ID: 1002599930

View in Genome Browser
Species Human (GRCh38)
Location 5:180348295-180348317
Sequence CTGTGTGTGTTGGGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1329
Summary {0: 1, 1: 2, 2: 33, 3: 200, 4: 1093}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002599918_1002599930 10 Left 1002599918 5:180348262-180348284 CCCGAGCGTGTGCACGTGTGTGC 0: 1
1: 0
2: 5
3: 57
4: 318
Right 1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG 0: 1
1: 2
2: 33
3: 200
4: 1093
1002599919_1002599930 9 Left 1002599919 5:180348263-180348285 CCGAGCGTGTGCACGTGTGTGCC 0: 1
1: 0
2: 4
3: 14
4: 144
Right 1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG 0: 1
1: 2
2: 33
3: 200
4: 1093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002599930 Original CRISPR CTGTGTGTGTTGGGGGAAGA GGG Intronic
900657208 1:3764486-3764508 TTGTGTGTGTTGGGGGGCGGTGG - Intronic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900991772 1:6101434-6101456 ATGTGTGTGTTGGGGGCGGCAGG - Intergenic
901417992 1:9129865-9129887 CTGTGTGTGTTGTGAGTGGAAGG + Intergenic
901439866 1:9271400-9271422 CTGTGTGTGTTCTTGGAGGAGGG + Intergenic
901831798 1:11897300-11897322 GTGTGTGTGTCGGGGGGAGGGGG - Intergenic
901948215 1:12720801-12720823 CTGTGTCTGTAGGAAGAAGACGG + Intronic
902341457 1:15786008-15786030 TTGTTTGTGTTTGGGGGAGAGGG - Intronic
902396535 1:16135017-16135039 CTGTGTGAGTTGGGGGACCCTGG - Exonic
902716444 1:18276079-18276101 CCATTTGGGTTGGGGGAAGATGG - Intronic
902996101 1:20226399-20226421 GTGTGTGTGGTAGGGGGAGATGG + Intergenic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903302725 1:22390705-22390727 GTGTGTGTGTTGGGGCAGGAAGG - Intergenic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903743061 1:25569389-25569411 TTGGGTGTGTTGGGGGATGGTGG + Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904425246 1:30418701-30418723 CTGTGTGTTTTGCGGGTGGAGGG + Intergenic
904536031 1:31199978-31200000 GTGTGTGTGTTCGGGGACCAGGG - Intronic
904616153 1:31751012-31751034 CTGGGCGTCTTGGGGGAAGCAGG - Intronic
904825290 1:33270306-33270328 CTGTGTGATTTGGGGCAAGTTGG + Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904894203 1:33801900-33801922 CTGTGTGCTTTGCTGGAAGAAGG + Intronic
904978983 1:34480465-34480487 CAGTGTGTGTTGGGGGGTGGGGG - Intergenic
905013557 1:34762455-34762477 CTGTGTGTGTTGGGGGGTGATGG - Exonic
905014510 1:34768082-34768104 CAGTGTGTGGTGGGTGAGGAGGG - Intronic
905122336 1:35691528-35691550 CTGTGTGTGTTGGGGTGGGGAGG - Intergenic
905352788 1:37359122-37359144 GTGTGTGTGTTGGGGGCTGGGGG + Intergenic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906200541 1:43957388-43957410 CTCTGTGTGCTGGGGAAAGAGGG - Exonic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
907338632 1:53717562-53717584 GTGTGTGTATTGGGTGAAGTGGG - Intronic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
908029510 1:59984875-59984897 TTGTGTGTGTTGTGGGAGGAGGG + Intergenic
908127286 1:61043817-61043839 GTGTGTGTGTTGGGGGGAAATGG - Intronic
908279207 1:62512793-62512815 AGGTGTGTATTGGGGGATGAAGG + Intronic
908366959 1:63434395-63434417 TTGTGTGTGGTGGGGGCAGTCGG + Intronic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909533965 1:76712939-76712961 GTGTGTGTGTTGGAGTGAGATGG + Intergenic
909883509 1:80910901-80910923 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
910121925 1:83799606-83799628 GTGTGTGTGTTGGGGGAGGGAGG + Intergenic
910176727 1:84438682-84438704 CGGTGGGTGGTGGGGGAAGGTGG + Intergenic
910229379 1:84970262-84970284 GTGTGTGTGTTGGGGGGTGGGGG - Intronic
910508403 1:87976818-87976840 GTGTGTGTGGTGGGGGAAGGGGG - Intergenic
910971358 1:92859406-92859428 ATGTGTGTGTTGCGGGCAGGGGG - Intronic
911367142 1:96952221-96952243 GTGTGTGTGTTGGGGGTGGGTGG + Intergenic
911397888 1:97334972-97334994 CTGTGTGTGTTGGGGCAGTGGGG + Intronic
911549537 1:99262958-99262980 CTGTGTGTGGTGGGGGGTGAGGG + Intergenic
911568287 1:99491143-99491165 AGGTGTGTGTTGGGAGAGGAAGG - Intergenic
911886943 1:103313847-103313869 CTGTGTGTCTTTGGGTAAGTTGG - Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912465031 1:109866531-109866553 CTGTGTGTGTATGGGGATGGGGG + Intergenic
912663870 1:111561497-111561519 GTGTATGTATTGGGGGAAGGAGG + Intronic
912689712 1:111795187-111795209 AAGTGTGTGTTGGGGGTAGGGGG - Intronic
912933503 1:113983726-113983748 GTGTGTGTGTTGGGGGTGGGAGG + Intergenic
913088346 1:115459212-115459234 GTGTGTGTGTTGGGGGAGGGTGG - Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913322592 1:117599641-117599663 ATGTGTGTGGTGGGAGGAGAGGG - Intergenic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
914231947 1:145770346-145770368 AGGTGTGTGTTGGGGGAAAGGGG + Intronic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
915117917 1:153612097-153612119 GTGTGTGTGTTGGGGGAGGCGGG - Intronic
915217510 1:154349909-154349931 GTGTGTGTGTTGGGGGCAGAGGG - Exonic
915234903 1:154473466-154473488 CGCTGTGTGTTGGGGGGACAGGG + Intronic
915318915 1:155045377-155045399 CAGGGTGTATTGGGGGAGGATGG + Intronic
915328456 1:155093475-155093497 ATGTCTGTGGTGTGGGAAGAGGG - Intergenic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
915518456 1:156427733-156427755 GTGTGTGGGTTGGGGTAAGCTGG + Intronic
915769684 1:158407294-158407316 GTGTGTGTGTCGGGGGACGGGGG + Intergenic
915907474 1:159889399-159889421 GTGTGTGTGTTGGGGGAGGGTGG + Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916078383 1:161216736-161216758 GTGTGTGTGTTGGTGGCAGCTGG + Intronic
916454635 1:164958372-164958394 ATGTGCATGTTGGGGGTAGAAGG + Intergenic
916584185 1:166135851-166135873 CTGTGTGTGTTCTGCAAAGATGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
917218939 1:172706798-172706820 GTGTGTGACTTGGGGGAAGGAGG - Intergenic
917779002 1:178371313-178371335 GTGTGTGTGTGTGGGAAAGAAGG - Intronic
917939229 1:179900910-179900932 GTGTGTGTGTTGGTGGTAGAGGG - Intronic
917971426 1:180210579-180210601 GTGTGTGTGTTGGGGGCTAAGGG + Intergenic
918205044 1:182300704-182300726 GTGTGTGTGTTGGTGGAGGGTGG + Intergenic
918237965 1:182598583-182598605 CTGTGTGGGTCAGGGGAAAAGGG - Intergenic
918273852 1:182931673-182931695 TTGTGTGTGCGGGGGGAACAAGG - Intronic
918314649 1:183313101-183313123 GCGTGCGTGTTGGGGGAGGAGGG - Intronic
919475306 1:198025493-198025515 ATGTGTGTGTTTGGGGGAGAGGG + Intergenic
919902586 1:202055217-202055239 CTGGGTGTTTTGGGGAAACAGGG + Intergenic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920349905 1:205331072-205331094 GTGTGTGTGTTGGGGCAGGCAGG + Intergenic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
920679983 1:208064878-208064900 CTGTGTGTGTTGGGCGGGGCTGG - Intronic
920749717 1:208662274-208662296 GTGTGTTTGTTGGGGGAGGGGGG - Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
920769030 1:208863023-208863045 CTCTGGGGGTTCGGGGAAGAAGG + Intergenic
921232199 1:213084186-213084208 ATGTGTGTGCTGGGGGAGAAAGG - Intronic
921581720 1:216903449-216903471 GTGTGTGTGTCGGGGGACTATGG + Intronic
921725717 1:218521306-218521328 GTCTGTGTGTGGGGGCAAGAAGG + Intergenic
921754985 1:218844846-218844868 GTGTGTGTGTTGGTGGGTGAGGG - Intergenic
921787313 1:219245965-219245987 CTCTGTGTGTCGGGGGATGTGGG + Intergenic
921926189 1:220711720-220711742 ATGTGTGTGTTGAGGGGAGTGGG - Intergenic
922042808 1:221913619-221913641 CAGTGTGTGATATGGGAAGATGG - Intergenic
922434452 1:225590070-225590092 GTGTGTGTGTTGAGTGATGAGGG - Intronic
922566697 1:226605827-226605849 CTGAGGGTGTTGGGGGATGGCGG + Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
923665265 1:235993397-235993419 GTGTGTGTGTTGGGTGGGGAAGG + Intronic
924085495 1:240447251-240447273 CTGTGTGTGTTGGGGGATGTTGG + Intronic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1063021550 10:2133990-2134012 CTGTGCGTGTGGGGGGATGGAGG + Intergenic
1063024624 10:2165746-2165768 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1063135610 10:3213801-3213823 CTTTGTTTGTTGGAGGCAGACGG + Intergenic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1063196288 10:3746946-3746968 TTGTGTGTGTTGGGTGAGGGTGG + Intergenic
1063511458 10:6648360-6648382 GTGTGTGGGTTTGGGGAAAAGGG + Intergenic
1063588972 10:7377970-7377992 TTGTGTGTGTGGGGGGGAGGTGG + Intronic
1063601677 10:7487345-7487367 GTGTGTGTGGTGAGAGAAGAAGG - Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1064068830 10:12207690-12207712 CTGTCTGTGTTGTGGGAGCAGGG + Intronic
1064162794 10:12960335-12960357 CTGTGTGTGTTTGGGAGAGATGG + Intronic
1064354113 10:14602990-14603012 GTGTGTGTGTGTGGGAAAGAGGG - Intronic
1064955626 10:20905553-20905575 CCGTATGTGTTGAGGGAAGGAGG - Intronic
1065021139 10:21502284-21502306 GTGTATGTGTTGGGGGATGGGGG + Intergenic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1065846787 10:29750977-29750999 GTGTGTGTGTTGGGGTTGGAGGG - Intergenic
1066065661 10:31759585-31759607 ATGGGTGTGTTGGGGGAAAGGGG + Intergenic
1067250102 10:44578762-44578784 TTCTGTGTGCTGGGGGAGGAAGG + Intergenic
1067380806 10:45771453-45771475 CTGAGGGTGTTGGGGTATGAAGG - Intronic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067888505 10:50112104-50112126 CTGAGGGTGTTGGGGTATGAAGG - Intronic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068171632 10:53402901-53402923 CTGTGTGTGTTGGGGGTGAGGGG - Intergenic
1068221135 10:54047358-54047380 CTGTGTGTGGTGGGGGGTGGGGG + Intronic
1068561390 10:58518580-58518602 ATGTGTGTGTTGGGGGGGGGGGG + Intronic
1068620667 10:59177346-59177368 GTGTGTGTGTTGGGGGAAGGGGG - Intronic
1068665291 10:59668462-59668484 GTGTGTGTGCTGGGGAGAGAGGG - Intronic
1068665817 10:59674848-59674870 CTGGGAGTGTGGGGGCAAGATGG + Intronic
1068671963 10:59732623-59732645 CACTGTGTGTTGGGGGAGGGGGG + Intronic
1068732592 10:60375746-60375768 GTGTTTATGTTGGGGGAAGTAGG - Intronic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069488558 10:68842005-68842027 GTGTGTGTGTTGGAGGATCATGG + Intronic
1069683172 10:70299707-70299729 CTGTGGGTGTTGGGGGCAAGTGG - Exonic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1069896564 10:71683750-71683772 CAGGGAGTGTTGGGGGAAGGAGG + Intronic
1070041077 10:72780542-72780564 GTGTGTGTGTTGGGTGAATTTGG + Intronic
1070649984 10:78228415-78228437 CTTTGTGTGCTGGGAGAAGGAGG + Intergenic
1070658744 10:78289710-78289732 CTGTGTGTGCTGGTGGGAGCTGG + Intergenic
1070664515 10:78333719-78333741 GTGTGTGTGGTGGGGGGTGATGG + Intergenic
1070772966 10:79093123-79093145 GTGTGTGTGTTGGGGGTGGGGGG - Intronic
1070775721 10:79108648-79108670 CTGTGTGTATTAGGGGGTGATGG - Intronic
1070937441 10:80312035-80312057 GTGTGTGTGTTGGGGGGAGGGGG - Intergenic
1070952855 10:80444763-80444785 TTCTGTGTGTTGGGGGAGGAAGG - Intergenic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1071017477 10:81015054-81015076 ATGTGTGTGAGGGGGGCAGAGGG + Intergenic
