ID: 1002613396

View in Genome Browser
Species Human (GRCh38)
Location 5:180435886-180435908
Sequence TTGCCTGGGGCTTGCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613387_1002613396 2 Left 1002613387 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
Right 1002613396 5:180435886-180435908 TTGCCTGGGGCTTGCTCCTCTGG No data
1002613383_1002613396 19 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613396 5:180435886-180435908 TTGCCTGGGGCTTGCTCCTCTGG No data
1002613389_1002613396 1 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613396 5:180435886-180435908 TTGCCTGGGGCTTGCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613396 Original CRISPR TTGCCTGGGGCTTGCTCCTC TGG Intergenic
No off target data available for this crispr