ID: 1002605339

View in Genome Browser
Species Human (GRCh38)
Location 5:180379791-180379813
Sequence AAGCCTGAGCACTGTGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002605333_1002605339 18 Left 1002605333 5:180379750-180379772 CCTCGGTGCACGGTGTGTGTTTA No data
Right 1002605339 5:180379791-180379813 AAGCCTGAGCACTGTGAGCGTGG No data
1002605328_1002605339 29 Left 1002605328 5:180379739-180379761 CCTTCCCTCGCCCTCGGTGCACG No data
Right 1002605339 5:180379791-180379813 AAGCCTGAGCACTGTGAGCGTGG No data
1002605331_1002605339 24 Left 1002605331 5:180379744-180379766 CCTCGCCCTCGGTGCACGGTGTG No data
Right 1002605339 5:180379791-180379813 AAGCCTGAGCACTGTGAGCGTGG No data
1002605332_1002605339 19 Left 1002605332 5:180379749-180379771 CCCTCGGTGCACGGTGTGTGTTT No data
Right 1002605339 5:180379791-180379813 AAGCCTGAGCACTGTGAGCGTGG No data
1002605330_1002605339 25 Left 1002605330 5:180379743-180379765 CCCTCGCCCTCGGTGCACGGTGT No data
Right 1002605339 5:180379791-180379813 AAGCCTGAGCACTGTGAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002605339 Original CRISPR AAGCCTGAGCACTGTGAGCG TGG Intergenic