1071181525 10:82989984-82990006 GTGTGTGTGTTGCGGGGAAAGGG + Intergenic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071665431 10:87551184-87551206 TTGTGTGTGTTGGGGGCAGAGGG + Intronic
1071713722 10:88074531-88074553 GTGTGTGTGATGGGGGAGGGAGG + Intergenic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1071849544 10:89554654-89554676 ATGTGTGTGTTGTGGGGAAACGG + Intronic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1072623577 10:97096706-97096728 CTGGGTTTGCTGGGGGAAGGGGG - Intronic
1072774017 10:98171042-98171064 CTATGTGTTTTGGGGAAGGAAGG - Intronic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073036532 10:100567662-100567684 GTGTGTGTGTTGCGGGGAGGTGG - Intergenic
1073042203 10:100615279-100615301 GTGTGTGGGTTTGGGGAGGAGGG + Intergenic
1073044220 10:100626976-100626998 CAGAGGGTGTTGGGGGAAAAGGG + Intergenic
1073269181 10:102247284-102247306 TTGTGTGTGTTGGGAGAAGGGGG + Intronic
1073348705 10:102803544-102803566 GTGTGTTTGTTGGGGAAAGGAGG + Intronic
1074095740 10:110310742-110310764 ACGTGTGTGTTTGGGGATGATGG + Intergenic
1074290347 10:112133511-112133533 TCGTCTGTGCTGGGGGAAGAAGG - Intergenic
1074302033 10:112241800-112241822 CTCTGTTTGTTGGGGGAAGTAGG - Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074538385 10:114345190-114345212 CTCTGTGTATCGGGGGAACATGG + Intronic
1074913654 10:117935636-117935658 CTGTGTGTGTAAGGGACAGAGGG - Intergenic
1075223450 10:120603872-120603894 TTGTGTGTGTTGGGGGAGGGGGG - Intergenic
1075242696 10:120792941-120792963 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1075242758 10:120793181-120793203 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075550908 10:123391614-123391636 CAGTCTGAGTTGGGGGAAGAGGG + Intergenic
1075584715 10:123649223-123649245 AAGTGAGTGTTGGGGAAAGAAGG + Intergenic
1075875064 10:125799401-125799423 ATGTGTGTGTTGGGGAATGCAGG + Intronic
1076326468 10:129627183-129627205 ATGGGTGTGCTGGGGGATGAGGG + Intronic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077082928 11:733316-733338 CTGTGTGTGTCGGGGAAGAATGG - Intergenic
1077484982 11:2834525-2834547 CTGTCTGTGTTGGGGGAGCTGGG - Intronic
1077523210 11:3048618-3048640 CTCTGGGTGCTGGGGGATGAGGG + Intronic
1077914807 11:6604144-6604166 GTGTTTGTGTTGGGGGTAGGGGG - Exonic
1077999037 11:7478313-7478335 CTCTGTGTGATGGGGGAAGGTGG + Intergenic
1078173439 11:8949032-8949054 GTGTGTGTGTTGAGGGTACAGGG - Intronic
1078187206 11:9062165-9062187 CTGAAGGAGTTGGGGGAAGAGGG - Intronic
1078293480 11:10040730-10040752 GTGTGTGTGTATGGGGGAGATGG + Intronic
1078650092 11:13182469-13182491 GTGTGTGTGTTGTGGGAGGGAGG + Intergenic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1078673112 11:13382510-13382532 GTGTGTGTGTTGTGGGCAGGGGG - Intronic
1079013773 11:16851400-16851422 GTGTGTGGGTTGTGGGAGGATGG - Intronic
1079023587 11:16927975-16927997 TTGTGTGTGGAGGGGGAAGGGGG + Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1080007064 11:27420758-27420780 ATGTGTGTCTTGGGGGAAGGTGG + Intronic
1080009694 11:27445550-27445572 CTGTATTCGTTGGGGGAGGAGGG - Intronic
1080017265 11:27520801-27520823 CTGTCAGTGTTGGGGGACGAGGG - Intergenic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080505723 11:32911282-32911304 CTGGGGGTGGTGGGGGAAGACGG + Intronic
1080567103 11:33520672-33520694 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1080582641 11:33656723-33656745 ATTTGTATGTTGGGGGAAGCTGG - Intronic
1080619426 11:33974654-33974676 GTGTGTGTGTTGGGAAAAGGAGG - Intergenic
1081010608 11:37806674-37806696 CTATGTGTGTTGGGGAAGGAGGG + Intergenic
1081155417 11:39683943-39683965 TTGTGTGTGTTGGGGGTGGAAGG - Intergenic
1081227182 11:40538279-40538301 CTGTGTGGGTTGGGGGGAAGGGG - Intronic
1081626076 11:44655977-44655999 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
1081671990 11:44947563-44947585 CTGGGTGAGTTGGGGGAGGCAGG + Intronic
1083374040 11:62205316-62205338 GTGTGTGTGTAAGGGGAAGGGGG + Intergenic
1083489312 11:63003445-63003467 GTATGTGTGTTGGGAGGAGATGG + Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083773227 11:64879647-64879669 CTGTGTGTGGCCGGGGAGGATGG - Intronic
1083932137 11:65851863-65851885 GTGTGTGTGTTGGGGGGTGCAGG + Intronic
1083950195 11:65950318-65950340 CTGGGTTTGTGGGGAGAAGAAGG - Intronic
1084333877 11:68445974-68445996 CTGTGTGTGATGGAGGGAGGAGG + Intronic
1084422002 11:69065176-69065198 CTGTGGGTGGTGGGGGCAGCTGG + Intronic
1084536598 11:69761023-69761045 GTGTGTGTACTGGGGGAACAGGG - Intergenic
1085294644 11:75424187-75424209 GTGTGTGTGTTGAGGGGTGAGGG - Intronic
1085297967 11:75441560-75441582 GTGTGTGTGTTGGGGGGTGGTGG + Intronic
1085309526 11:75507919-75507941 GGGTGGGTGTTGGGGGATGATGG - Intronic
1085345355 11:75765085-75765107 CTGTGTGAGTTTGGGCAAGGGGG - Intronic
1085623728 11:78056391-78056413 ATGAGTGTGTTGGTGGAAAAGGG - Intronic
1085683138 11:78596795-78596817 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1085768380 11:79303972-79303994 TTGTGTGTGTTGGGCTAATATGG + Intronic
1085777542 11:79380093-79380115 CTGCATGTGTTGGGGGAAGGAGG - Intronic
1086185308 11:84006857-84006879 CAGTCAGTGTTGGGGGAACAAGG - Intronic
1086738882 11:90341929-90341951 CTGTGTGTGTTGGGAGTGCAGGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086902874 11:92387399-92387421 CTGTGTGTGTTGCAGGGTGAAGG + Intronic
1086929240 11:92674244-92674266 CTGGGTGTGATGGAGAAAGAAGG + Intronic
1086944928 11:92835721-92835743 CTGTGTGTGTAGGGGGAAAGGGG - Intronic
1086970857 11:93079100-93079122 GTGTGTGTGTTGGTGGAAATTGG + Intergenic
1087293532 11:96343667-96343689 ATGTGTGTGTTGAGGGCGGAAGG + Intergenic
1087317237 11:96616715-96616737 TTGTATGTGTTGGGGGGTGAGGG - Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087478561 11:98669560-98669582 GTGTGTGTGTTGGAGGGAGAAGG - Intergenic
1088643332 11:111895262-111895284 TAGTGTGGGTTGGGGGAAGGTGG + Intergenic
1088816074 11:113421918-113421940 CTGAGTGTGTCAGGGGAGGAGGG - Intronic
1088824319 11:113481155-113481177 CTGATTGTGTTGGAGGAAGAGGG - Intergenic
1088833140 11:113555080-113555102 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1089092188 11:115887388-115887410 GTGTGTGTGCTTGGGGAAGGTGG + Intergenic
1089174309 11:116537316-116537338 ACGTGGGTGTTGGGGGACGAGGG - Intergenic
1089283809 11:117392890-117392912 TTGTGTGTGTTGGGGGAGATTGG + Intronic
1089527486 11:119107007-119107029 CTGGGGGTGTTGGGAGAAGGGGG + Intronic
1089581874 11:119486528-119486550 CCGTGTGTGTTAGGGGAGGGGGG + Intergenic
1089586766 11:119514592-119514614 CTGTGTGTGTTGAGGGGGGTAGG + Intergenic
1089718414 11:120387235-120387257 TTGTGTGTGGTGGGGGGGGAGGG + Intronic
1089778918 11:120859507-120859529 CTCTGTGTGTGGGGAGAGGATGG + Intronic
1089936563 11:122370330-122370352 CCATGTGTGTTGGGGGCTGAGGG + Intergenic
1090042222 11:123301290-123301312 ATGTGTGTGTTGGGGAGGGAGGG + Intergenic
1090172620 11:124617986-124618008 TTGTATGTGTTGGGGGATGGGGG + Intronic
1090439904 11:126716738-126716760 GTGTGTGTGTTGGGGGGGGGGGG + Intronic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090485472 11:127108649-127108671 CAGTGTGTGTTTGGGGACGGGGG - Intergenic
1090874456 11:130776425-130776447 CTCTGTGTGTTGAGGGTACAAGG + Intergenic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091584264 12:1806922-1806944 ACTTGTGTGTTTGGGGAAGAGGG + Intronic
1091815481 12:3434682-3434704 CCGTGTGTGTTGGGGGTTGGTGG + Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1091936685 12:4440438-4440460 CAGTGTGTGTTGGATGGAGAAGG + Intronic
1092046510 12:5434761-5434783 CTGTGTGTGTGAGGGAAAGGTGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092184600 12:6469810-6469832 CTGTGTGTGTTGGAGGAAAGGGG + Intronic
1092272833 12:7037160-7037182 GTGTGTGTGTTGGCGGGGGAGGG + Intronic
1092783885 12:12010731-12010753 GAGTGTGTGTTTAGGGAAGATGG - Intergenic
1092793582 12:12089707-12089729 TGGTGTGTGTTGGGGGGACAGGG - Intronic
1092913718 12:13171164-13171186 GTGGGTGGGTGGGGGGAAGAGGG + Intergenic
1093210428 12:16301658-16301680 GTGTGTATGTTGGGGTGAGAGGG + Intergenic
1093787288 12:23207352-23207374 GTGTGTGTGTTGGGGGTGGGTGG - Intergenic
1093799992 12:23361696-23361718 GTGTGTGTGGTGGTGGAAGGCGG - Intergenic
1093866028 12:24228524-24228546 GTGTGTGTGGTGGGAGAAGAGGG - Intergenic
1093912273 12:24761657-24761679 GTGTGTGTGTTGGGGGCTGGGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094150048 12:27272744-27272766 CTGTGTGTGTTGGGGGAAAGAGG - Intronic
1094478431 12:30860583-30860605 GTGTGTGTGTTGGGGGTTGGGGG - Intergenic
1094617714 12:32051135-32051157 CTGTGTGTGTTGGCTGATGTCGG + Intergenic
1095392054 12:41719289-41719311 GTGTGTGTGGCGGGGGAGGAGGG - Intergenic
1095575478 12:43733161-43733183 GTGTGTGTGTGTGGGCAAGATGG - Intronic
1095970080 12:47895679-47895701 CTGTTGGTGTTGGGGAAGGACGG - Intronic
1096116210 12:49056941-49056963 CTGAGAGTGTTAGGGGAAAAAGG - Intronic
1096792384 12:54053277-54053299 GTGAGTGTGTATGGGGAAGAGGG + Intronic
1096850223 12:54430773-54430795 CTGAATGTGTTGGGGTAAGATGG - Intergenic
1097237691 12:57550923-57550945 GTGTGTGTGTTGTGGGGAGTAGG + Intronic
1097555192 12:61127793-61127815 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1097727138 12:63088126-63088148 CTCAGTGAGTTGGGGGAAGTGGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098420858 12:70296132-70296154 GTGTGTGTGTTGGTGGGGGAGGG - Intronic
1098532596 12:71557752-71557774 CTGAGTGTGCTGGGAGAGGAGGG + Intronic
1098770160 12:74541148-74541170 GTGTGTGTTATGGGGGAAGGGGG + Exonic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1099719673 12:86344766-86344788 GTGTGTGTGTAGCGGCAAGAGGG + Intronic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1099935434 12:89119360-89119382 ATGTGTTTGTTGGGGGACGGGGG - Intergenic
1100418627 12:94406483-94406505 GTGTGTGTGGTGGGGGCAGGGGG + Intronic
1100686059 12:96986761-96986783 CTCTGAGAGTTGGGGGAAGTGGG + Intergenic
1100712089 12:97268554-97268576 CTGGGGGTGATGGTGGAAGAAGG + Intergenic
1100743081 12:97616632-97616654 CTGTTTGTGTGGGTGGGAGAGGG - Intergenic
1100808208 12:98310476-98310498 GTGTATGTGTTTGGGGGAGATGG - Intergenic
1100926299 12:99551934-99551956 GTGTGTGTGGTGGGGGGAGGTGG - Intronic
1101030816 12:100657563-100657585 GTGTGTGTTGTGGGGGAGGAGGG - Intergenic
1101055345 12:100906766-100906788 CTGAAGGTGTTTGGGGAAGAGGG + Intronic
1101579177 12:106026523-106026545 CTCTCTGTGATGGAGGAAGATGG - Intergenic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1101938266 12:109077815-109077837 GTGTTTGTGTTGGGGGGGGAGGG + Intronic
1102181130 12:110913180-110913202 GTGTGTGTGTAGGGGGGACAGGG + Intronic
1102196676 12:111030414-111030436 GTGTGTGTGTTTGTGGCAGAGGG + Intergenic
1102398556 12:112609085-112609107 CTGTGAGGATTTGGGGAAGATGG - Intronic
1103284956 12:119793074-119793096 TTGTGTGTGGTGGGGGAGGGGGG - Intronic
1103362951 12:120364470-120364492 TTGTGTGTGTTGGGAGAAAGGGG - Intronic
1103617223 12:122161994-122162016 ATATGTCTGTTGGGGGAACACGG - Intergenic
