ID: 1002624038

View in Genome Browser
Species Human (GRCh38)
Location 5:180511946-180511968
Sequence CTTTTGATGGAAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 13, 3: 43, 4: 499}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002624038 Original CRISPR CTTTTGATGGAAAGGGAAGA AGG (reversed) Intronic
900672401 1:3863406-3863428 CCATTGATGGGAAGGGAAAACGG + Intronic
900796497 1:4711726-4711748 CCTTTGAAGGAAAGGAAGGAAGG + Intronic
901002000 1:6153517-6153539 GTTTTGATGGAAGGGGCTGAGGG - Intronic
901848091 1:11997408-11997430 GTTTTGATGGACAGGTAAGAGGG + Exonic
901952541 1:12760340-12760362 CTTTTGATGCAAAGGGACACAGG + Intronic
902998903 1:20250344-20250366 TTTTTGGGAGAAAGGGAAGAAGG + Intergenic
904258542 1:29273233-29273255 CTTCTGAAGCAAAGGCAAGATGG - Intronic
904520698 1:31093468-31093490 CTTTTGATGAAAATGTAAAATGG - Intergenic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904706584 1:32395320-32395342 CTTTTGCTGTAAAGGGGAGTAGG - Intergenic
905328958 1:37178817-37178839 CATTTCCTGGAAAGGAAAGAAGG - Intergenic
905743645 1:40394191-40394213 CTTCTGAGGGAAATGGTAGATGG - Intronic
905871857 1:41408936-41408958 CTTGTGATGGAAAGTGAAATAGG + Intergenic
906115958 1:43357530-43357552 TTTTTTCTGTAAAGGGAAGATGG + Intergenic
906482175 1:46206262-46206284 CTTTTGGTGGAGGGGGTAGAGGG + Intronic
907332927 1:53683105-53683127 CTTTAGAAGGAAAGGAAAGAAGG + Intronic
907824350 1:58000937-58000959 AATTTGAGAGAAAGGGAAGATGG - Intronic
907940300 1:59081236-59081258 CTTTTTTTTGGAAGGGAAGATGG + Intergenic
910145013 1:84069589-84069611 CTTTTGATAGAAAGGTAAAAAGG - Intergenic
910517344 1:88076725-88076747 CCTGTGATGGACAGGAAAGAGGG + Intergenic
910688714 1:89943931-89943953 ATTACAATGGAAAGGGAAGAAGG - Intergenic
911942419 1:104064390-104064412 CTATTTATGCAAAAGGAAGAGGG + Intergenic
912614918 1:111089556-111089578 CTATTGGTGGAAATGGAAAATGG + Intergenic
912626441 1:111208580-111208602 ATTTAGATGGAAAGGGGAGGTGG - Intronic
913578761 1:120204940-120204962 CTGTTGATGGAAATGTAAAATGG - Intergenic
913629412 1:120693429-120693451 CTGTTGATGGAAATGTAAAATGG + Intergenic
914973913 1:152339977-152339999 CTGCTGATGGAAAGGGAGAATGG + Intergenic
915334155 1:155130763-155130785 CTTTTGAGGAAAAGTGAAGCTGG + Intronic
915789660 1:158654579-158654601 TTTTTGATGGAAAGATTAGAAGG + Intronic
916423127 1:164654942-164654964 CATGTGATGGGAATGGAAGATGG + Intronic
916552376 1:165861120-165861142 CACTTGATGGAAAGGGCAAAAGG + Intronic
917130762 1:171740293-171740315 CTTCTTATGGAAAAGGAAGCAGG - Intronic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
917481348 1:175414784-175414806 CTTTTGAGGGACTGGGAGGAAGG + Intronic
917588223 1:176450257-176450279 CTACTGATAGAAAGGGAAAAAGG - Intergenic
917871369 1:179244907-179244929 CTTTTGACAGAAATGGAAGAAGG + Intergenic
919040585 1:192382793-192382815 CTATGGAGGGAAAGAGAAGATGG + Intergenic
919914141 1:202129695-202129717 CTTTTGAGGGACAGAGAGGATGG + Exonic
919979360 1:202632750-202632772 CATTTGACTGAAAGGAAAGATGG - Intronic
921759826 1:218900017-218900039 CTTTGGAGGTAAAGGTAAGAGGG + Intergenic
922145605 1:222940711-222940733 CTCCTGATGGAAAGGGCAGGAGG + Intronic
922681914 1:227606002-227606024 CTTTTTATTGAAAGTGAAGGGGG + Intronic
923512267 1:234662671-234662693 CTTTTGATGTAACAGAAAGAAGG - Intergenic
923772599 1:236950637-236950659 CTTTTGCAGGAAAGAAAAGAGGG + Intergenic
924113852 1:240726554-240726576 TTTTTGATAGAATGTGAAGATGG + Intergenic
924205161 1:241704886-241704908 CATTTGCTGGCAAGGGATGATGG - Intronic
924356793 1:243186513-243186535 CTTTGGATTGAAAAGGAGGAGGG - Intronic
1063217246 10:3935949-3935971 CATTAAATAGAAAGGGAAGATGG - Intergenic
1063878780 10:10509432-10509454 CATTTGGTGGAAAGGGCAAATGG - Intergenic
1064302191 10:14132565-14132587 CTCATGATGGAAAGGGGAGGAGG + Intronic
1067141837 10:43664546-43664568 GGAGTGATGGAAAGGGAAGAAGG + Intergenic
1068745473 10:60525457-60525479 CTTTTGAAAGAAAGAGAACACGG + Intronic
1069807962 10:71137746-71137768 CATTTTATAGAATGGGAAGATGG + Intergenic
1070132097 10:73663389-73663411 CTTATGCAGGAAAAGGAAGATGG - Intronic
