ID: 1002613390

View in Genome Browser
Species Human (GRCh38)
Location 5:180435871-180435893
Sequence CTGCCCTAGTTGGCCTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613383_1002613390 4 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613390 5:180435871-180435893 CTGCCCTAGTTGGCCTTGCCTGG No data
1002613382_1002613390 16 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613390 5:180435871-180435893 CTGCCCTAGTTGGCCTTGCCTGG No data
1002613379_1002613390 28 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613390 5:180435871-180435893 CTGCCCTAGTTGGCCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613390 Original CRISPR CTGCCCTAGTTGGCCTTGCC TGG Intergenic
No off target data available for this crispr