ID: 1002600329

View in Genome Browser
Species Human (GRCh38)
Location 5:180350899-180350921
Sequence GGTCTCCGCCCCTGAGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002600324_1002600329 0 Left 1002600324 5:180350876-180350898 CCAAGTGATAAGGAAGGGCCTTA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1002600329 5:180350899-180350921 GGTCTCCGCCCCTGAGGGAACGG 0: 1
1: 0
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002600329 Original CRISPR GGTCTCCGCCCCTGAGGGAA CGG Intronic
900625309 1:3605836-3605858 GGCCTCCGCCCCTGACAGGAGGG - Intronic
900947966 1:5841899-5841921 GGTCTCGGCACCTGAGGTCAGGG - Intergenic
901818845 1:11812500-11812522 GGTCTCCTCCCTGGAGGGATGGG + Intronic
905990734 1:42335110-42335132 CGTCTCCGCCCCCCCGGGAAAGG + Intronic
906775350 1:48524420-48524442 GCTCTCCACCCCAGAGGGACTGG + Intergenic
908595581 1:65685757-65685779 AGACTCCACCTCTGAGGGAAGGG - Intergenic
911399601 1:97358353-97358375 GGTCTCCACCTCTGGGGGCAGGG + Intronic
915557236 1:156667522-156667544 GATCTTGGCCCCTGAGGGATAGG + Intergenic
919922927 1:202177116-202177138 TGTCTCGGCCCCTGGGGGCATGG - Intergenic
920100408 1:203513811-203513833 AGTCCCCGTCCCTGAGGGAGGGG - Intergenic
920442169 1:205988707-205988729 GGTCTCCGCCCCGCAGAGGAGGG + Intronic
921205525 1:212845406-212845428 CTTCTCAGACCCTGAGGGAAAGG - Intronic
1065359556 10:24876846-24876868 CGACTCAGCCCCTGAGGAAATGG + Intronic
1066638100 10:37527383-37527405 GGTGTCCGCACCTCAGGGAGTGG + Intergenic
1070829404 10:79409461-79409483 GGTCTCTGTCCCTGAGGAGAGGG - Intronic
1074870844 10:117574819-117574841 GGTGTCCGCCTTTGAGGGGAGGG + Intergenic
1075087651 10:119424186-119424208 TGACTCTGACCCTGAGGGAATGG + Intronic
1075579137 10:123603673-123603695 GGGTTCTGCCCCTGAGGGGAGGG - Intergenic
1076527379 10:131120604-131120626 GGTGTCAGCCTATGAGGGAATGG - Intronic
1076930364 10:133528180-133528202 GGTGGGCGCGCCTGAGGGAAGGG + Intronic
1077480759 11:2813364-2813386 GGTCTCCACCCCTGTGAGAGTGG - Intronic
1080611964 11:33912434-33912456 AGTCTCCGCCCGTTAGGGAGAGG - Intergenic
1081596593 11:44463685-44463707 TGTCCCTGCCCTTGAGGGAAAGG + Intergenic
1083327461 11:61879998-61880020 AGGCTCAGCCCCTGAGGGAGGGG - Intronic
1091795474 12:3295343-3295365 GGTGTCCGCCCCTTGGGGAATGG + Intergenic
1092081890 12:5723368-5723390 GGTTTCCGCCAATGAGGGGAAGG + Intronic
1096579493 12:52575353-52575375 CCTCTCAGCCCCTGAGGTAACGG + Intergenic
1096586925 12:52628927-52628949 GGTCTCCCTCCCAGAGGCAAAGG - Intergenic
1098907096 12:76173254-76173276 GGTCTCTGCCCCTAAGGAAGGGG - Intergenic
1100040751 12:90314201-90314223 GTTCTCCCCCTCTGAGGGACAGG - Intergenic
1108639952 13:52373981-52374003 GGTCTCTGCCTCTGAGAAAAAGG - Intergenic
1109527788 13:63598988-63599010 TGTCTCAGCCCCTGAGAGACAGG - Intergenic
1110567107 13:76967930-76967952 GGTCTGAGCCCCTAGGGGAAGGG - Intergenic
1113360750 13:109629212-109629234 GTTCTCAGCACCTGAGTGAAGGG + Intergenic
1113871798 13:113564505-113564527 GGTCTCCGAGTCTGTGGGAAGGG - Intergenic
1113897461 13:113775426-113775448 GGTCTCCGCCCCTTTGGGTGGGG + Intronic
1113949655 13:114064950-114064972 GGTCTCTGCCTCAGAGGGAGAGG - Intronic
1121815228 14:96923865-96923887 AGTCTGAGCCCCTGAGGGAAAGG - Intronic
1121815256 14:96923979-96924001 AGCCTTAGCCCCTGAGGGAAGGG - Intronic
1122692099 14:103536311-103536333 TGTATGCGCCCCTGAAGGAAGGG + Exonic
1123129492 14:105974014-105974036 GGTGTGCTCCTCTGAGGGAAGGG - Intergenic
1123579746 15:21704845-21704867 GGTGTGCTCCTCTGAGGGAAGGG - Intergenic
1123616373 15:22147356-22147378 GGTGTGCTCCTCTGAGGGAAGGG - Intergenic
1127276103 15:57445484-57445506 GGTCTCCGTCCCTAAGGGAGAGG - Intronic
1128269086 15:66293394-66293416 GGTCCAGGCCACTGAGGGAAGGG + Intronic
1129344195 15:74906483-74906505 GGCCTCGGCCCCGGAGGGAAGGG - Intronic
1129892745 15:79082361-79082383 GGTCCCCTCCACTGAGGGGAAGG - Intronic
1202988616 15_KI270727v1_random:439090-439112 GGTGTGCTCCTCTGAGGGAAGGG - Intergenic
1136455276 16:30376657-30376679 GGTCTTGGACCCTGAGGGAAAGG + Exonic
1137054933 16:35740500-35740522 ATTCTCAGACCCTGAGGGAAAGG + Intergenic
1141802871 16:86323068-86323090 GGTCGCCATCCCTGAGGGGAGGG - Intergenic
1145059696 17:19724813-19724835 GCTCGCCGCCCCTGAGGGGCTGG - Intergenic
1145133180 17:20376852-20376874 ACGCTCCGCCCCTGTGGGAACGG - Intergenic
1145903794 17:28505688-28505710 TGTATCTGCCCCTGAGGGAGAGG + Intronic
1145990483 17:29076420-29076442 GGTCTCTATCCCTGGGGGAAAGG + Exonic
1146211562 17:30947335-30947357 GGTCTCAGACACTAAGGGAATGG - Intronic
1147919481 17:43907238-43907260 GGTCCCCGCCCCTGCGGTAGGGG - Intronic
1148906865 17:50917737-50917759 GGTCTACAGCCCTGAGGGGAGGG + Intergenic
1155264909 18:24082681-24082703 TCTCTTCTCCCCTGAGGGAAGGG + Intronic
1155941930 18:31808661-31808683 CTTCTCCGACCCTGTGGGAAAGG - Intergenic
1160667162 19:336297-336319 TGTCTCCGCCTCTGAGGGCTGGG + Intronic
1160700817 19:506529-506551 GGGCAACGCCCCTGAGGGACGGG + Intergenic
1160808231 19:1001695-1001717 GGTCTCCCTCCCTGAGGAGAGGG - Intronic
1161553774 19:4929013-4929035 GGCCTGAGACCCTGAGGGAAGGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161894472 19:7069832-7069854 GGTTTCCGCCCCTGAGGCCTCGG + Intronic
1162500492 19:11050784-11050806 GGGCAGGGCCCCTGAGGGAAGGG + Intronic
1165158964 19:33804745-33804767 GGTCACAGCCCCTGCTGGAAAGG - Intronic
1165331821 19:35144487-35144509 GGTCTCCAGCACTGAGGGCAGGG + Intronic
1166423625 19:42656929-42656951 GGTCTCAGCCCCTGAGAAACAGG - Intronic
1168349672 19:55668859-55668881 GGTCTCCCCTCCTCAGGGGACGG + Intronic
927210696 2:20637388-20637410 GGTCAGCGGCCCTGAGGGAGAGG - Intronic
928951915 2:36820761-36820783 GGGCTCAGCCCCTAAGGGGAGGG - Intergenic
932633097 2:73363662-73363684 GGTCTCCGCCACTGTGGGATAGG - Intergenic
933655103 2:84880736-84880758 GGGCTGCGCCCCCGCGGGAAAGG + Intronic
936976918 2:118229819-118229841 GGTCTCAGCATCTCAGGGAAAGG - Intergenic
944578513 2:201112868-201112890 ATTCTCCTCACCTGAGGGAAGGG - Intergenic
948411722 2:237767844-237767866 CGTCTGGGCCCCTAAGGGAAAGG + Intronic
1169769630 20:9186880-9186902 GGTCTCAGCGTCTGAGGCAAAGG - Intronic
1170547224 20:17444818-17444840 GGTATCCCACCCTGTGGGAAAGG + Intronic
1175772966 20:61635380-61635402 AGTCACCGCCCCTGGGAGAATGG + Intronic
1176024746 20:62980082-62980104 GCTCTCCGCCCACGAGGGGATGG - Intergenic
1178148750 21:29769688-29769710 GGTCTATGCCCCTGTGGGACTGG + Intronic
1181804603 22:25367208-25367230 GGTCTTCGCCCCACAGGAAAGGG + Intronic
1182104633 22:27680708-27680730 CGTCTCTGCCCCAGAGGGAATGG + Intergenic
1184241487 22:43213268-43213290 GGTCTCCACCCCTGGGGGAGTGG - Intronic
949552584 3:5123142-5123164 GGTCTCCGCGCCTGGGGGACGGG - Intronic
950605762 3:14078669-14078691 GGTCTCCGCCTTCCAGGGAATGG - Intronic
951402684 3:22253102-22253124 GGTCTCCCACACTGAGGGAATGG + Intronic
958422379 3:93942987-93943009 CTTCTCAGACCCTGAGGGAAAGG - Intronic
960096724 3:113696593-113696615 GGTCTCCGGCCTTGAGGGCTCGG - Exonic
963025429 3:140914117-140914139 GGTCTGAGCCCCTTAGGGCATGG + Intergenic
963973796 3:151458628-151458650 GGTCGCCACCCCTGGGGGCAAGG - Exonic
964940540 3:162154784-162154806 GTTCTCAGACCCTGTGGGAAAGG + Intergenic
972792673 4:42387783-42387805 GGTCTTCACCCCTGAGTGTAAGG - Intergenic
979732792 4:124045180-124045202 GGACTGAGCCCCTGGGGGAAAGG - Intergenic
984092144 4:175387566-175387588 GGCCTGAGCCCCTGAGGGGAGGG + Intergenic
984417278 4:179477555-179477577 GCTCTCAACCCCTGTGGGAAGGG - Intergenic
985484108 5:139395-139417 GGTCTCCACCCCTCAGGGGAAGG - Intergenic
985692201 5:1319640-1319662 GGCCCCAGGCCCTGAGGGAAGGG + Intronic
985761178 5:1749653-1749675 GGGCTCTGCCCCTGAGGCAGTGG - Intergenic
986566389 5:9119131-9119153 AGCCTCCGTTCCTGAGGGAAGGG + Exonic
