ID: 1002603186

View in Genome Browser
Species Human (GRCh38)
Location 5:180366552-180366574
Sequence CTCCATAGTTGGGCTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002603178_1002603186 13 Left 1002603178 5:180366516-180366538 CCACAAGAGGCGGCTGCAGGGTG No data
Right 1002603186 5:180366552-180366574 CTCCATAGTTGGGCTGGCCAGGG No data
1002603177_1002603186 14 Left 1002603177 5:180366515-180366537 CCCACAAGAGGCGGCTGCAGGGT No data
Right 1002603186 5:180366552-180366574 CTCCATAGTTGGGCTGGCCAGGG No data
1002603174_1002603186 20 Left 1002603174 5:180366509-180366531 CCGGTGCCCACAAGAGGCGGCTG No data
Right 1002603186 5:180366552-180366574 CTCCATAGTTGGGCTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002603186 Original CRISPR CTCCATAGTTGGGCTGGCCA GGG Intergenic
No off target data available for this crispr