ID: 1002613389

View in Genome Browser
Species Human (GRCh38)
Location 5:180435862-180435884
Sequence GCCAACTAGGGCAGCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613389_1002613400 9 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data
1002613389_1002613406 29 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613406 5:180435914-180435936 GGGAGGCCTGGGCACCAGCATGG No data
1002613389_1002613404 18 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613404 5:180435903-180435925 CTCTGGGCCGAGGGAGGCCTGGG No data
1002613389_1002613399 8 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613399 5:180435893-180435915 GGGCTTGCTCCTCTGGGCCGAGG No data
1002613389_1002613401 12 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613389_1002613396 1 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613396 5:180435886-180435908 TTGCCTGGGGCTTGCTCCTCTGG No data
1002613389_1002613397 2 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613397 5:180435887-180435909 TGCCTGGGGCTTGCTCCTCTGGG No data
1002613389_1002613403 17 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613389 Original CRISPR GCCAACTAGGGCAGCCCACC TGG (reversed) Intergenic
No off target data available for this crispr