1103900576 12:124301719-124301741 CTGAGTGTCTGGGGGGAAGTGGG + Intronic
1104086086 12:125475162-125475184 GTGTGTGTGTTGGGGGGAAGAGG + Intronic
1104545993 12:129713460-129713482 CTTTGTGTGTTTTGGGAAGGAGG + Intronic
1104636418 12:130440375-130440397 GTGTCTGTGTTGGAGGAAGAAGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105465654 13:20637325-20637347 CTGTGAGTGTTATGGGAAAAGGG + Intronic
1105652179 13:22391136-22391158 CTGTGTGCTTTGGGGAAAGTTGG + Intergenic
1106059048 13:26268244-26268266 GTGTGTGTGTTGGGGGAGGGGGG - Intronic
1106463025 13:29989521-29989543 GTGTGTGTGTTGGGGGGCGCGGG + Intergenic
1107288645 13:38825760-38825782 CTGTGAGTGATGGGGGTAAAAGG - Intronic
1107317795 13:39152126-39152148 CTGTGTGTGTTGGCTAAATAAGG - Intergenic
1107501436 13:40981336-40981358 GTGTGTGTGTTGTGGGGAGGGGG + Intronic
1107731250 13:43351268-43351290 ATGTGTGTTTTGGGGGTAGAAGG - Intronic
1108036840 13:46298971-46298993 GTGTGTGTGTTGGAGGAGGTGGG - Intergenic
1108268465 13:48735187-48735209 CTGTGTGTTTTAGGGGAAAGAGG + Intergenic
1108320979 13:49290258-49290280 TTATGTGTGTTGGGGGGAGATGG - Intronic
1108529449 13:51315307-51315329 GTGTGTGTGTAGGGGGTTGAGGG - Intergenic
1108723347 13:53154837-53154859 GTGTGTGTGTTGGGGGCGGGGGG - Intergenic
1108784748 13:53883143-53883165 GTGTGTGTGTTTGAGAAAGAGGG - Intergenic
1109001483 13:56811240-56811262 CTGTGAATGTTGGGGGATGGAGG - Intergenic
1109018185 13:57048008-57048030 TTGTGTTTGTTGTGGGAACATGG - Intergenic
1109193208 13:59350117-59350139 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
1109213686 13:59563659-59563681 CGGTGTGTGTTTGGGAAAGGAGG + Intergenic
1109251985 13:60031210-60031232 GTGTGTGTGTTGGCTGGAGAGGG + Intronic
1109589002 13:64451456-64451478 ATGTGTGTGTTTGGGGCAGGGGG - Intergenic
1109658822 13:65431421-65431443 GTGTGTGTACTGGGGGCAGAGGG + Intergenic
1109843192 13:67948424-67948446 CTGTAAGTGTTGGGGAAACATGG + Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110798678 13:79669986-79670008 GTGTGTGTGTTGGGGGATGGGGG - Intergenic
1110817818 13:79880950-79880972 CCATGGGTGTTGGAGGAAGATGG + Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111133147 13:84001513-84001535 GTATGTGTGTTGGGGGATGGAGG + Intergenic
1111505444 13:89183556-89183578 TTCTGTGAGTTGGAGGAAGATGG + Intergenic
1111548061 13:89770026-89770048 CTGTGTGTGTTTGTGGATGATGG - Intergenic
1111619719 13:90708422-90708444 CTGTGTGTGTTGTAGAAGGAGGG - Intergenic
1112274869 13:98007204-98007226 CTGTGTGTGGTGGGGAAAGGAGG - Intronic
1112403012 13:99092467-99092489 CTGTGTGGGTTGGGGGAGTTTGG - Intergenic
1112426509 13:99306512-99306534 GTGTGTGTGTTGGGGGAGGGGGG - Intronic
1112886208 13:104175231-104175253 CTGCGTGTGTTGGGGGGCGGGGG + Intergenic
1112920694 13:104608583-104608605 TTGTGGGTGATGGGGGAAGCAGG - Intergenic
1112983794 13:105421059-105421081 CTGTGTGTGTTGGTGGAGGTGGG + Intergenic
1113047532 13:106171745-106171767 CTGGGTGTGGTGGCGGGAGACGG + Intergenic
1113062064 13:106332646-106332668 GTGCGTGTGTTGGGGGCAGGGGG - Intergenic
1113343538 13:109450424-109450446 CTGGGAGTGCTGGGGGCAGAAGG - Intergenic
1113383220 13:109823216-109823238 CTGTGTGGGGTGGGGGAAGTGGG - Intergenic
1113769773 13:112900619-112900641 GCTTGTGTGTTGGGGGAAGAGGG + Intronic
1113884078 13:113648326-113648348 GTGTGTCTGTTGGGGGCTGACGG + Intergenic
1113974839 13:114219854-114219876 CTGTGTGTGAGGGAGGAAGGAGG + Intergenic
1114069540 14:19096602-19096624 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1114092722 14:19303401-19303423 GTGAGTGTGTGGGGGGGAGAGGG - Intergenic
1114251674 14:20967144-20967166 CTGGGAATGTTGGGGGAAGAAGG + Intergenic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1115400012 14:32946321-32946343 GTGTGTGTGTTGGGGGGATGGGG - Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115653406 14:35420142-35420164 GGGTGTGGGTTGGGGGAGGATGG - Intergenic
1116159465 14:41250638-41250660 GTGTGTGTGTTGGGTGATGGTGG + Intergenic
1117195450 14:53335813-53335835 CTGTGTGTGTAGGGGCCAGGTGG + Intergenic
1117460404 14:55939443-55939465 CTGTCTGTGTCGGGGGAGGAGGG + Intergenic
1117812103 14:59558164-59558186 CTTGGTGTGTTCGAGGAAGAAGG + Intronic
1117871488 14:60205500-60205522 GTGTGTGTGGTGGGGGGAGGAGG + Intergenic
1118019656 14:61696961-61696983 GTGTGTGTGTTGGGGGATGGGGG - Intronic
1118172020 14:63396558-63396580 TGGAGTGTGATGGGGGAAGAAGG - Intronic
1118181043 14:63493496-63493518 GTGTGTGTGGTGGGGGGAGGGGG + Intronic
1118326985 14:64787960-64787982 CTGTGGGTGTTCGAGAAAGATGG - Intronic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1118568312 14:67167169-67167191 ATGTGGGTGTTGGGGGATTATGG - Intronic
1118773366 14:68957294-68957316 AGGTGTCTCTTGGGGGAAGAGGG - Intronic
1119064591 14:71512644-71512666 TTTTGTGTGTGGGGGGAAGCCGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119655093 14:76411602-76411624 CTGTGTGTGTTGCAGGAAGGAGG + Intronic
1119716472 14:76863206-76863228 GTGTGTGTGTTGGGATAGGAAGG + Intronic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1120710065 14:87784088-87784110 GTGTGTAGGTTGTGGGAAGATGG + Intergenic
1121115202 14:91338447-91338469 CTGTGTGTCCTGGGGGTAGCAGG - Intronic
1121168969 14:91836780-91836802 GGGTGTGTTTTGGGAGAAGAAGG + Intronic
1121250081 14:92492947-92492969 GTGTGTGTGTTTGGGGTAGAGGG - Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1121616855 14:95319466-95319488 GTGTGTGTGTTGTGGGGCGAGGG - Intronic
1121774806 14:96583658-96583680 GAGTGTGTGTTGGGGGAGGGCGG + Intergenic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1122289038 14:100669651-100669673 GTGTGTGTGTTGGAGCAAGGCGG - Intergenic
1122472919 14:101984146-101984168 GTGTGTGTGTTGGCGGGAGGGGG + Intronic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1125250288 15:37694177-37694199 GTGTGTGTGTTGTGGGTGGAAGG - Intergenic
1125547796 15:40519999-40520021 CCATGTGTGTTGGGGTAAAAGGG - Intergenic
1125740029 15:41956044-41956066 CTGTGTGTGCTGCGGGGAGCTGG - Intronic
1125766805 15:42141774-42141796 TTGTGTGTTTTTGGAGAAGATGG - Exonic
1125793822 15:42389715-42389737 TTGGGCGTGTTGGGAGAAGAAGG - Intronic
1126110318 15:45171324-45171346 GTGTGTGTGTTCGGGGATGGGGG - Intronic
1126282401 15:46970019-46970041 GTGTGTGTGTTGGGGGAGGGAGG - Intergenic
1126419492 15:48456405-48456427 CACTGTGTGTTGGGGGAAAGGGG + Intronic
1126737482 15:51746443-51746465 CTGGGTGTGTAGGGGGAATGAGG + Intronic
1127151988 15:56085290-56085312 GTGTATGTGGTGGGGGTAGAAGG + Intergenic
1127304140 15:57685502-57685524 CTGTGTGTGTCGGGGGAGGGTGG + Intronic
1127412268 15:58721550-58721572 GTGTGTGGGGTGGGGGCAGAGGG - Intronic
1127485346 15:59413174-59413196 CTGTGGGAGATGGGGGAACATGG + Intronic
1127488356 15:59439398-59439420 GTGTGTGTGTTGGGGGGGGCGGG + Intronic
1127898276 15:63321717-63321739 CTGTGTGTGTAGGGGCGAGGGGG + Exonic
1127899320 15:63329583-63329605 GTGTGTGTCTTGGAGGAAGAAGG + Intronic
1128585256 15:68843869-68843891 GTATGTGTGTGGGGGGTAGAGGG - Intronic
1128765095 15:70246511-70246533 CTGTGGGTGTTGGAGCAGGACGG + Intergenic
1129033903 15:72638464-72638486 TTGTGTGGGTATGGGGAAGAAGG + Intergenic
1129215979 15:74098752-74098774 TTGTGTGGGTATGGGGAAGAAGG - Intergenic
1129291061 15:74568043-74568065 CTCTGTCTTCTGGGGGAAGATGG + Intronic
1129408814 15:75337700-75337722 TTGTGTGGGTATGGGGAAGAGGG + Intronic
1129733117 15:77943087-77943109 TTGTGTGGGTATGGGGAAGAGGG - Intergenic
1130113749 15:80988657-80988679 CTGTGTGTGTTACGGGAGAAGGG - Intronic
1130977234 15:88786460-88786482 GTGTGTGTGTTGGGGAGAGGGGG - Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131060063 15:89399242-89399264 CCGTGTGTGGTGGGGGAGGGGGG + Intergenic
1131298393 15:91172616-91172638 TTCTATGTGTTGGGGGAGGACGG - Intronic
1131573837 15:93566655-93566677 GTGTGTGTGTTGGGGGACGGAGG - Intergenic
1131619410 15:94051357-94051379 GTGTATGTATTTGGGGAAGAGGG - Intergenic
1131736648 15:95339668-95339690 GTGTGTGTGTTGGTGGAGGGGGG - Intergenic
1132113792 15:99121047-99121069 CTTTGGGTGGTGGGGGAAGTGGG + Intronic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132530505 16:445952-445974 CTGTGTGAGGTGGGGGTAGGTGG + Intronic
1132595398 16:746816-746838 CTGTGTGTGATGGGGGCATCTGG - Intronic
1133265703 16:4582389-4582411 TGGGGTGTGTTGGGGGAAAAGGG + Intronic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1133712991 16:8419565-8419587 AATTGTGTGTTGAGGGAAGAGGG - Intergenic
1135169166 16:20167967-20167989 CAGTGTGTGTTGTGGTAAGATGG + Intergenic
1135281793 16:21158989-21159011 GTGTGTGTGTTGGGGGGTGGCGG - Intronic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135548107 16:23379104-23379126 CTGGGTGTGTGGGTGGATGATGG - Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136186293 16:28590759-28590781 GTGTGTCTCCTGGGGGAAGAGGG - Exonic
1136225957 16:28860720-28860742 GTGTGTGTGTCGGGGGGAAATGG - Intronic
1137249918 16:46733745-46733767 CTATGTGTGTTAGGGGGTGAGGG + Intronic
1137347236 16:47675472-47675494 GTGTGTGTGTTGGGAGAAGAGGG - Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137433559 16:48437379-48437401 CTTTGTGTGTTGGGAGAAAATGG - Intronic
1137501678 16:49016415-49016437 GTGTGTGTGGTGGGAGAAGTGGG + Intergenic
1137601759 16:49760903-49760925 GTGTGTGTGTTGGAGGGAGGTGG - Intronic
1137710864 16:50565990-50566012 CAGTGTGTGTCGGGGGCACAGGG - Intronic
1137733674 16:50708733-50708755 CTGTGTGTGGTGCTGGCAGATGG + Intronic
1138102894 16:54268693-54268715 CTGCTTCTGTTTGGGGAAGACGG + Intronic
1138799500 16:60010754-60010776 GTGTGTGTGTTGTGTTAAGAAGG - Intergenic
1138887855 16:61102056-61102078 GTATGTGTGTTGGGGGATGGGGG + Intergenic
1138897142 16:61220513-61220535 CTGTACATGTTGGGGGAGGAGGG + Intergenic
1139183990 16:64782081-64782103 CTGTATGTGTACGGGGCAGAAGG - Intergenic
1139472212 16:67184347-67184369 CTGTGTGTGTTGGGGAAGGTGGG - Exonic
1139724398 16:68885022-68885044 ATGTGTATGTTGGAGGAAAATGG + Intronic
1139839654 16:69868175-69868197 GTGTGTGTGTTGGGGGGTGGTGG + Intronic
1140002639 16:71040489-71040511 TTGTGTGTGTGGGGGGGAGGGGG - Intronic
1140043567 16:71425191-71425213 GTGTGTGTGTTGGGGGGGGGGGG + Intergenic
1140190711 16:72813633-72813655 ATGTGTGTGTTGGGAGGAGGAGG - Intronic
1140462036 16:75147665-75147687 TTGTGTGTGCTGGGGGGACATGG + Intergenic
1140651106 16:77089527-77089549 CAGTGTGTGTTGGCCTAAGAGGG + Intergenic
1140719016 16:77753660-77753682 CTCTGGATGTTGGGTGAAGAAGG - Intergenic
1141148688 16:81549531-81549553 CTGTGTGTGTTGGGGGCGGGGGG + Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141347408 16:83260083-83260105 GTGTGTGTATTGGGGGTACATGG - Intronic
1141362379 16:83407953-83407975 CTGGGAATGTTGTGGGAAGAGGG - Intronic
1141710696 16:85697291-85697313 AAGTGTGTGTTGGGGGAACATGG - Intronic
1142043008 16:87907332-87907354 CTGTGTCTGTGGGGGAAAGGGGG + Intronic
1142183058 16:88681044-88681066 CGGTCTGGGCTGGGGGAAGAGGG - Intronic
