ID: 1002613392

View in Genome Browser
Species Human (GRCh38)
Location 5:180435873-180435895
Sequence GCCCTAGTTGGCCTTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613383_1002613392 6 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613392 5:180435873-180435895 GCCCTAGTTGGCCTTGCCTGGGG No data
1002613379_1002613392 30 Left 1002613379 5:180435820-180435842 CCGTCTGTCTGTCCTCACTGCAC No data
Right 1002613392 5:180435873-180435895 GCCCTAGTTGGCCTTGCCTGGGG No data
1002613382_1002613392 18 Left 1002613382 5:180435832-180435854 CCTCACTGCACACCTTTCAGGGC No data
Right 1002613392 5:180435873-180435895 GCCCTAGTTGGCCTTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613392 Original CRISPR GCCCTAGTTGGCCTTGCCTG GGG Intergenic
No off target data available for this crispr