ID: 1002609478

View in Genome Browser
Species Human (GRCh38)
Location 5:180405347-180405369
Sequence TGTGAAACCATCAAAAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002609471_1002609478 17 Left 1002609471 5:180405307-180405329 CCCACCAACTTACAATTCCCCAA No data
Right 1002609478 5:180405347-180405369 TGTGAAACCATCAAAAGTAAAGG No data
1002609474_1002609478 0 Left 1002609474 5:180405324-180405346 CCCCAACTTATAATTCCATATTC No data
Right 1002609478 5:180405347-180405369 TGTGAAACCATCAAAAGTAAAGG No data
1002609476_1002609478 -2 Left 1002609476 5:180405326-180405348 CCAACTTATAATTCCATATTCTG No data
Right 1002609478 5:180405347-180405369 TGTGAAACCATCAAAAGTAAAGG No data
1002609472_1002609478 16 Left 1002609472 5:180405308-180405330 CCACCAACTTACAATTCCCCAAC No data
Right 1002609478 5:180405347-180405369 TGTGAAACCATCAAAAGTAAAGG No data
1002609475_1002609478 -1 Left 1002609475 5:180405325-180405347 CCCAACTTATAATTCCATATTCT No data
Right 1002609478 5:180405347-180405369 TGTGAAACCATCAAAAGTAAAGG No data
1002609473_1002609478 13 Left 1002609473 5:180405311-180405333 CCAACTTACAATTCCCCAACTTA No data
Right 1002609478 5:180405347-180405369 TGTGAAACCATCAAAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002609478 Original CRISPR TGTGAAACCATCAAAAGTAA AGG Intergenic
No off target data available for this crispr