1142248278 16:88979626-88979648 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1142389435 16:89789240-89789262 CTGCTTGTGTTGGGAGAAGGTGG - Intronic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1142606449 17:1084020-1084042 GTGTGTGTGCTGGGGGGAGCTGG + Intronic
1142684736 17:1571296-1571318 CAGTCTGTATTGGCGGAAGACGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143256660 17:5562551-5562573 CTGTGTGTGTTGGGGACAGGGGG - Intronic
1143393907 17:6576797-6576819 GTGTGTGTGTTGGGGGAGTGGGG - Intergenic
1143498048 17:7323613-7323635 CTGTGTGTGTTGGGGGCTGTTGG - Intronic
1143551025 17:7630606-7630628 CAGTGTGGGTTTGGGGGAGATGG - Intronic
1143565480 17:7717830-7717852 AGGTGTGTGTCGGGGGCAGAGGG + Exonic
1143584071 17:7842750-7842772 CTGTGTGTGTTCAGGGAGGCGGG + Intronic
1144021765 17:11244332-11244354 CTGTGTGTGGTAGGGGGACAGGG + Intronic
1144224844 17:13135264-13135286 GTGTGTGTGTTGGTGGCAGAGGG + Intergenic
1144456881 17:15426099-15426121 GTGTGTGTGTTGGGGGTAGGGGG - Intergenic
1144730805 17:17525179-17525201 CTGGGTCTGTTGGGGGAGGGGGG - Intronic
1144793846 17:17877902-17877924 CTTCGTGTTTTGGGGGGAGAGGG - Intronic
1146019165 17:29261073-29261095 CTGTGTATTTTGTGGGAAAAGGG + Exonic
1146544262 17:33724817-33724839 GTGTATGTGTTGGGGGTTGAGGG - Intronic
1146589550 17:34116845-34116867 AAGTGTGTGTGGGGGGAGGAGGG + Intronic
1146706849 17:35006866-35006888 ATGTGTATGTTGGGGGAGTAGGG + Exonic
1146710998 17:35041282-35041304 GTGTGTGTGTTGAGGGGAGGAGG - Intronic
1146720149 17:35118474-35118496 GTGTGTGTACTTGGGGAAGAAGG - Intronic
1147163369 17:38580265-38580287 GTGTGTGTGTTGGGGGCAGGTGG - Intronic
1147210456 17:38870023-38870045 CTGTGTTTATTAGGGGAAGGAGG + Exonic
1147241148 17:39091300-39091322 GGGTGTGTGTTGCGGGGAGATGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147498575 17:40940743-40940765 GTGGGTGTGTTGGGGTCAGAAGG + Intergenic
1147952673 17:44115755-44115777 TTCTCTGTGTTGGGGAAAGAAGG - Intronic
1147975616 17:44246707-44246729 GTCTGTGTGTTGGGGGATGGGGG + Intergenic
1148260930 17:46183033-46183055 CTGTGTGATTTGGGGGATGGAGG + Intronic
1148403776 17:47392446-47392468 ATGTGTGTGTTGGGGGGTGGGGG + Intronic
1148595025 17:48847199-48847221 ATGTCTGTGTTGGGGGCAGAGGG - Intronic
1148756823 17:49977564-49977586 CTGTGTGTATTTGGTGAGGAGGG - Intergenic
1148778826 17:50110482-50110504 CTTTGTGGGCTGGGGGAATAAGG - Exonic
1148788020 17:50155236-50155258 GTGTGTGTGTTGGGGGGCGGGGG + Intergenic
1148869605 17:50648747-50648769 CTCTGTGTGTTGGGGGCAGGTGG - Intronic
1148921216 17:51036545-51036567 CTGTGTGTGGTAGGGGGAGAGGG - Intronic
1148949483 17:51297952-51297974 GTGTGTGTGTTGGGGGTGGAGGG - Intergenic
1149013509 17:51882454-51882476 GTATGGGTGTTGGGGGAGGATGG + Intronic
1149345355 17:55728796-55728818 GTGTGTGTGTAGGGGGTAGGGGG + Intronic
1149427560 17:56569808-56569830 ATGTGTGTGTTGGGGGATAGAGG + Intergenic
1149490740 17:57083669-57083691 CTTTGTTTTTTGGGGGAATAGGG - Intergenic
1149546434 17:57507165-57507187 CTGTGTGTGTTGGGGGGGGGGGG + Intronic
1149577533 17:57724864-57724886 CTGTGAGTGTCAGGGGTAGAGGG + Intergenic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1149951269 17:60989676-60989698 GTGTGTGTGTTGGGGGGCAAAGG + Intronic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150313061 17:64145425-64145447 GTGTGTGTGTTGGGGGGGGGCGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151446025 17:74164633-74164655 GTGTGTGTGTTGTGGGGGGATGG - Intergenic
1151506403 17:74530538-74530560 GTGTGTGTGTTGGGGGACCTGGG - Intronic
1152088115 17:78232377-78232399 CTGTCAGTTTTGGGGGAAGACGG - Intronic
1152421208 17:80194138-80194160 GTGTGTGTGTTGGGGGCAGGGGG - Intronic
1152449201 17:80365740-80365762 CTGTGTGGGTGTGGGGAAAAGGG - Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152857059 17:82671136-82671158 CTGTGTGTGTTGGAGTTACAGGG - Intronic
1152857075 17:82671248-82671270 CTGTGTGTGTTAGGGTTACAGGG - Intronic
1153073258 18:1131526-1131548 CTGTGTGTGTAGGAGGATGGAGG + Intergenic
1153762414 18:8344723-8344745 GTGTGAGTGTTGGGGGAGGGTGG + Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1154040675 18:10852766-10852788 GTGTGAGTGTTAGGTGAAGACGG - Intronic
1154080400 18:11250533-11250555 GTGTGTGTGTTAGGGGAAGTAGG - Intergenic
1154308049 18:13244689-13244711 GGGTGTGTCTTGGGGGAAGAGGG - Intronic
1155060425 18:22223511-22223533 CTGTGCGTGCTGGGGGAACAAGG + Intergenic
1155278694 18:24215863-24215885 ATGGGAGGGTTGGGGGAAGAGGG + Intronic
1155370045 18:25089329-25089351 TTGTGTGTATTGGGGGCAAAGGG - Intronic
1156055400 18:32997159-32997181 CTCTGTGTGTGGGGGTAGGATGG + Intronic
1156099846 18:33579365-33579387 GTGTGTGTGTTTGGTGAAGTTGG + Intronic
1156202751 18:34852881-34852903 GTGTGTGTGTTGGGGGCAGGAGG + Intronic
1156524420 18:37753185-37753207 GTGTGTGTGTTGGGGGAGGCGGG + Intergenic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1156789775 18:40956682-40956704 GTGTGTGTGTTGGGGGTGAAAGG + Intergenic
1157182983 18:45513903-45513925 CTCTGTGTGTTGGGTGGAGAAGG - Intronic
1157193442 18:45600365-45600387 GTGTGTGTGTTGGGGGGACCTGG - Intronic
1157234379 18:45950019-45950041 TTGAGTGTGTTATGGGAAGAGGG - Intronic
1157788521 18:50508439-50508461 TTGTGTCTTTTGGGGGAACATGG + Intergenic
1158051689 18:53228832-53228854 GAGTGTGTGTTAGGGGAATAGGG - Intronic
1158152660 18:54389991-54390013 CTGTGTGTGTCGGGGGGTGTGGG + Intergenic
1158518628 18:58151649-58151671 GTGTGTGTGTTGGCTGGAGAAGG + Intronic
1159532388 18:69670966-69670988 GTGTGTGTGTTGGGGGAGGGAGG - Intronic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160762338 19:791861-791883 CTGGGTGGGGTGGGGAAAGAGGG + Intergenic
1160910578 19:1472045-1472067 CAGGTTGTTTTGGGGGAAGAGGG + Exonic
1161249458 19:3272568-3272590 CTTTCTGTGTTGGTGGAAGTTGG + Intronic
1161670153 19:5602819-5602841 ATGTCTGTATTGGTGGAAGATGG - Intronic
1162145780 19:8611353-8611375 CTGAGTGGGTTGGGGGGAGGTGG + Intergenic
1162452350 19:10762801-10762823 CTGTGGCTGTTGGTGGAAAAGGG + Intronic
1162580727 19:11528773-11528795 CTGGGTCTCTTGGGGGAAAAAGG + Intronic
1162876153 19:13622474-13622496 CTCTGTGTCTTGGAGGAAAATGG + Intronic
1163688524 19:18725764-18725786 CAGGCTGTGTTGGGGGAAGGTGG - Intronic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1163736913 19:18987409-18987431 TTGTGTGTGTTGGGGGTTGGCGG + Intergenic
1163836809 19:19579937-19579959 CTGTGGATGGTGGGGGGAGATGG - Intronic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1165229486 19:34377915-34377937 CTGTGTGTGTTGGGGTGGGGAGG + Intronic
1165411549 19:35665509-35665531 ATGCGTGTGTTGGGGGGCGACGG + Intergenic
1165808767 19:38597604-38597626 GTGTGTATGTAGGGGGAAGCAGG + Intronic
1166199484 19:41227150-41227172 GTGTGTGTGCTGGGGGAGGGGGG + Intronic
1166283584 19:41810448-41810470 CTGTGTGTTTTGGGGGAAGGTGG - Intronic
1166354282 19:42217733-42217755 CTGCGCGAGTTGGGGGAAGGAGG - Intronic
1166367826 19:42286183-42286205 GTGTTTGTGGTGGGGGAGGAAGG + Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166783206 19:45352899-45352921 GTGTCTGAGTTGGGGGGAGAGGG + Intronic
1166803038 19:45469677-45469699 CTGTGTGTGCCTGGAGAAGAGGG - Intronic
1167036610 19:46998722-46998744 GTGTGGGCGTTGGGGGAAAAGGG + Intronic
1167112896 19:47472182-47472204 GTGTGTGTGTTGGGGGGCGGGGG - Intergenic
1167159811 19:47759967-47759989 GTGTGTGTGTTGGGGGCGGCGGG + Intergenic
1167250264 19:48395497-48395519 GTGTGTGTGTTGGGAGGTGAGGG + Intronic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
1167404411 19:49295081-49295103 TTGTGTGTGATGGGGTATGATGG - Intronic
1167495161 19:49813249-49813271 CTGTTTGAGTTGGGTGAAGAAGG - Exonic
1168012217 19:53542189-53542211 GTGTGTGTGTTGGGAGGGGAAGG + Intronic
1168193547 19:54757049-54757071 CTGTGTGTGCTGGGGTCACAGGG - Intronic
1168679947 19:58307623-58307645 GTGTGTGTGTTGGGGGGAGCGGG - Intronic
1168716653 19:58532502-58532524 CTTGCTGTGTTGGGGGAAGCTGG + Intronic
925055187 2:851804-851826 GTGTGTGTGTAGGGGCAAGGGGG + Intergenic
925059269 2:878574-878596 GTGTGTGTGTAGGGGCAAGAGGG - Intergenic
925090838 2:1154783-1154805 ATGTATGTGTTGGAGGTAGAAGG - Intronic
925293887 2:2765503-2765525 CTGTATCTGTGGGGAGAAGAGGG - Intergenic
925650550 2:6085236-6085258 ATGTGTGTGTTGGGGGAATGGGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926209132 2:10856128-10856150 GTGTGTGTGTTGGGGGGGGGTGG + Intergenic
926368207 2:12153091-12153113 CTGTGTGTGTTTGGGGATATGGG - Intergenic
926372691 2:12196444-12196466 GTGTGTGTGGTGGGGGTAGGAGG - Intergenic
926589993 2:14730275-14730297 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
926938194 2:18107255-18107277 CTGTGTGAGATTGAGGAAGAAGG + Intronic
927288832 2:21384702-21384724 CAATGTGTGTTGGGGGTAGGAGG + Intergenic
927322886 2:21768938-21768960 GTGTGTGTGTTTGGGGGAGCCGG + Intergenic
927445281 2:23155078-23155100 CAGTGTGTTTTGGGGAAAAAAGG + Intergenic
927633805 2:24796843-24796865 GTGTGTGTGTTGGGGGTGGGGGG + Intronic
927797414 2:26062361-26062383 TTGTGTTTGTTTGGGGAGGAGGG - Intronic
927834642 2:26383980-26384002 CTGTCTGGGTTGCGGGGAGAAGG + Intronic
928435795 2:31253730-31253752 GGGTGTGTCTTGTGGGAAGAAGG + Intronic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
928683492 2:33726529-33726551 TTGTGTGTGTTTGGGGGAGTGGG - Intergenic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929414041 2:41729512-41729534 GTGTGTGTGTTGGGGGGAGTAGG - Intergenic
929476632 2:42257126-42257148 GTGTGTGTGTTAGGGGATGGTGG + Intronic
929546568 2:42858638-42858660 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
929828768 2:45330817-45330839 CTGTGTGTGTTGGGGAGGAAAGG - Intergenic
930168074 2:48222818-48222840 CTGTCTGTTTTGTGGGAAGGTGG - Intergenic
930242380 2:48949288-48949310 CTATGTGAGTTGGAGGAGGATGG - Intergenic
930298204 2:49581506-49581528 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
930342505 2:50134674-50134696 GTATGTGTGATGGGGGAAGGAGG - Intronic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
931251867 2:60538777-60538799 GTGTGTGTAATGGGGAAAGAGGG + Intronic
931257686 2:60587721-60587743 CTCTGTGGGTTGTGGGTAGATGG + Intergenic
931414520 2:62068233-62068255 CTGTATGTGTTGAGGGGAGCAGG + Intronic
931668430 2:64626328-64626350 GTGTGTGTGTTTGGGGCAGCGGG + Intergenic
931757816 2:65389386-65389408 AAGGGTGTGTTGGGGGAGGAAGG + Intronic
931893106 2:66697137-66697159 CTTTGTGTGTTGCGGGGAGGGGG + Intergenic
931944351 2:67288414-67288436 GTGTCTGTGCTTGGGGAAGAAGG + Intergenic
931969447 2:67569367-67569389 GTGTGTGTGTTGGGGAATGGGGG + Intergenic
931986989 2:67751690-67751712 GTGTGTGTGTTCGGGCAAGGAGG + Intergenic
932030766 2:68182075-68182097 GTGTGTGTGGTGGGGGGAGGGGG - Intronic
932099186 2:68881031-68881053 CTGTGTGTGTTGGGGGGGTGTGG - Intergenic
932335738 2:70930486-70930508 AGGTGGCTGTTGGGGGAAGAGGG - Intronic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932481557 2:72042419-72042441 GTGTGTGTGGTGTGGTAAGAGGG + Intergenic
933006197 2:76998487-76998509 CTGTGTGTGTTGGGGAGGGGTGG - Intronic
