ID: 1002613393

View in Genome Browser
Species Human (GRCh38)
Location 5:180435874-180435896
Sequence GCCCCAGGCAAGGCCAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613393_1002613400 -3 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data
1002613393_1002613403 5 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data
1002613393_1002613401 0 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613393_1002613397 -10 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613397 5:180435887-180435909 TGCCTGGGGCTTGCTCCTCTGGG No data
1002613393_1002613404 6 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613404 5:180435903-180435925 CTCTGGGCCGAGGGAGGCCTGGG No data
1002613393_1002613406 17 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613406 5:180435914-180435936 GGGAGGCCTGGGCACCAGCATGG No data
1002613393_1002613399 -4 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613399 5:180435893-180435915 GGGCTTGCTCCTCTGGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613393 Original CRISPR GCCCCAGGCAAGGCCAACTA GGG (reversed) Intergenic