ID: 1002613403

View in Genome Browser
Species Human (GRCh38)
Location 5:180435902-180435924
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002613389_1002613403 17 Left 1002613389 5:180435862-180435884 CCAGGTGGGCTGCCCTAGTTGGC No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data
1002613398_1002613403 -10 Left 1002613398 5:180435889-180435911 CCTGGGGCTTGCTCCTCTGGGCC No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data
1002613394_1002613403 4 Left 1002613394 5:180435875-180435897 CCTAGTTGGCCTTGCCTGGGGCT No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data
1002613393_1002613403 5 Left 1002613393 5:180435874-180435896 CCCTAGTTGGCCTTGCCTGGGGC No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data
1002613395_1002613403 -5 Left 1002613395 5:180435884-180435906 CCTTGCCTGGGGCTTGCTCCTCT No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data
1002613387_1002613403 18 Left 1002613387 5:180435861-180435883 CCCAGGTGGGCTGCCCTAGTTGG No data
Right 1002613403 5:180435902-180435924 CCTCTGGGCCGAGGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002613403 Original CRISPR CCTCTGGGCCGAGGGAGGCC TGG Intergenic