933076310 2:77931716-77931738 CTGTGTGGGTTGGGTGATCATGG - Intergenic
933150682 2:78911308-78911330 GTGTGTGTGATGGGGGAAGGGGG - Intergenic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933299383 2:80525229-80525251 CTGTGTGTGTTGGGGAGGCAGGG - Intronic
933608268 2:84407052-84407074 GTGTGTGTGTTGGGGGAGGGGGG - Intergenic
933975422 2:87505399-87505421 CTGCCTGTGTTGGGAGAAGCAGG - Intergenic
934921482 2:98347845-98347867 GTGTATGTGTTGGGGGGAGGGGG - Intronic
934955456 2:98614079-98614101 ATGTGTGGGTTGGGGGCAAAAGG + Intronic
935062611 2:99621578-99621600 CTGAGTGTGGTGGGGACAGAAGG + Intronic
935383558 2:102478412-102478434 GTGTATGTGTTTGGTGAAGAGGG + Intronic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936318404 2:111445414-111445436 CTGCCTGTGTTGGGAGAAGCAGG + Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936743895 2:115549936-115549958 ATGTGTGTGATGTGGGAAAAAGG - Intronic
936878897 2:117225882-117225904 CTGTGTGGGGTGGGGGGAGTGGG - Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937087773 2:119182600-119182622 AAGTGTGTGTTGGGGGGAGCTGG - Intergenic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937345443 2:121122769-121122791 TTTTGTGTGTTGGGGGGTGAGGG + Intergenic
937485316 2:122309210-122309232 CTGTGTGTGTTTGTGGGTGAGGG - Intergenic
937506627 2:122544838-122544860 TTGTGTGAGTTGGGGAAAGAAGG + Intergenic
938403373 2:131012568-131012590 GTGTGTGTGTTGGGGGGTGGGGG + Intronic
938835601 2:135100520-135100542 CTGTGTGTTTTGGGACAAGGAGG + Intronic
939638758 2:144614049-144614071 CTCTGAGTGTTTGGGGCAGAAGG - Intergenic
940064684 2:149614162-149614184 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940264957 2:151827582-151827604 TTGTGTGTGTTGGGGGCAGGGGG - Intronic
941196399 2:162458125-162458147 GTGTGTGTGTTGGGTGGAGTAGG + Intronic
941225189 2:162839050-162839072 GTGTGTGTGTTAGGGGGAGAGGG - Intergenic
941296938 2:163750460-163750482 CTGTGTGTGTTGGAGTAAAAAGG - Intergenic
941551967 2:166927789-166927811 ATGTGTGTGTGGGGGGATGGAGG + Intronic
942137891 2:172946709-172946731 AGGTTTGTGTTGGGGGAAGAAGG - Intronic
942264724 2:174211168-174211190 GTGTGTGTGTTGTGGGGAGGAGG - Intronic
942414678 2:175746407-175746429 CTGGGGGTGTTGGGGGGAGGGGG - Intergenic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
942655176 2:178207716-178207738 CTGTGTTTGTCTGGGGAGGAGGG + Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943394441 2:187315596-187315618 GTGTGTGTGGTGGGGCGAGAGGG - Intergenic
943648618 2:190432817-190432839 GTGTGTGTGTTGGGGGGCGGGGG - Intronic
944014051 2:195010882-195010904 CTGTGTGTGTTGCGTGGAGTCGG - Intergenic
944312820 2:198253573-198253595 GTGTGTGTGTTGGGGGTGGTGGG + Intronic
944360865 2:198854816-198854838 TTGTATGTGTTTGGGGCAGAGGG - Intergenic
945052959 2:205842932-205842954 GTGTGTGTGTTAGGGGTAAAGGG - Intergenic
945381915 2:209150342-209150364 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
945406649 2:209456952-209456974 GTGTGTGTGTTGGAAGAAGTGGG - Intronic
945549349 2:211200248-211200270 GTGTGTGTGTTAAGGGAATAGGG - Intergenic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
945877358 2:215292450-215292472 GTGTGTGTGTTGGGGGAATTTGG - Intergenic
946044998 2:216813542-216813564 CAGTGTCTTTTGGGGGAATACGG + Intergenic
946092623 2:217243497-217243519 GTGTGTGTGTTGGGGAAAGGGGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946310460 2:218880199-218880221 GTGTGTGTGTTGGGGTGGGATGG + Intergenic
946476071 2:220007652-220007674 CTGTGTCTTTTGGTGGCAGAAGG + Intergenic
946586118 2:221189690-221189712 CTGTGTGTGTTTGGGGGGCAGGG - Intergenic
946611181 2:221459538-221459560 GTGTGTGTGTTGGGAGAAGGGGG - Intronic
947817724 2:233049123-233049145 CTGGGTGTGGCGGGAGAAGAAGG + Intergenic
947866193 2:233399518-233399540 CTGCCTGTGGTGGGGGAAGGGGG + Intronic
948002321 2:234578346-234578368 GTGTGTGTTTTGGGGGAGGAGGG - Intergenic
948016992 2:234699194-234699216 CTTTTGGGGTTGGGGGAAGAAGG + Intergenic
1168851739 20:981697-981719 ATGTGTGTGTTTGGGGGACAGGG + Intronic
1168997404 20:2143680-2143702 CTGTGTGTGCTGGGGGCTGTGGG - Intronic
1169018329 20:2309846-2309868 ATGTGTGTGTTTGGGCAAGGAGG - Intronic
1169241017 20:3980957-3980979 GTGTGTGTGTTGGGGGGGGCAGG + Intronic
1169529315 20:6467127-6467149 CTTTGTGTCTTGTGGGAAGCAGG + Intergenic
1169636869 20:7702101-7702123 ATGTGTGTGTTGGCAGGAGAGGG + Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1170342661 20:15346591-15346613 ATGTGTGTGCCGGGGGAAGGAGG + Intronic
1170784054 20:19452416-19452438 GTGTGTGTGTTGGGGAAGTAAGG + Intronic
1171963653 20:31513978-31514000 CAGTGTGTGTGGGGGGACGTTGG - Intergenic
1172441231 20:34967994-34968016 CTGTGGGTGTTGGGGTACTATGG - Intergenic
1172632312 20:36386581-36386603 CTTTTTGGGTTGGGGGAAGGGGG + Intronic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1172946105 20:38690678-38690700 GTGTGTGTGTTGGGGGGAGGGGG + Intergenic
1173290801 20:41713315-41713337 GTGTGTGTGTCTTGGGAAGAAGG - Intergenic
1173364759 20:42375144-42375166 GTGTGTGTGTCGGGGGGACAGGG + Intronic
1173501523 20:43557739-43557761 CTATGTGTGTTGGTGGAGGTGGG + Intronic
1173617461 20:44412494-44412516 CAGAGTGTGTAGGGGGAAGCCGG + Intronic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1173667040 20:44770462-44770484 CTGTGTGTATTGGGGGAAACTGG + Intronic
1173674026 20:44818219-44818241 ATGTGTGTGTTGGATGAAGGTGG - Intergenic
1174216272 20:48918968-48918990 GTGTGTGTGTTGGGGGGAGTGGG + Intergenic
1174452937 20:50630922-50630944 CTGTAGGTGTTGGTGGAAGGTGG - Intronic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174677556 20:52373055-52373077 CAGAGTGTGTGAGGGGAAGAGGG - Intergenic
1174829516 20:53799776-53799798 GTGTGTGTGTTGGGGGAGGGAGG - Intergenic
1174918614 20:54678901-54678923 TTTTATGTGTTGGGGAAAGAGGG + Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175514023 20:59557329-59557351 CACTGTGTGTTGGGGGCAGGGGG + Intergenic
1175749223 20:61483688-61483710 GTGTGTGTGTTGGGGGCAGCGGG - Intronic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1176180900 20:63748870-63748892 ATGTGTGTCATGGCGGAAGACGG + Intronic
1176263527 20:64196246-64196268 CATTGTGTGGTGGGGGCAGAAGG + Intronic
1176316377 21:5248479-5248501 TGTTGTGGGTTGGGGGAAGAGGG - Intergenic
1176372872 21:6073143-6073165 GTGTGTGTGTTGGGGGGGGGTGG - Intergenic
1176415448 21:6471982-6472004 CTGAGTGTGTTGGTGGGAGACGG + Intergenic
1177686533 21:24444172-24444194 GTGTGTGTGGCGGGGGAGGAGGG + Intergenic
1177792787 21:25738225-25738247 ATGTGTGTGTTGGGGGCAGGGGG - Intronic
1178704835 21:34864574-34864596 CTGTGTGTGCTGCTGGAAGTCGG + Intronic
1178729155 21:35083111-35083133 GTGTGTGTGTTGGGGAGAGCAGG + Intronic
1178753797 21:35328623-35328645 CTGTGGGAGTTGGGGGTTGAGGG + Intronic
1179381224 21:40901123-40901145 CTGTGTGTGTTGTGGGGGGGGGG - Intergenic
1179409417 21:41150921-41150943 GTGTGTGTGATGGGGGAGAATGG + Intergenic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179560176 21:42210795-42210817 CTGTGTGTGCTTGGTGAAGAAGG + Intronic
1179690948 21:43080315-43080337 CTGAGTGTGTTGGTGGGAGACGG + Intergenic
1179750605 21:43465100-43465122 GTGTGTGTGTTGGGGGGGGGTGG + Intergenic
1180053151 21:45342835-45342857 GTGTGTGTGTTGCGGGTAGGGGG + Intergenic
1180158718 21:45989740-45989762 CTGGGTGTGTAGGGAGAAAAAGG + Exonic
1180488007 22:15819165-15819187 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1180755932 22:18161208-18161230 GTGTGAGTGTTGGTGGAAGGAGG - Intronic
1181075836 22:20376195-20376217 GTGTGAGTGTTGGTGGAAGGAGG + Intronic
1181322749 22:22021264-22021286 CTCTGTCTGTTGGGGGGAGATGG - Intergenic
1181362765 22:22351371-22351393 CTCTGCCTGTTGGGAGAAGATGG - Intergenic
1181365526 22:22374153-22374175 CTCTGCCTGTTGGGAGAAGATGG - Intergenic
1181644954 22:24226112-24226134 GTGTCTGTGCTGGGGGAGGATGG - Exonic
1182012663 22:27013749-27013771 GTGTGTGTGTTGGGGAATGAGGG + Intergenic
1182028073 22:27135976-27135998 CTGGGTAGGTTGGGGGCAGAAGG + Intergenic
1182453488 22:30434949-30434971 CTGTGTGTGTTGGGGGTGTGAGG + Intergenic
1182712421 22:32331230-32331252 GTGTGTGTGTTGGGGCACCAAGG + Intergenic
1182960666 22:34471621-34471643 TTGTGTGTGTTGGGGGGAGTGGG + Intergenic
1183131479 22:35840648-35840670 GTGTGTGTGTAGGGGGGAGGAGG + Intronic
1183139980 22:35928240-35928262 CTGTGTCTGTTGGGGGGGCAGGG + Intronic
1183357829 22:37368936-37368958 CTGTGTGGGATGGGGGGACAGGG - Exonic
1183501132 22:38180101-38180123 GTGTGTGTGCTGGGGGAAGTAGG - Intronic
1183519009 22:38285495-38285517 CTGTGTGTGTATGGGGGAGCGGG + Intergenic
1183995307 22:41628605-41628627 CTGCCTGTGGTTGGGGAAGATGG + Intronic
1184096096 22:42317370-42317392 ATGTGTGTGGTGGGGAAGGAGGG + Intronic
1184310115 22:43635798-43635820 TTGGGTATGTTGGGGGCAGAGGG + Intronic
1184399668 22:44266599-44266621 GTGTGTGTGTTGGGGGGCCAGGG + Intronic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184742115 22:46434579-46434601 ATGTGTGTGATGGTGGAGGATGG - Intronic
1184796255 22:46735064-46735086 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
1184958944 22:47914799-47914821 GTGTGTGTGTTGGGGGCGGGGGG + Intergenic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
949096094 3:87577-87599 TTGTGTGTGTGGGGGGACGCGGG + Intergenic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
949608068 3:5676082-5676104 GTGTGTGTGGTGGGGGGAGGTGG - Intergenic
949614822 3:5741625-5741647 GGGTGTGTGTTGGGGGATGGAGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949926103 3:9043069-9043091 GTGTGTGTGTTTGGGAGAGATGG - Intronic
950335848 3:12192308-12192330 TTATGTGTGTTGTGGGAGGAGGG - Intergenic
950428740 3:12938824-12938846 CTGTGTGTGTTGGGGGCGAAGGG + Intronic
950545700 3:13636788-13636810 ATGTGTGTGTATGAGGAAGAGGG - Intronic
950558298 3:13708001-13708023 TTGTGTGTGGTGGGGGCACATGG + Intergenic
950707112 3:14789723-14789745 CTGTCTGTCTGGGGGCAAGACGG + Intergenic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
951955003 3:28243799-28243821 GTGTCTGTGTAGGGGGAAAAGGG - Intronic
952075654 3:29694145-29694167 GTTTGTGTGTTGAGGGAAGGGGG + Intronic
952124841 3:30288635-30288657 GTGTGTGTGTTGTGGGGCGATGG + Intergenic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
952986385 3:38788610-38788632 GTGTGTGTGTTGGGGGGGGGTGG + Intronic
953138288 3:40202860-40202882 ATATGAGTGGTGGGGGAAGAAGG - Intronic
953567724 3:44047488-44047510 ATGTCTGTGGTGGGGGTAGAGGG - Intergenic
953606425 3:44415887-44415909 CTCAGACTGTTGGGGGAAGATGG - Intergenic
953713909 3:45299264-45299286 TTGTGTGTGTTGGAGGCAGGGGG - Intergenic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
954424089 3:50434286-50434308 GTGTGTGTTTTGGGGGCAGGGGG - Intronic
954574145 3:51665816-51665838 GTGTGTGTGTTGTCGGGAGAAGG + Exonic
954633702 3:52060150-52060172 ATGTGTGTGTTGGGGGGAAGGGG - Intergenic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
