ID: 1002609471

View in Genome Browser
Species Human (GRCh38)
Location 5:180405307-180405329
Sequence TTGGGGAATTGTAAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002609471_1002609478 17 Left 1002609471 5:180405307-180405329 CCCACCAACTTACAATTCCCCAA No data
Right 1002609478 5:180405347-180405369 TGTGAAACCATCAAAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002609471 Original CRISPR TTGGGGAATTGTAAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr