ID: 1002619058

View in Genome Browser
Species Human (GRCh38)
Location 5:180474029-180474051
Sequence AGAGCTCTGGCTGGGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002619052_1002619058 13 Left 1002619052 5:180473993-180474015 CCAATAAAATACACCAGCAAAAT No data
Right 1002619058 5:180474029-180474051 AGAGCTCTGGCTGGGCACGGTGG No data
1002619053_1002619058 0 Left 1002619053 5:180474006-180474028 CCAGCAAAATACTTATGTTAAAG No data
Right 1002619058 5:180474029-180474051 AGAGCTCTGGCTGGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002619058 Original CRISPR AGAGCTCTGGCTGGGCACGG TGG Intergenic
No off target data available for this crispr