ID: 1002613382

View in Genome Browser
Species Human (GRCh38)
Location 5:180435832-180435854
Sequence GCCCTGAAAGGTGTGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613382_1002613392 18 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613392 5:180435873-180435895 GCCCTAGTTGGCCTTGCCTGGGG No data
1002613382_1002613385 -8 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613385 5:180435847-180435869 TTCAGGGCTCACAGCCCAGGTGG No data
1002613382_1002613388 6 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613388 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
1002613382_1002613390 16 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613390 5:180435871-180435893 CTGCCCTAGTTGGCCTTGCCTGG No data
1002613382_1002613386 -7 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613386 5:180435848-180435870 TCAGGGCTCACAGCCCAGGTGGG No data
1002613382_1002613391 17 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613391 5:180435872-180435894 TGCCCTAGTTGGCCTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613382 Original CRISPR GCCCTGAAAGGTGTGCAGTG AGG (reversed) Intergenic