955108241 3:55921320-55921342 GTGTTGGTGTTTGGGGAAGAGGG + Intronic
955156820 3:56425199-56425221 GTGTGTGTTTTGTGGGGAGATGG - Intronic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955286094 3:57643408-57643430 GTGTGTGTGTTGTGGGGGGAGGG - Intronic
955588685 3:60510709-60510731 TTGTGTGTGTGGGGGGAGGTGGG - Intronic
955755111 3:62218275-62218297 CTGTGTCTGTTAGGGAAAGGTGG + Intronic
955784933 3:62527439-62527461 CTGTGTGTGCTGGGGGTGGGGGG + Intronic
955818275 3:62870641-62870663 CTGTGCATGATGGGGGAAAAGGG - Intronic
956167722 3:66408954-66408976 GTGTGTGTGGTGGGGGGAGGGGG + Intronic
956369202 3:68539712-68539734 ATGTGTGTGGTGGGGGGAGGGGG + Intronic
956487974 3:69741179-69741201 TTGTGTGTGTTGGGGGCTGGGGG + Intronic
956728218 3:72174121-72174143 CTGTGTATGTTGGAGAGAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959055326 3:101562029-101562051 ATGTGTGTGTTGGGGGTGGGAGG + Intronic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
959908772 3:111739488-111739510 CTGTGTGTGTTTGGAGGAGGAGG + Intronic
960368532 3:116805682-116805704 CTGTGTGTGTATGGGGATGGGGG - Intronic
960987926 3:123292532-123292554 CTGTGGGTGGTGGTGGAAGGCGG - Intronic
961110151 3:124276918-124276940 GTGCGTGTGTTGGGAGAAGAGGG - Intronic
961385909 3:126523541-126523563 GTGTGTGTGTTGGGGGGTGGAGG - Intergenic
961418774 3:126782830-126782852 ATGTGTGTTTTGGGGGTGGAGGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961559808 3:127720845-127720867 CTTTTTGTCTTGGGGGAAAATGG + Intronic
961747146 3:129071531-129071553 GTGTCTGTGTTGGGGGGTGAGGG - Intergenic
962690388 3:137890952-137890974 GTGTGTGTGTTGGGGAAGGCTGG + Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962776660 3:138667422-138667444 GTGTGTGTGTTGTGGGGAGGAGG + Intronic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
963116499 3:141734701-141734723 GTGTGTGTGTTGGGGGAGTGGGG + Intergenic
963211486 3:142697254-142697276 CTGTTTGTGTTCGGGAATGAGGG - Intronic
963287159 3:143444489-143444511 ACGTGTGTGTTGGGGAAAGGTGG - Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
964187652 3:153965884-153965906 CTGTGTGGGGTGGGGGAAGGGGG + Intergenic
964297970 3:155254595-155254617 CTGAGAGTGTGGGTGGAAGAAGG - Intergenic
964542558 3:157795839-157795861 CTCTGTGTGTTGGGTGATGGAGG + Intergenic
964858210 3:161170547-161170569 CTGTGTGTGATGGGGTGACACGG + Intronic
965370473 3:167855935-167855957 GTGTGTGTGTTGGGGGCGGCAGG - Intergenic
965419214 3:168436406-168436428 GTATGTGTGTTGAGGGAGGAAGG - Intergenic
965440033 3:168700836-168700858 TTGTGAGAGTTGGGGGAACACGG - Intergenic
965727530 3:171734685-171734707 CTGTATGGCTTGGGGAAAGAAGG + Intronic
966224379 3:177582275-177582297 GTGTGTGAGTTGGGGGAACCTGG + Intergenic
966440597 3:179940376-179940398 CTGTGTGTGTTGGGGGGCGCTGG + Intronic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
967439723 3:189492527-189492549 CTGTGTGTGTTTGGGATACAGGG - Intergenic
967479503 3:189957471-189957493 GTGTGTGTGTTTGGGGGAGGAGG + Exonic
967513955 3:190345085-190345107 GTGTGTGTGTTAGGTGGAGAGGG - Intronic
968422302 4:496144-496166 TTTTGTGTGTGGGGGGTAGACGG + Intronic
968539137 4:1154194-1154216 CTGGGTATGTTGGGGGAGGCTGG + Intergenic
968539165 4:1154290-1154312 TTGGGTGTGTTGGGGGAGGCCGG + Intergenic
969067975 4:4505074-4505096 CTGGGGGTGTTGGGGGAAATGGG - Intronic
969462467 4:7335998-7336020 CTTTGTGACTTGGGGGATGATGG + Intronic
969867148 4:10083505-10083527 CTTTATGTTTTGGGGGCAGAGGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
970466286 4:16326259-16326281 CTGTGTGTGTTAGTGGACAAAGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970769987 4:19600747-19600769 CTATGTGTGTTGTGGGGATAGGG + Intergenic
971026164 4:22589927-22589949 TTGTGTGTGTTGTGTGATGAGGG - Intergenic
971124568 4:23739308-23739330 ATGTGTATGTTGTGGGAAGGAGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971504887 4:27355707-27355729 GTGTGTGTGTTGCGGGGGGAGGG + Intergenic
972216898 4:36907467-36907489 CACTGTGTGTTGGGAGCAGAGGG - Intergenic
972311962 4:37890744-37890766 CAGTGTCTGTGGGGGGAATAGGG - Intergenic
972691500 4:41403202-41403224 CTGGGGGTGGTGGGGGAAGATGG + Intronic
972782969 4:42301828-42301850 GTGTGTGTGTTGGGGTAGGGGGG - Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973605453 4:52582895-52582917 CAGTGTGTGTTGGGGGCACAGGG + Intergenic
974069951 4:57114279-57114301 CTGTGTGTGTGGGGGGGTGGGGG + Intergenic
974566413 4:63582256-63582278 GTGTGTGTGTTGGGGGGGGCAGG + Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975044369 4:69783518-69783540 GTGTGTGTCTTGGGGGGTGAAGG + Intronic
975448913 4:74501307-74501329 CTATGTGTGTGAGGGGAAAAGGG + Intergenic
975651851 4:76601252-76601274 CTGTGTGTGGTGTGGGGAGGGGG + Intronic
975752681 4:77539848-77539870 GTGTGTGTGGTGGGGGTAGGGGG + Intronic
975814283 4:78201827-78201849 CAGTGTGAGTTGGGAGAAAAGGG + Intronic
975944203 4:79684940-79684962 CAATGTGTGTTGGGGGTGGAGGG - Intergenic
976113664 4:81703441-81703463 CTGTGAGTGTTGGGAGCCGAAGG - Intronic
976114261 4:81710204-81710226 GTGTGTGTGTTGGGGGGTGAGGG - Intronic
976484075 4:85580126-85580148 GTGTGTGTGGTGGGGGGGGAGGG + Intronic
976959986 4:90958529-90958551 CTGTGTGTTTTGGGTCGAGAAGG + Intronic
977047861 4:92090146-92090168 GTGTGTGTGTTGGGGGGGGGGGG - Intergenic
977227131 4:94405988-94406010 GTGTGTGTGATGGGGGAGGATGG - Intergenic
978013482 4:103716247-103716269 GTGTGTGTGTTGGAGGTATAGGG + Intronic
978618544 4:110618764-110618786 GCGTGTGTGTCGGGGGAAGGCGG - Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978937166 4:114391800-114391822 GTGTTTGTGTTGGGGGAAGCAGG - Intergenic
979418944 4:120479332-120479354 TGTTGTGTGGTGGGGGAAGAGGG + Intergenic
979615106 4:122733364-122733386 GTGTGTGTGTTGGGGTTGGAGGG - Intronic
979747717 4:124238672-124238694 CCGTGTGTGTTGCGGGGACAGGG + Intergenic
979988877 4:127350409-127350431 CTGTGTCTTTTGTGGGAACATGG + Intergenic
980196649 4:129597412-129597434 TTATGTGTGTTTGGGGAGGAGGG - Intergenic
980825833 4:138071411-138071433 GCGTGTGGGTTGGGGGAAGGGGG + Intergenic
981309748 4:143285642-143285664 CTGTATGGGGTGGGGGAAGAGGG - Intergenic
981670778 4:147284792-147284814 TTGTGTATTTTGGGGGTAGAGGG - Intergenic
981784357 4:148461176-148461198 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
982037559 4:151361422-151361444 GTGTGTGTGTTGGGGGTGGGGGG + Intergenic
982533049 4:156571734-156571756 TTGTGTGTGTTGGGGGGTGGTGG + Intergenic
982926531 4:161343862-161343884 TTGTGTGTGTTGGGGGACAGAGG + Intergenic
982956905 4:161781644-161781666 CTGCATGTGTTGGGGAAAAAGGG - Intronic
983055913 4:163098734-163098756 CTATGTGTTTTGGGAGATGAGGG + Intergenic
983897789 4:173100088-173100110 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
984136645 4:175948985-175949007 GTGTGTGTGTTGGGGGGATGTGG + Intronic
984642913 4:182189737-182189759 GTGTGTGTGTTGGGGGTGGTGGG + Intronic
984837748 4:184038272-184038294 CTGTGTGTATACGGGAAAGATGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985173600 4:187177573-187177595 CTGTGTGTGGTGGGGGAAGTTGG - Intergenic
985553698 5:545916-545938 CTCTTTGTGGAGGGGGAAGAGGG + Intergenic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
985776045 5:1842880-1842902 CGGTGTGTGTTGGGGGTGGGTGG + Intergenic
985776069 5:1842996-1843018 CGGTGTGTGTTGGGGGTGGGTGG + Intergenic
986189591 5:5482763-5482785 GTGTGTGTGTTGGGGGGTGGGGG - Intronic
986293235 5:6417112-6417134 CTGTGTGTTTTGGGTGAACTGGG - Intergenic
986360894 5:6976906-6976928 GTGTGTGTGTTGGGAGAAAAAGG + Intergenic
986615701 5:9615159-9615181 CTGTGTGTGTTCTGGGCAAAGGG + Intergenic
986671548 5:10147140-10147162 CTGTGTGGGGTAGGGGAATATGG - Intergenic
986739779 5:10695908-10695930 CTGAGTGTGTTGGGTGAATAGGG + Intronic
986811507 5:11364717-11364739 CGGTGTGTGCTGGCGGCAGAGGG + Exonic
986898795 5:12406008-12406030 GTGTGAGGGTAGGGGGAAGATGG - Intergenic
987059665 5:14230366-14230388 GTGTGTGTGTTGGGTGATGAGGG + Intronic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987870232 5:23607945-23607967 GTGTGTGTGTTGGAGGAGGTGGG - Intergenic
987995034 5:25265259-25265281 GTGTATGTGTTGGGGAAGGATGG - Intergenic
988282748 5:29171786-29171808 GTGTCTGTGTTGGGGGATGGGGG + Intergenic
988446217 5:31288946-31288968 TTGTTTTTGTTGGGGGGAGAGGG + Intronic
989033987 5:37150499-37150521 GCGTGTGTGTTGGGGGAGGGAGG - Intronic
989701006 5:44264929-44264951 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
990325383 5:54670514-54670536 ATGTTTGTGTTGGGGCATGATGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990562262 5:56995201-56995223 CTGTGTGTGTTGGAAGTAGGAGG + Intergenic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
991570794 5:68051323-68051345 CTGTGTGTGTCGGGAGTAGGCGG - Intergenic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
991680517 5:69134877-69134899 CGGGGTGGGTTGGGGGAAGAGGG + Intergenic
991778748 5:70111792-70111814 TTGTGTGTGTTGGGGGTGGGGGG + Intergenic
991858039 5:70987259-70987281 TTGTGTGTGTTGGGGGTGGGGGG + Intronic
991871197 5:71112145-71112167 TTGTGTGTGTTGGGGGTGGGGGG + Intergenic
991947620 5:71915006-71915028 CTGTGTGGGTGGGCGGAAGGTGG + Intergenic
991959005 5:72022879-72022901 GTGTGTGTGTTGGAGGAAGAGGG - Intergenic
992103826 5:73433755-73433777 CTGTTTCTGTTGAGGGAAGGAGG + Intergenic
992122635 5:73610441-73610463 CTGTGTGTGTTTGGGGAGATGGG + Intergenic
992443459 5:76814455-76814477 GTGTGTGTGGATGGGGAAGAGGG + Intergenic
993075080 5:83219297-83219319 TTGGGTGTGTTGGGGGGTGAGGG + Intronic
993503032 5:88683340-88683362 GTGTGTGTGTAGGGAGAAGTAGG + Intergenic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993968309 5:94385896-94385918 GTGTGTGTATTGGGGGATGGGGG + Intronic
994041847 5:95267827-95267849 GTGTGTGTGTTGGGGGAGATGGG - Intronic
994140042 5:96332154-96332176 TTGTTTGTTTTGGGAGAAGAAGG - Intergenic
994148668 5:96423072-96423094 GTATATGTGTTGGGAGAAGAAGG - Intronic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994685974 5:102952865-102952887 ATGTGTGGGTTGGAGGTAGATGG - Intronic
995284946 5:110377510-110377532 TTGTGTGTGTTTGGGGAAAACGG - Intronic
995337636 5:111019306-111019328 GTGTGTGTGTTGGGGGATGTGGG - Intergenic
995706335 5:114992246-114992268 CTCTCTGTGATGGGGGAAAATGG + Intergenic
995870610 5:116739917-116739939 GTGTGTGTGCCAGGGGAAGAGGG + Intergenic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
996260014 5:121455643-121455665 CTGGTAGTGTTGGGGGAAGGTGG - Intergenic
996277330 5:121682795-121682817 CTGTGTGTGGTAGGGGCAGGAGG + Intergenic
996313682 5:122137181-122137203 GTGTGTGTGTTTGGGACAGAGGG + Intronic
996339388 5:122419185-122419207 CTGGATGTGTTAGGGGAAAAGGG + Intronic
996361692 5:122655136-122655158 GTCTGTGTGTTAGTGGAAGAGGG + Intergenic
996421235 5:123265206-123265228 TTGCATTTGTTGGGGGAAGAGGG - Intergenic
996537007 5:124587985-124588007 GTGTGCATGCTGGGGGAAGATGG - Intergenic
996650931 5:125874964-125874986 CTGTGAGTGTTGGCTGATGATGG - Intergenic
