ID: 1002602799

View in Genome Browser
Species Human (GRCh38)
Location 5:180363587-180363609
Sequence TCATCTCAGAGGAGTCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002602797_1002602799 -2 Left 1002602797 5:180363566-180363588 CCTGACGAGAACTAGCAGGTGTC No data
Right 1002602799 5:180363587-180363609 TCATCTCAGAGGAGTCTTGCTGG No data
1002602795_1002602799 8 Left 1002602795 5:180363556-180363578 CCTCAATCAGCCTGACGAGAACT No data
Right 1002602799 5:180363587-180363609 TCATCTCAGAGGAGTCTTGCTGG No data
1002602794_1002602799 25 Left 1002602794 5:180363539-180363561 CCAGGCTGGACAGGGGACCTCAA No data
Right 1002602799 5:180363587-180363609 TCATCTCAGAGGAGTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002602799 Original CRISPR TCATCTCAGAGGAGTCTTGC TGG Intergenic
No off target data available for this crispr