ID: 1002613401

View in Genome Browser
Species Human (GRCh38)
Location 5:180435897-180435919
Sequence TTGCTCCTCTGGGCCGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613394_1002613401 -1 Left 1002613394 5:180435875-180435897 CCTAGTTGGCCTTGCCTGGGGCT No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613389_1002613401 12 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613387_1002613401 13 Left 1002613387 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613393_1002613401 0 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613395_1002613401 -10 Left 1002613395 5:180435884-180435906 CCTTGCCTGGGGCTTGCTCCTCT No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data
1002613383_1002613401 30 Left 1002613383 5:180435844-180435866 CCTTTCAGGGCTCACAGCCCAGG No data
Right 1002613401 5:180435897-180435919 TTGCTCCTCTGGGCCGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613401 Original CRISPR TTGCTCCTCTGGGCCGAGGG AGG Intergenic
No off target data available for this crispr