ID: 1002613383

View in Genome Browser
Species Human (GRCh38)
Location 5:180435844-180435866
Sequence CCTGGGCTGTGAGCCCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613383_1002613397 20 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613397 5:180435887-180435909 TGCCTGGGGCTTGCTCCTCTGGG No data
1002613383_1002613396 19 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613396 5:180435886-180435908 TTGCCTGGGGCTTGCTCCTCTGG No data
1002613383_1002613392 6 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613392 5:180435873-180435895 GCCCTAGTTGGCCTTGCCTGGGG No data
1002613383_1002613390 4 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613390 5:180435871-180435893 CTGCCCTAGTTGGCCTTGCCTGG No data
1002613383_1002613401 30 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613383_1002613391 5 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613391 5:180435872-180435894 TGCCCTAGTTGGCCTTGCCTGGG No data
1002613383_1002613399 26 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613399 5:180435893-180435915 GGGCTTGCTCCTCTGGGCCGAGG No data
1002613383_1002613388 -6 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613388 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
1002613383_1002613400 27 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613383 Original CRISPR CCTGGGCTGTGAGCCCTGAA AGG (reversed) Intergenic
No off target data available for this crispr