTATGGG + Intronic
998392641 5:141797234-141797256 GTGTGTCCAAGTGTGTGCCTAGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1001487948 5:172133198-172133220 GCGTGTGTGCGTGTGTGTCTGGG + Intronic
1001709423 5:173766265-173766287 GAGTCTGCACGTGTGTCTCTGGG + Intergenic
1001799602 5:174531530-174531552 GTGTGTGCACACCTGTGCCTGGG + Intergenic
1001833973 5:174814920-174814942 GTGTGTGTACGTGTGTGTGTGGG - Intergenic
1001936310 5:175708276-175708298 GCGTGCACATGTGTGTGCATGGG + Intergenic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002455374 5:179343322-179343344 TCTTGTGCACGTATGTGTCTGGG - Intronic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002900074 6:1403878-1403900 GCATGTGCGTGTGTGTGTCTCGG - Intergenic
1003558734 6:7163740-7163762 GTGTGAGCACGTGTGTGCCTGGG + Intronic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1006295414 6:33167924-33167946 GCATGTGTATGTGTGTGTCTAGG - Intronic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007603201 6:43096683-43096705 GGGTGTGCAGGGGTCTGCCTGGG + Intronic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1007836483 6:44677886-44677908 ACATGTGCATGTGTGTGCATAGG - Intergenic
1010375237 6:75161066-75161088 GGGTGTGTGTGTGTGTGCCTAGG - Intronic
1010843228 6:80673535-80673557 GTGTGTGTACATGTGTGTCTAGG + Intergenic
1010982677 6:82386988-82387010 GTGTGTGCGCGTGTGAGCATGGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1013684699 6:112565848-112565870 GCACGTGCACGTGTGTGTCATGG + Intergenic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1019139566 6:169934987-169935009 GAGTGTGCGAGTGTGTGCCCGGG - Intergenic
1019148025 6:169987117-169987139 GCCTGGGCAGGTGTGGGCCTCGG - Intergenic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019264736 7:108163-108185 GTGTGTGCACATGTGTACATGGG - Intergenic
1019329502 7:455630-455652 GTCTGTGCACGTGTGAGCGTGGG - Intergenic
1019356637 7:583368-583390 GAGTGTGCACATGTGTGAGTGGG - Intronic
1019356644 7:583413-583435 GGGTGTGTGCGTGTGTGCGTGGG - Intronic
1019356648 7:583452-583474 GTGAGTGCACGTGTGTGAGTGGG - Intronic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1019560046 7:1651389-1651411 GTGTGTGCCCGTGTGTGCCTGGG - Intergenic
1019949306 7:4358398-4358420 GCGTCTTCACCTGTGTGACTTGG + Intergenic
1021281681 7:18727592-18727614 GAGAGCGCACGTGTGTGCGTGGG - Exonic
1022112195 7:27238765-27238787 GCCTGTACACCTGTCTGCCTGGG - Intergenic
1022260536 7:28700213-28700235 GCTTGTGCGCGTGTGTGAGTTGG - Intronic
1022701221 7:32762117-32762139 GAGAGTGCACGTGTGGGCTTGGG - Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1026148964 7:67772007-67772029 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1026272188 7:68846071-68846093 GTGTGTGTGCGTGTGTGTCTTGG - Intergenic
1026576621 7:71577412-71577434 GCGTGTGTTTGTGTGTGTCTGGG - Intronic
1026975685 7:74496572-74496594 GGGTGTGCATGTGTGTGGGTGGG + Intronic
1029590739 7:101505340-101505362 ATGGGTGCATGTGTGTGCCTAGG + Intronic
1034318629 7:150158863-150158885 CTGTGTGCACGTGTGTGTGTGGG - Intergenic
1034526848 7:151669791-151669813 GTGTGTGCAAGTGTGTGCACAGG - Intronic
1034774123 7:153808337-153808359 GTGTTTGCACGTGTGTGTGTGGG + Intergenic
1035458971 7:159027746-159027768 GCGTGTGTGGGTGTGTGCGTGGG - Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036212126 8:6850833-6850855 GCATGTGCAGGTGTGTGTATGGG - Intergenic
1036473497 8:9072057-9072079 GTGTGTGTACGTGTGTGACAGGG - Intronic
1036762041 8:11515966-11515988 GGGTGTGCACTCGCGTGCCTGGG + Intronic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1037768557 8:21786193-21786215 GGGTGTGTATGTGTGTGCATGGG - Intronic
1038055692 8:23855647-23855669 AGGTGTGCACATGTGTACCTGGG - Intergenic
1039074559 8:33678087-33678109 GTGTGTGTATGTGTGTGTCTAGG + Intergenic
1039318435 8:36399668-36399690 GGGTGTGAATGTGTGTGGCTTGG - Intergenic
1040063200 8:43122211-43122233 GCGTGACAACATGTGTGCCTTGG - Exonic
1041715429 8:60927699-60927721 GTGTGTGTAGGTGTTTGCCTTGG + Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1042231656 8:66561324-66561346 GAGTGTGCACATATGTTCCTGGG + Intergenic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1046010223 8:108537487-108537509 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1047915234 8:129575826-129575848 GTGTGTGTATGTGTGTGACTGGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048985144 8:139731075-139731097 CAGTGTGCACGTGTGTGCCCTGG - Exonic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049013021 8:139900194-139900216 GCCCGTGTGCGTGTGTGCCTGGG + Intronic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049784012 8:144441981-144442003 GTGTGTGCAGGGGTGAGCCTGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1052132857 9:24870851-24870873 GTGTGTGTACGTGTGTGTGTTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053112207 9:35471084-35471106 GCCTGTGCTGGTGTGTTCCTTGG - Intergenic