997434628 5:133865440-133865462 CTGTGAGAGGTGGGGGAAGGTGG + Intergenic
997500698 5:134371377-134371399 GTGTGAGTGCTGGGGGAGGAGGG - Exonic
997525563 5:134550934-134550956 TTGTGTGTGTTGGGGAAGGGGGG - Intronic
997631164 5:135369847-135369869 TTGGGAGTGTTGGGGGAAGCAGG - Intronic
997652592 5:135533620-135533642 GTGTGTGTGTTGGGGGGATGGGG + Intergenic
997844330 5:137272737-137272759 GTGTGTGTGTTGGGGGGTGGGGG - Intronic
997875554 5:137543651-137543673 CTGTGTGTGTAAGGAGAGGAGGG + Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998156598 5:139790271-139790293 CAGTGTGGGTTGGGTTAAGATGG + Intergenic
998298239 5:140992668-140992690 ATGTGTGTGTTAGGGGTTGAGGG + Intronic
998480268 5:142457450-142457472 CTGTGTGACTTTGTGGAAGAAGG - Intergenic
998502326 5:142644419-142644441 ATGTGTGTGGTGGGGAATGAGGG - Intronic
998700840 5:144697881-144697903 CTGTGTGGCTTAGGGGAAGATGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999030883 5:148289923-148289945 GTATGTGTGTTGGGGGAGGGGGG - Intergenic
999298791 5:150477469-150477491 GTGTGTGTGTTGGGGGAGGGAGG + Intergenic
999299969 5:150485369-150485391 AGGTGTGTGTTGGGGGAGGGAGG + Intergenic
999304760 5:150512240-150512262 GTGTGTGTGTTGGGGGGGCAGGG + Intronic
999385405 5:151150719-151150741 CAGTGTGTGGTGGGGGGAGGAGG + Intronic
999492506 5:152064922-152064944 TCGTGCATGTTGGGGGAAGATGG + Intergenic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
1000116024 5:158154167-158154189 GTGTGTGTGTTGGGGGGTGGGGG - Intergenic
1000129629 5:158283686-158283708 GTGTATGTGGTGGGGGAAGGGGG + Intergenic
1000346138 5:160315306-160315328 GTGTGTGTGTTGGGGGGCGGGGG - Intronic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1000879685 5:166682898-166682920 CTGTATATGTTGTGGGGAGAGGG + Intergenic
1001229601 5:169974832-169974854 GTGTGTGTGTCGGGGGGAGGGGG - Intronic
1001414554 5:171535800-171535822 CTGAGTGAGTCAGGGGAAGAAGG + Intergenic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002624798 5:180518495-180518517 TTGTGTGTGTGGGGGGGAGGAGG + Intronic
1002885080 6:1286307-1286329 GTGTGTGTGGTGGGGTAAGGGGG + Intergenic
1003285336 6:4729165-4729187 GTTTGTGTGTTTGGAGAAGAGGG - Intronic
1003572920 6:7267766-7267788 GTGTGTGTGTTGGGGGCGGGTGG - Intergenic
1003874440 6:10423625-10423647 GTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1004415221 6:15417146-15417168 GTGGGTGAGTAGGGGGAAGAGGG + Intronic
1004453765 6:15771891-15771913 CTGTGTGTCTTGGGGCATGGTGG + Intergenic
1004846242 6:19645644-19645666 CTGTGTGTGTTGGTTGGAGGAGG - Intergenic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1005611016 6:27525238-27525260 GTGTGTGTGTTGGAGGTAGAGGG + Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006224295 6:32522888-32522910 CTGTGTCTGTTTGGGCAAAACGG + Intronic
1006299258 6:33185157-33185179 CTGTCTGTGCTGGGGGATGGGGG + Intronic
1006405075 6:33840338-33840360 CTCTGTGTGTGCGTGGAAGAGGG - Intergenic
1006783684 6:36650342-36650364 CAGTGTGTTGTAGGGGAAGAAGG - Intergenic
1007048828 6:38804899-38804921 GTGTGTGTGTTGGGGGTGGCCGG + Intronic
1007053036 6:38852379-38852401 CTGTATCTGTCGGGGGAGGAGGG + Intronic
1007091567 6:39187957-39187979 CTGTGTGTGATGGCAGGAGAGGG + Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007214421 6:40226298-40226320 CTGTGTATATTGGGAGAAGCGGG + Intergenic
1007236864 6:40396754-40396776 GTGTGTGTGTTGGCGGTAGGAGG + Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007475052 6:42114050-42114072 TGGTGTGTGTGGGAGGAAGACGG + Intronic
1007592037 6:43027713-43027735 GTGTGTGTGTTGGGGGGGGGGGG - Intronic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1007900137 6:45403763-45403785 ATGTGTGACTTGGGGGAAGAGGG + Intronic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008014484 6:46502955-46502977 GTGTGTGTGTTAGGGGAGGGAGG - Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008129303 6:47702250-47702272 GTGTGTGTGTTGGGGGGAGTTGG + Intronic
1008498660 6:52157736-52157758 CTGTGTTCTTTGGGGGAAGTAGG - Intergenic
1008868909 6:56248245-56248267 TTGTGTGTGTTGGGGTAGGAGGG - Intronic
1009502076 6:64426361-64426383 CTGTGTCAGTTGTGGGAACATGG + Intronic
1009569131 6:65358630-65358652 GTGTGTGTGTTGGGAGAAGGGGG + Intronic
1009569948 6:65371771-65371793 GTGTGTGTAATGGGGGAAGTGGG + Intronic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1010564116 6:77387723-77387745 CTGTGTGTGTTGGGGCGGGGGGG + Intergenic
1010731595 6:79396987-79397009 CTGTGTGTGTAAGGAGAAGAGGG + Intergenic
1011218682 6:85032071-85032093 CTGTGAGTGTTAGGGGAGGAGGG - Intergenic
1011543581 6:88460150-88460172 CATTGTGTGTTAGGGGAAAATGG + Intergenic
1013067535 6:106698379-106698401 GTGTGTGTGTTGGTGGGAGTGGG - Intergenic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1013947667 6:115741371-115741393 TTGTGTGTATTGGGTTAAGAAGG - Intergenic
1014056920 6:117026511-117026533 GTGTTTTTGTTTGGGGAAGAGGG + Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1014289556 6:119542087-119542109 TTGTGTGTTTTAGGGAAAGATGG - Intergenic
1014564586 6:122932065-122932087 GTGTGTGTGTTGTGGTGAGAGGG + Intergenic
1014637807 6:123870271-123870293 TGGTGTGTGTTGGGGGGAGTTGG + Intronic
1015102390 6:129496627-129496649 TTGTGTGTGTAGGGGGAAAAGGG + Intronic
1015133628 6:129842229-129842251 ATGTGTGTGTTTTGGGTAGAGGG - Intronic
1015855400 6:137618782-137618804 GTGTGTGTGTTGGGGGTGGGGGG - Intergenic
1016050809 6:139528089-139528111 ATGTATGTGTGGGGGGAAGGAGG + Intergenic
1016678468 6:146799716-146799738 ATGTGTGTGTAGGAGGAAGGGGG + Intronic
1016726446 6:147374894-147374916 GTGTGTGTGGTGGGGGGAGGTGG - Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017090300 6:150753301-150753323 GTGTGTGTGTTGGGAGAGGCAGG + Intronic
1017406950 6:154129839-154129861 GTGTGTGTGCTGGGGGGGGAGGG - Intronic
1017590835 6:155976498-155976520 CAGTGTGTATTCTGGGAAGAGGG - Intergenic
1017650529 6:156577400-156577422 CTGTGTGTGATGGGGGGAAAGGG + Intergenic
1018153722 6:160965507-160965529 CTTGGGGGGTTGGGGGAAGATGG - Intergenic
1018245187 6:161815763-161815785 GTCTGTGTGTAGGGGGAAGACGG + Intronic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018980630 6:168599077-168599099 CGGTGTGTGTTGGGGGAAGTGGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019390628 7:784567-784589 GTGTGTGTGATGGGGGCAGTGGG - Intronic
1019463210 7:1172444-1172466 CTGAGTGAGTAGGGGGAAGCTGG - Intergenic
1019670952 7:2278063-2278085 GTGTGTGTGTCGGGGCAGGAGGG - Intronic
1019705690 7:2496161-2496183 TTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1020106788 7:5425909-5425931 CTGTGTGCCTTAGGGGAGGAGGG + Intergenic
1020168098 7:5823652-5823674 CTGGGTCTCTAGGGGGAAGAAGG + Intergenic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021026016 7:15667604-15667626 GTGTGTGTGTTGGGGGACCTAGG + Intronic
1021085182 7:16414338-16414360 GTGTGTGTGTTGGGGTAGGGGGG - Intronic
1021168135 7:17365567-17365589 GTGTGTGTGTTGGGGGCAGAAGG - Intergenic
1021270416 7:18577963-18577985 ATGTGTGTGTTTTGGGGAGAGGG - Intronic
1021287978 7:18805927-18805949 CTCTGTGTGTTGGGGAGAGGAGG - Intronic
1022030606 7:26488460-26488482 CTGGGTGGGTTGGGGGAAGAAGG + Intergenic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022420825 7:30221750-30221772 CTGTGCATGGTGGGGGTAGAGGG + Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023260208 7:38350463-38350485 GTGTGTGTGTTGGGGGGGCAGGG + Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024239434 7:47422996-47423018 CCGGGTGTGTTGGAGGAACATGG - Intronic
1024337072 7:48219871-48219893 GTGTGTGTGTTTGGGGAAGGTGG - Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1026390697 7:69898648-69898670 CTGTGTGTGGTTGGGGATGAGGG - Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027113220 7:75457379-75457401 TTGTGGGGGTTGGGGGATGAAGG - Intronic
1027241192 7:76330353-76330375 TTGTGTGGGCTGGGGGAAGGGGG + Intronic
1027259916 7:76457450-76457472 CTGTGTATGTTGTGGGGAGTGGG + Intergenic
1027282556 7:76619440-76619462 CTGTGTATGTTGTGGGGAGTGGG - Intronic
1027285470 7:76641974-76641996 TTGTGGGGGTTGGGGGATGAAGG - Intergenic
1027311288 7:76955554-76955576 CTGTGTATGTTGTGGGGAGTGGG + Intergenic
1027731339 7:81877236-81877258 CTGGGAGAATTGGGGGAAGAGGG + Intergenic
1027744597 7:82057437-82057459 GTGTATGTGTTGGGGGAAAGGGG + Intronic
1027828083 7:83142033-83142055 GTGTGTGTGTCGGGGGGAGGGGG - Intronic
1027989984 7:85345870-85345892 GTGTGTGTGTTTGGGGGAGTGGG + Intergenic
1028087272 7:86651829-86651851 TTTTGGGTGTTGGGGGAAGTGGG - Intronic
1028487924 7:91380281-91380303 GTGTGTGTGTTGGGGGGAGGGGG - Intergenic
1028704287 7:93820015-93820037 GTGTGTGTGTTGGTGGGAGGTGG + Intronic
1028894575 7:96026857-96026879 CTGTGTGTGAGGGGGATAGATGG - Intronic
1029707376 7:102282966-102282988 GTGTGTGTGTTGGGGAAGGGGGG - Intronic
1029797470 7:102910397-102910419 CTTTGTGTGTTGGGGGGAGGGGG + Intronic
1029823954 7:103171028-103171050 GTGTGTGTGTTGGGAGTAGGGGG + Intergenic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030020076 7:105265092-105265114 GTGTGTGTGTTGTGTGTAGAAGG - Intronic
1030105536 7:105983903-105983925 CTGTTTGAGGTGGGGGAAGAAGG - Intronic
1030216299 7:107046130-107046152 CTGGGTGTGTTAGGGAAAGAGGG - Intronic
1030416139 7:109245859-109245881 CTGTGTGTGAATGGGGGAGAGGG - Intergenic
1030711371 7:112753968-112753990 CATTGTGTGTTAGGGGAGGAAGG - Intergenic
1030881449 7:114885504-114885526 GTGTGTGTGTTTGGGGGAGGTGG + Intergenic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031815787 7:126433442-126433464 CTGTGTGTGTTGGGAATGGAGGG + Intergenic
1031924889 7:127629744-127629766 CTCTGGGTGTTGGAGGAAGCTGG + Intergenic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032089677 7:128904991-128905013 GTGTGTGTGTTGGGGGAGCGGGG + Intronic
1032331752 7:130987019-130987041 GTGTGTGTGTTGGGGGTGGGAGG + Intergenic
1032478347 7:132227299-132227321 GTGGGTGTGTTATGGGAAGAGGG - Intronic
1032510864 7:132471351-132471373 TTGTGTGTGTTGTGTGAAGTTGG + Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1032739145 7:134721579-134721601 CTGTGTGTGTTTAGGGGAGGTGG + Intergenic
1033367381 7:140681948-140681970 CTCTGTGTGCTGTGAGAAGAAGG + Intronic
1033581332 7:142739833-142739855 GTGTACGTGTTGGGGGAGGAAGG + Intergenic
1033590968 7:142808098-142808120 CTCTGTTTGGTGGGGGAGGAGGG + Intergenic
1033755792 7:144397621-144397643 CTATGTGTGTTGGGGCACGGGGG - Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034455177 7:151166475-151166497 GTGTGTGTGTTGGGGGGGGGGGG - Intronic
1034694685 7:153043217-153043239 TTGTGTGTGTTGAAGGAAGGAGG - Intergenic
1034830831 7:154305929-154305951 CTTTGTAACTTGGGGGAAGAGGG + Intronic
1035331324 7:158098996-158099018 CGGGATGTGTTGGGGGAGGAAGG - Intronic
1035436492 7:158863737-158863759 CCGGGTGTGTGGGGGGAAGGGGG + Intronic
1035644395 8:1206998-1207020 CTGTGTGTGGTGGGGACAGGAGG - Intergenic
1035655500 8:1302048-1302070 CTGTGTGTGCTGGGGGAAAAGGG + Intergenic
