ID: 1002613379

View in Genome Browser
Species Human (GRCh38)
Location 5:180435820-180435842
Sequence GTGCAGTGAGGACAGACAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613379_1002613390 28 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613390 5:180435871-180435893 CTGCCCTAGTTGGCCTTGCCTGG No data
1002613379_1002613388 18 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613388 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
1002613379_1002613386 5 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613386 5:180435848-180435870 TCAGGGCTCACAGCCCAGGTGGG No data
1002613379_1002613391 29 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613391 5:180435872-180435894 TGCCCTAGTTGGCCTTGCCTGGG No data
1002613379_1002613392 30 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613392 5:180435873-180435895 GCCCTAGTTGGCCTTGCCTGGGG No data
1002613379_1002613384 1 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613384 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
1002613379_1002613385 4 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613385 5:180435847-180435869 TTCAGGGCTCACAGCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613379 Original CRISPR GTGCAGTGAGGACAGACAGA CGG (reversed) Intergenic
No off target data available for this crispr