ID: 1002605901

View in Genome Browser
Species Human (GRCh38)
Location 5:180382547-180382569
Sequence GCCAACACCACAACTAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002605894_1002605901 7 Left 1002605894 5:180382517-180382539 CCTGGCAAGGGAGAAGAAACCTT No data
Right 1002605901 5:180382547-180382569 GCCAACACCACAACTAGAAGGGG No data
1002605890_1002605901 26 Left 1002605890 5:180382498-180382520 CCAGCACTGCTGGGAAACACCTG No data
Right 1002605901 5:180382547-180382569 GCCAACACCACAACTAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002605901 Original CRISPR GCCAACACCACAACTAGAAG GGG Intergenic
No off target data available for this crispr