1036629004 8:10497224-10497246 GTGGGAGTGTTGGGGGGAGAAGG - Intergenic
1037062538 8:14532702-14532724 CTTTGTGTGTGGGGGGAGGGCGG + Intronic
1037330151 8:17736338-17736360 CTGTGTGTGGTGGGGGCTGGAGG - Intronic
1037526128 8:19725807-19725829 GTGTATGTGTTGGGGGTAGAGGG - Intronic
1037590131 8:20304919-20304941 GTGTGTGTGTTGGGGGGTGGGGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037810661 8:22084833-22084855 ATGTGTGTGTTGTGGGGAGGAGG - Intergenic
1038236972 8:25768911-25768933 GTGTGTGTGTTGGGGAGAGGAGG - Intergenic
1038276109 8:26122237-26122259 CTGTGTGTGCTGGAGGGACATGG - Intergenic
1038367326 8:26949028-26949050 GTGTGTGTGTTCGGGAGAGAAGG + Intergenic
1038650560 8:29399284-29399306 CTCTTTGTGTCTGGGGAAGATGG + Intergenic
1038928295 8:32165018-32165040 TTGTGTGTGTTGGGGGGTGGGGG - Intronic
1039165170 8:34670933-34670955 ATGTGTGTGGTGGGGGAAGCAGG - Intergenic
1039378467 8:37061482-37061504 CAGGATGTGCTGGGGGAAGAGGG + Intergenic
1039435001 8:37553877-37553899 GTGTGTGTGTTGCGGGAGGCGGG - Intergenic
1039596328 8:38793020-38793042 GTGTGTGTGTTTGGGGAAGGGGG - Intronic
1039821551 8:41139617-41139639 GTGTGTGTGTTGGGTGCACAGGG - Intergenic
1039970901 8:42320865-42320887 CTGTGTGTGCTGGGCACAGAGGG - Intronic
1040357519 8:46633830-46633852 TGTTGTGTGGTGGGGGAAGAGGG + Intergenic
1040669111 8:49665726-49665748 GTGTGTGTGTTGGGGGGTGGTGG + Intergenic
1041015877 8:53592868-53592890 GTGTGTGTGTTGGGGGGTGAGGG - Intergenic
1041113922 8:54515679-54515701 CTGTGTGTGGTGTTGGCAGAGGG + Intergenic
1041127612 8:54660538-54660560 CTGTATGTGCTGGGGGTAGGAGG + Intergenic
1041141181 8:54820845-54820867 CTGAGTGTGTTCTGGGAAGGAGG - Intergenic
1041282223 8:56222136-56222158 CTCAGTGGGTTGGGGGAGGATGG + Intergenic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1041515301 8:58692690-58692712 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
1041537123 8:58939263-58939285 CTGTTTGTGGTGGGGGCTGAGGG - Intronic
1041711085 8:60895184-60895206 CTGTGTGGGTTGGTGAAAAAAGG - Intergenic
1041723546 8:60997964-60997986 ATGTGTGTGTTTGTGGAGGACGG + Intergenic
1042045877 8:64651024-64651046 GTGTTTGAGGTGGGGGAAGACGG + Intronic
1042702647 8:71633455-71633477 GTGTGTGTGTTGGGGGGAGATGG + Intergenic
1042714321 8:71755944-71755966 CTGTGTGTGTTGGAGGAGTGGGG + Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1043054133 8:75415769-75415791 GTGTGTGTGTTGGGGGGTGGGGG + Intronic
1043464196 8:80487976-80487998 CTGTATGTGTTGTGGGGGGAAGG + Intronic
1043854631 8:85250956-85250978 GTGTGTGTGGTGGTGGATGAAGG + Intronic
1044309034 8:90671335-90671357 GTGTGTGTGTTGGGGGAAAAGGG + Intronic
1044828653 8:96223726-96223748 CAGAATGTGTTTGGGGAAGAGGG + Intergenic
1044898063 8:96913992-96914014 CTGTGTGTGTTGGAGGATTGTGG + Intronic
1045147898 8:99368321-99368343 GTGTGTGTGTTGGGGTAGGGGGG - Intronic
1045420626 8:102011199-102011221 GTGTCTGTGTTGGGGGAGTAGGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1046504411 8:115118504-115118526 GTGTTTGTGTTGGGACAAGAAGG - Intergenic
1046804535 8:118465164-118465186 CTGGGTAGGGTGGGGGAAGAGGG + Intronic
1047021024 8:120775171-120775193 CTTTGTGTTTTGAGGGGAGAAGG + Intronic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1048512793 8:135077891-135077913 CTGTGAGTGTTGGGGAATGGGGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048888093 8:138924696-138924718 GTGTGTGTGGTGGGGGAGTAGGG - Intergenic
1049055524 8:140233610-140233632 GTGTGTGTGGTGGGGAGAGAGGG - Intronic
1049272244 8:141702219-141702241 GTGTGTGTGTTGGGGGAGATGGG + Intergenic
1049440295 8:142606490-142606512 CTGTGGCTGTTGGGTGAGGAAGG - Intergenic
1049542403 8:143214564-143214586 CTGTGTGTGGTGGGGCATGCTGG - Intergenic
1049678555 8:143904644-143904666 GTGTGTGTGTTGGGGTGGGAGGG + Intergenic
1049905280 9:210975-210997 CTGCGTGGTTTTGGGGAAGAAGG + Intergenic
1051509488 9:17861476-17861498 CTGTCTGTGTTGGGGGTAAGAGG + Intergenic
1051538534 9:18188182-18188204 ATGTATGTGTTGGGGGGAAAAGG - Intergenic
1053089346 9:35259777-35259799 GTGTGTGTGTAGGGGGATGCGGG + Intronic
1053507826 9:38659814-38659836 CTGTGTCAGTTTGGGGAGGAAGG + Intergenic
1054703574 9:68438828-68438850 GTGTGTATGTTGGGGGAGGAGGG + Intronic
1054832562 9:69643045-69643067 CTGTGTGTGGAGGGGGGAGGAGG - Intronic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1055545189 9:77363962-77363984 CTATGTGTGGTGGGGTAAGAGGG + Intronic
1055589274 9:77793688-77793710 ATGTGTGTGTTGGGGGAACGGGG - Intronic
1055697614 9:78903717-78903739 CAGTGTGTGTTGGGTGATGTTGG + Intergenic
1056262433 9:84862348-84862370 CCGTGTGTTTTTGGGGAAGGTGG + Intronic
1056438757 9:86598832-86598854 CTGTGTGGGGTGGGGTAGGAGGG - Intergenic
1056541004 9:87571424-87571446 GTGTGTGTGTTGGGGGGTGGGGG - Intronic
1056657484 9:88521187-88521209 GTGCCTGTGTTGGGGGAGGAGGG + Intergenic
1056764302 9:89435504-89435526 CTCTGTGAGTTGGGGAAAGGAGG - Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057287399 9:93769243-93769265 CTGTGTGTGTTGGGGCAAGCGGG + Intergenic
1057490816 9:95517958-95517980 GTGTGTGTGTTGGGGGCGGGGGG + Intergenic
1057577421 9:96254660-96254682 CTCTGTGGGCTGGGGGAAGCAGG - Intronic
1057966809 9:99512303-99512325 GTTTGTGGGTTGGGGGAAGGTGG - Intergenic
1058075459 9:100646028-100646050 CTGTGAGGGGTGGGGGGAGAGGG - Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058117337 9:101099095-101099117 GTGTGTGTGTCGGGGGGAGGCGG + Intronic
1058198084 9:102003352-102003374 CAGTGTGTGTTGGGGGAGGGTGG - Intergenic
1058275649 9:103038190-103038212 CTGTGGGTGTTGGGGGACAGGGG - Intergenic
1058785996 9:108387701-108387723 GTGTGTGTGTTGGGGGGTGTGGG - Intergenic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1059980153 9:119762591-119762613 GTGAGTGTGTTGGAGGAACAAGG - Intergenic
1060003903 9:119982725-119982747 TTGGATGTGTTGGTGGAAGATGG + Intergenic
1060312604 9:122476142-122476164 CTGTATGTGTTTGGGGAGAAAGG + Intergenic
1060743275 9:126113448-126113470 ATGTGGGAGTTGGGGGACGATGG + Intergenic
1061241768 9:129378611-129378633 GTGTGTGTGTTGGGGGGCGTGGG + Intergenic
1061377107 9:130233067-130233089 CTGTGTGTGGATGCGGAAGAAGG - Exonic
1061382162 9:130265333-130265355 GTGTGTGTGTTGGGGGGCGGGGG + Intergenic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061498363 9:130988840-130988862 GTGTGTGTGTTGGGGGAGGGGGG - Intergenic
1061790173 9:133054993-133055015 CTGTGTGTGTTGGGGACATCTGG + Intronic
1061799396 9:133105752-133105774 GTGTGCGTGAAGGGGGAAGAGGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1203355420 Un_KI270442v1:133673-133695 CTGTTTGGGTTGGGGGGAGGGGG + Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186265924 X:7833777-7833799 CTGTGTGTGTGGGTGGGAGGAGG - Intergenic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1186597803 X:11002818-11002840 GTGTGGATGTTGGGGGAGGAGGG - Intergenic
1186612312 X:11149453-11149475 GTATGTGTGTTGGGGGAGGGGGG + Intronic
1186659775 X:11657849-11657871 CTGTGTGTGATGGGGATAGGAGG + Intronic
1186938049 X:14472836-14472858 CTGTGTGTGTTAGGGAATGTTGG + Intergenic
1187226434 X:17377912-17377934 CTGTGTGGTTTGGGGTAAAAAGG - Intronic
1187291545 X:17959065-17959087 GTGTGTGTGTTGGGGGTCGGGGG - Intergenic
1187331666 X:18345850-18345872 GTGTGTGTGTCGGGGGTAGGGGG - Intronic
1187743751 X:22385541-22385563 GTGTGGATGTTGGGGGTAGATGG - Intergenic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1188689130 X:33107313-33107335 TTGTGTGTGTTGGGGGGGGGGGG - Intronic
1188784756 X:34332066-34332088 CTGTGTGTGTTTAGTGGAGATGG - Intergenic
1188977088 X:36688890-36688912 GTGTGTGTGTTGGGGGGCTAGGG - Intergenic
1189241707 X:39529667-39529689 GTGTGTGTGGTGGGGGTAGATGG - Intergenic
1189292454 X:39895837-39895859 CTGTCTGTGCCAGGGGAAGAAGG + Intergenic
1189309544 X:40009847-40009869 GTGTGTGTGTTGGGGGCGGTGGG - Intergenic
1189499184 X:41539111-41539133 CTGTGTGTGTGGGAGTTAGAGGG + Intronic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190454643 X:50615776-50615798 TTGTGTGTGGTGGGGGGAGGGGG + Intronic
1190518571 X:51251364-51251386 TTGTGTGTGTTGGGGGTCGGGGG - Intergenic
1190765472 X:53472650-53472672 CTGTGTTGGGTGGGGGAAGCAGG + Intergenic
1191054455 X:56227862-56227884 GTGTGTGTGTTGGGGCTAGGGGG - Intergenic
1191639070 X:63410555-63410577 CACTGTGTGTTGGGGGAAGGGGG - Intergenic
1192261455 X:69508147-69508169 CTGGGTCTTTTGTGGGAAGAAGG + Intronic
1192782168 X:74305235-74305257 ATGTGTATGTGGGGGAAAGAGGG + Intergenic
1193018172 X:76759376-76759398 CGCTGTGGGCTGGGGGAAGAGGG + Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1194301703 X:92195253-92195275 CTATGTGTGTTTAGGGAAGGGGG - Intronic
1194598698 X:95892565-95892587 ATGTGTGTGTTGGGGGAGGAAGG + Intergenic
1194814335 X:98424199-98424221 GTGTGTGTGTTGGGGAAGGGGGG + Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195273732 X:103257816-103257838 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1195302465 X:103544221-103544243 TTGTTTTTGTTGGGGGATGAAGG - Intergenic
1195706497 X:107741520-107741542 CTGTGTGTGTTGGCGGCAACAGG - Intronic
1195711802 X:107778925-107778947 TGGTGTGTGTAGGGGGAATAGGG + Intronic
1196123742 X:112078221-112078243 GTGTGTGTGTTAGGGGGAGGTGG + Intronic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196423217 X:115544033-115544055 CACTGTGTGTTGGGGGTAGGGGG + Intergenic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1197170344 X:123426924-123426946 CTGTGTGTGGGGGTGGAAGGGGG + Intronic
1197279498 X:124518393-124518415 GTGTGTTTGTTGGGGGCGGAGGG + Intronic
1197593903 X:128443935-128443957 CTGTGGGGGTTGGGGGACTAGGG - Intergenic
1197630081 X:128848346-128848368 GTGTGTGTGTTGGGGGTAGATGG + Intergenic
1197839272 X:130728166-130728188 CTGTGTGTGCTGTGGGAACTGGG - Intronic
1197989643 X:132303919-132303941 ATGTGTCTGTAAGGGGAAGAAGG + Intergenic
1198435504 X:136613100-136613122 GTGTGTGTGTTGGGGGGCGGGGG + Intergenic
1198556905 X:137804530-137804552 CTGTATGTGTTGTGGGATGGTGG + Intergenic
1198986378 X:142458867-142458889 GTGTGTGTGGTGGGGGATGTGGG - Intergenic
1199006059 X:142697474-142697496 CTGGGGGTGGTGGGGGTAGAAGG - Intergenic
1199057981 X:143319706-143319728 GGGTGTGTGTTTGGGGAAGGAGG + Intergenic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199332824 X:146582020-146582042 CTGTGAGTGTTGGGGGCATAGGG + Intergenic
1199606925 X:149585470-149585492 AAGTGTGTGTTGGGGGTGGAGGG + Intronic
1199632198 X:149783898-149783920 AAGTGTGTGTTGGGGGTGGAGGG - Intronic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic
1199984543 X:152941352-152941374 TGGTGTGTGTTGGGGGATGTGGG - Intronic
1199987778 X:152964756-152964778 GTGTGTGTGTTGGGGGCGGGAGG + Intronic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1200280663 X:154774438-154774460 CTGTGTGTGTTGGAGTTAGTGGG + Intronic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1201512219 Y:14777619-14777641 GTGAGTGTGAGGGGGGAAGAGGG + Intronic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic