ID: 1002620151

View in Genome Browser
Species Human (GRCh38)
Location 5:180482508-180482530
Sequence CTGCACTGCCTGGCAACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002620151_1002620155 -9 Left 1002620151 5:180482508-180482530 CCCGCTGTTGCCAGGCAGTGCAG No data
Right 1002620155 5:180482522-180482544 GCAGTGCAGTGGCATGATCTTGG 0: 361
1: 19942
2: 65151
3: 122456
4: 131828
1002620151_1002620157 16 Left 1002620151 5:180482508-180482530 CCCGCTGTTGCCAGGCAGTGCAG No data
Right 1002620157 5:180482547-180482569 CACTGCAATCTCCGCCTCATGGG 0: 6
1: 1111
2: 35682
3: 161285
4: 223486
1002620151_1002620156 15 Left 1002620151 5:180482508-180482530 CCCGCTGTTGCCAGGCAGTGCAG No data
Right 1002620156 5:180482546-180482568 TCACTGCAATCTCCGCCTCATGG 0: 11
1: 2198
2: 81020
3: 166368
4: 119008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002620151 Original CRISPR CTGCACTGCCTGGCAACAGC GGG (reversed) Intergenic
No off target data available for this crispr