ID: 1002613395

View in Genome Browser
Species Human (GRCh38)
Location 5:180435884-180435906
Sequence AGAGGAGCAAGCCCCAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613395_1002613403 -5 Left 1002613395 5:180435884-180435906 CCTTGCCTGGGGCTTGCTCCTCT No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data
1002613395_1002613406 7 Left 1002613395 5:180435884-180435906 CCTTGCCTGGGGCTTGCTCCTCT No data
Right 1002613406 5:180435914-180435936 GGGAGGCCTGGGCACCAGCATGG No data
1002613395_1002613404 -4 Left 1002613395 5:180435884-180435906 CCTTGCCTGGGGCTTGCTCCTCT No data
Right 1002613404 5:180435903-180435925 CTCTGGGCCGAGGGAGGCCTGGG No data
1002613395_1002613401 -10 Left 1002613395 5:180435884-180435906 CCTTGCCTGGGGCTTGCTCCTCT No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613395 Original CRISPR AGAGGAGCAAGCCCCAGGCA AGG (reversed) Intergenic
No off target data available for this crispr