1053284774 9:36843136-36843158 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1053593127 9:39533681-39533703 CCGTGTGTACGTGTGTGTGTCGG - Intergenic
1053850864 9:42288389-42288411 CCGTGTGCACGTGTGTGTGTCGG - Intergenic
1054573180 9:66831596-66831618 CCGTGTGCACGTGTGTGTGTCGG + Intergenic
1055950399 9:81724797-81724819 CCCTGTGCAGCTGTGTGCCTGGG - Intergenic
1056705408 9:88948405-88948427 ATGTGTGCATGTGTGTGCCTGGG + Intergenic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059502638 9:114768091-114768113 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1059773266 9:117448062-117448084 GGGTATGTACGTTTGTGCCTGGG - Intergenic
1060695929 9:125708829-125708851 GTGTGTGCAAGAGTGTGTCTGGG - Intergenic
1060749088 9:126157084-126157106 GGGTGCACACGTGTGTGCATGGG - Intergenic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061060068 9:128245795-128245817 GTGTGTGCACATGTGTATCTGGG - Intronic
1061235186 9:129337923-129337945 GCCTGTGTCCGTGTGTGCTTGGG + Intergenic
1061936831 9:133862578-133862600 ATGTGTGTACGTGTGTGTCTGGG + Intronic
1062104286 9:134744914-134744936 GTGTGTGCACGTGCACGCCTGGG - Intronic
1062187520 9:135226496-135226518 GAGTGTGCATGTGTGAGCATGGG - Intergenic
1062197974 9:135285094-135285116 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198003 9:135285279-135285301 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198016 9:135285342-135285364 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198027 9:135285405-135285427 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198039 9:135285465-135285487 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198051 9:135285528-135285550 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198064 9:135285591-135285613 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198075 9:135285654-135285676 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198095 9:135285779-135285801 GCGTGTGCACCTATGTGCCTAGG - Intergenic
1062198104 9:135285839-135285861 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198117 9:135285902-135285924 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198126 9:135285965-135285987 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198141 9:135286028-135286050 GCGTGTGCACCTGTATGCCTGGG - Intergenic
1062198154 9:135286091-135286113 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198167 9:135286154-135286176 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198194 9:135286340-135286362 GCGTGTGTACGTGTGTGCCTGGG - Intergenic
1062198202 9:135286400-135286422 GTGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198221 9:135286524-135286546 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198234 9:135286587-135286609 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062221705 9:135419541-135419563 GCGTGTGCACGTGTGCTCACTGG - Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062267023 9:135691305-135691327 TCGTGTGTACGTGTGTGCACTGG - Intergenic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062525873 9:136977929-136977951 GCGTGGGCGCGTGTGTGGCCCGG - Intronic
1062616443 9:137398696-137398718 GCGGGTGCACGTGTGTCACGGGG - Intronic
1062616472 9:137398821-137398843 GCGGGTGCACGTGTGTCACGGGG - Intronic
1062673210 9:137723626-137723648 GGGTGTGCCCGTGTCTGTCTGGG + Intronic
1185480175 X:440136-440158 GTGTGTGCACCTGTGTGTGTGGG - Intergenic
1185567992 X:1110848-1110870 GCGTGTGCATGTGTGTATGTAGG + Intergenic
1185764344 X:2712864-2712886 TTGTGTGCACGTGTGTGTATGGG - Intronic
1185776543 X:2807858-2807880 GTGTGTGCATGTGTGTCCATGGG + Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1189267307 X:39726728-39726750 GCATGTGTATGTGTGTGTCTGGG + Intergenic
1192387782 X:70690563-70690585 GAGTGTGGTGGTGTGTGCCTAGG + Intronic
1192599840 X:72450377-72450399 GTGTGTGCCTGTGTGTGCATAGG - Intronic
1194657514 X:96590720-96590742 GTGTGTGCAAGTGTGTGTATGGG + Intergenic
1194923728 X:99797681-99797703 GAGTGTGTATGTGTGTGCATAGG - Intergenic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196047238 X:111269267-111269289 TTATGTGCACGTGTGTGCCTGGG - Intronic
1198081164 X:133240849-133240871 GTGTGTGCACCTTTGTGCGTAGG - Intergenic
1199004309 X:142676904-142676926 CTGTGTACACATGTGTGCCTGGG + Intergenic
1200059669 X:153478673-153478695 GCTTGGGCATGGGTGTGCCTCGG - Intronic
1200121484 X:153793147-153793169 GTGTGTGCCTGTGTGTGCGTTGG - Intronic