ID: 1002601616

View in Genome Browser
Species Human (GRCh38)
Location 5:180356980-180357002
Sequence GTGCCTGGCATTTCTACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002601616_1002601623 22 Left 1002601616 5:180356980-180357002 CCAGATGTAGAAATGCCAGGCAC No data
Right 1002601623 5:180357025-180357047 CAGCCCAGGCCAGGGACCACAGG No data
1002601616_1002601621 13 Left 1002601616 5:180356980-180357002 CCAGATGTAGAAATGCCAGGCAC No data
Right 1002601621 5:180357016-180357038 CTAGAGACACAGCCCAGGCCAGG No data
1002601616_1002601619 8 Left 1002601616 5:180356980-180357002 CCAGATGTAGAAATGCCAGGCAC No data
Right 1002601619 5:180357011-180357033 GTGGCCTAGAGACACAGCCCAGG No data
1002601616_1002601622 14 Left 1002601616 5:180356980-180357002 CCAGATGTAGAAATGCCAGGCAC No data
Right 1002601622 5:180357017-180357039 TAGAGACACAGCCCAGGCCAGGG No data
1002601616_1002601624 23 Left 1002601616 5:180356980-180357002 CCAGATGTAGAAATGCCAGGCAC No data
Right 1002601624 5:180357026-180357048 AGCCCAGGCCAGGGACCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002601616 Original CRISPR GTGCCTGGCATTTCTACATC TGG (reversed) Intergenic
No off target data available for this crispr