ID: 1002613397

View in Genome Browser
Species Human (GRCh38)
Location 5:180435887-180435909
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613389_1002613397 2 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613397 5:180435887-180435909 TGCCTGGGGCTTGCTCCTCTGGG No data
1002613383_1002613397 20 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613397 5:180435887-180435909 TGCCTGGGGCTTGCTCCTCTGGG No data
1002613387_1002613397 3 Left 1002613387 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
Right 1002613397 5:180435887-180435909 TGCCTGGGGCTTGCTCCTCTGGG No data
1002613393_1002613397 -10 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613397 5:180435887-180435909 TGCCTGGGGCTTGCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613397 Original CRISPR TGCCTGGGGCTTGCTCCTCT GGG Intergenic