987370221 5:17186395-17186417 GGTCGCCGGCCCTGGTGGAAGGG - Intronic
997767007 5:136514710-136514732 GGTCTCTTCCCATGTGGGAATGG + Intergenic
1000136922 5:158361949-158361971 AGTCTCAGCCCCTGTGGGGAGGG + Intergenic
1002100695 5:176856094-176856116 GGCCTCCGTCCCTGGGGGCAGGG - Intronic
1002600329 5:180350899-180350921 GGTCTCCGCCCCTGAGGGAACGG + Intronic
1006837074 6:37005546-37005568 GGTCAGCCCCCCTGAGGGAGAGG + Intergenic
1007327256 6:41072359-41072381 GGTCCCCGCCCCGCGGGGAAGGG + Exonic
1007340601 6:41188848-41188870 GCTCACAGCCTCTGAGGGAAGGG - Intergenic
1007360764 6:41353600-41353622 GAGCTCCTCCCCTGAGGAAATGG + Intergenic
1007427387 6:41756443-41756465 GGTCTGCTCCCCTGAGAGGAGGG + Intergenic
1010739981 6:79489987-79490009 GCTTTCCACCCCTGTGGGAAAGG - Intronic
1015561957 6:134525573-134525595 GCTCTCTGCCCAGGAGGGAAAGG + Intergenic
1017270222 6:152495293-152495315 CTTCTCAGACCCTGAGGGAAAGG - Intronic
1017950078 6:159128996-159129018 GGGCTCATCCCCTGAGGGAGTGG - Intergenic
1027443677 7:78246855-78246877 TGTCTCTGACCCTGAGGGCAGGG - Intronic
1028027687 7:85866934-85866956 GGACAGAGCCCCTGAGGGAAGGG + Intergenic
1029414929 7:100436501-100436523 TGACTCCGCCCCCGAAGGAAAGG - Exonic
1029448565 7:100628009-100628031 GGGCTCAGCCCCAGAGGCAAGGG + Intronic
1032067054 7:128779426-128779448 GGTCTGAGCCCCTCAGGGATTGG - Intergenic
1032222741 7:130006884-130006906 GGTCACCGCATCTGAGGCAACGG - Intergenic
1034347685 7:150397285-150397307 GGTCTCCGGCCCCGAGGGGCCGG + Exonic
1040981884 8:53252509-53252531 GGGCTCAGCCCCTGAGGTGAAGG + Intergenic
1041483391 8:58347944-58347966 AGTCTCTGCCCCACAGGGAAGGG + Intergenic
1041756374 8:61317345-61317367 GGACTCCTCCCCTCAGGAAAGGG - Intronic
1043070404 8:75629890-75629912 GGTCTCCACCTTTCAGGGAATGG - Intergenic
1047342260 8:123993676-123993698 GGACTCCTACTCTGAGGGAAAGG - Intronic
1052816096 9:33103523-33103545 GGGTTCCTCCCCTGGGGGAATGG - Intergenic
1053029971 9:34767293-34767315 GGGCTCCACCTCTGGGGGAAGGG - Intergenic
1061231803 9:129319804-129319826 GCTCTGCGACCCTGAGTGAATGG - Intergenic
1062012686 9:134275503-134275525 GGGCTCCTCCCCTGCGGGGAGGG - Intergenic
1062207127 9:135343341-135343363 CGTCTCCTCCCCTGTGGGATGGG + Exonic
1197471314 X:126867588-126867610 CTTCTCAGACCCTGAGGGAAAGG - Intergenic
1198679392 X:139165540-139165562 GCTCTGGGCCCCTGATGGAAGGG - Intronic
1199086579 X:143635360-143635382 GGTCTCCACGCCTGAGGAAAGGG - Intronic
1199863286 X:151821168-151821190 GGTCTCTGCCCTGCAGGGAAAGG + Intergenic
1201494251 Y:14576173-14576195 AGACTCCACCCCTGGGGGAAGGG - Intronic