ID: 1002613400

View in Genome Browser
Species Human (GRCh38)
Location 5:180435894-180435916
Sequence GGCTTGCTCCTCTGGGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613394_1002613400 -4 Left 1002613394 5:180435875-180435897 CCTAGTTGGCCTTGCCTGGGGCT No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data
1002613389_1002613400 9 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data
1002613393_1002613400 -3 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data
1002613383_1002613400 27 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data
1002613387_1002613400 10 Left 1002613387 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
Right 1002613400 5:180435894-180435916 GGCTTGCTCCTCTGGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613400 Original CRISPR GGCTTGCTCCTCTGGGCCGA GGG Intergenic
No off target data available for this crispr