ID: 1002618920

View in Genome Browser
Species Human (GRCh38)
Location 5:180472706-180472728
Sequence ATAGTGCAGTGGTTCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002618917_1002618920 29 Left 1002618917 5:180472654-180472676 CCACACAGGTTTGTGATGAGGAT No data
Right 1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002618920 Original CRISPR ATAGTGCAGTGGTTCTCAGT TGG Intergenic
No off target data available for this crispr