1070326429 10:75392495-75392517 ATTTTGGTAGAAAGGGAAAAAGG + Intergenic
1070494239 10:77006993-77007015 CTTTTGCTGCAAAGGAATGAGGG + Intronic
1071021514 10:81062597-81062619 CTGTTGATGGAAATGTAAAATGG - Intergenic
1071417515 10:85455090-85455112 CTTTTGATGGTAAGGGTGGGTGG - Intergenic
1072627060 10:97119325-97119347 CTTTTAATGGAAAGGGGCGGGGG + Intronic
1073067956 10:100775003-100775025 CTTGTGAAGGAAAGAGAAGTGGG + Intronic
1073522267 10:104144055-104144077 CTTCAGCTGGAAAGGGAAGAAGG + Intronic
1073613489 10:104968527-104968549 CGTGTGCTGGAAGGGGAAGAGGG - Intronic
1073721619 10:106179189-106179211 CATTTCATGAAAAGGGATGAGGG + Intergenic
1074058597 10:109944196-109944218 CTTATGAGGGAAAAGGAAGGGGG - Intronic
1074156403 10:110804061-110804083 TTGTTGAAGGAAAGGGAAGGGGG - Intronic
1074246060 10:111694680-111694702 CCTGTAATGGAAAGAGAAGAAGG + Intergenic
1074426755 10:113358263-113358285 CGTTTGGTGGGAAGGGCAGAGGG + Intergenic
1074647168 10:115470502-115470524 ATTATGATTGAAAGGGAAAAGGG + Intronic
1074949365 10:118314602-118314624 CTTTTTATGGAAGTGGAAGGGGG - Intronic
1075259480 10:120950007-120950029 CCTTGGAAGGAAAGGCAAGAGGG + Intergenic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1077820686 11:5736927-5736949 CAATTGATGGATAGCGAAGAGGG - Exonic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1078387754 11:10907998-10908020 TTTTTGAAGGACAGGGCAGATGG + Intergenic
1079877132 11:25873703-25873725 CATTTAATGAAAAGGGGAGAAGG + Intergenic
1082002891 11:47403462-47403484 CTGCTGGTGGCAAGGGAAGAGGG + Intergenic
1082632858 11:55561379-55561401 GTTTTGATAGAAAGGCAACAGGG - Intergenic
1083089822 11:60188525-60188547 GTTTTGAGGGAAAGGAAAGTGGG - Intergenic
1083114332 11:60444804-60444826 CTTTTGATGGAAATGGGAAACGG + Intronic
1083209832 11:61176386-61176408 GTTTTGAAGGGAAGGGAGGAGGG - Intergenic
1084075140 11:66769123-66769145 ATTTGGCTGGAATGGGAAGAGGG + Intronic
1085440602 11:76559176-76559198 CAGTTGCTGGAAAGGGAAGTGGG + Intergenic
1086052398 11:82608847-82608869 CTTGTCATGGGAAAGGAAGAGGG + Intergenic
1086761729 11:90639614-90639636 CTTTTGATGCAAATGGAAAAGGG - Intergenic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1088036375 11:105321262-105321284 CTCTTGCTGGAGAGGAAAGAGGG + Intergenic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1089282737 11:117385764-117385786 CTTTGGAAGGAAGGAGAAGATGG + Intronic
1089864960 11:121623809-121623831 CTTGTCAGGGGAAGGGAAGAAGG - Intronic
1089913900 11:122132702-122132724 ATTTTGATGGACAGAGATGAGGG - Intergenic
1090582462 11:128175037-128175059 ATTTTGAAGGCAAAGGAAGATGG - Intergenic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091770474 12:3148085-3148107 CCTTTGAAAGAAAGGGAGGAAGG + Intronic
1092713843 12:11367459-11367481 CTTTCCATGAAAAGGGTAGAAGG - Intronic
1092945019 12:13444938-13444960 CTGTTGATGGAAATGCAAAATGG - Intergenic
1093440468 12:19189514-19189536 CTTTTGGGGGAAAGGGCAGGGGG + Intronic
1094221156 12:27995064-27995086 CTTTGGATGTATAGGGAAGCAGG - Intergenic
1095029710 12:37254665-37254687 CTTTTTGTGGAAAGTGAAGATGG - Intergenic
1095880425 12:47130006-47130028 CTCTAGATGAAAAGGGAACAAGG - Intronic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096464699 12:51841862-51841884 CTTTTGAGGAAAAGGGGAGGAGG - Intergenic
1096765186 12:53881577-53881599 CTTCTGATGGGAATGGAAAATGG + Intergenic
1097759956 12:63451985-63452007 CTGTTGATGGAAATGCAAAATGG + Intergenic
1098150044 12:67537446-67537468 CATTTGATGCAAGGGGGAGAAGG - Intergenic
1098336933 12:69413927-69413949 CCTTTGATGGAAATGTAAGCAGG - Intergenic
1098663001 12:73122526-73122548 CTTTTTATGGGACAGGAAGATGG + Intergenic
1098672076 12:73243926-73243948 CTTTTGATGGCAAAAAAAGAGGG + Intergenic
1099640280 12:85277541-85277563 CTTTTGATGGTAATGGTTGAAGG - Intergenic
1099805529 12:87513976-87513998 CATTAGATAGAAAGGGAAGCAGG - Intergenic
1099859227 12:88207257-88207279 CTCATGATGGAAAGTGAAGCAGG + Intergenic
1100796156 12:98183957-98183979 CTTCTTAGGGAAAGAGAAGAGGG - Intergenic
1103288403 12:119823103-119823125 CCTTTGGTCCAAAGGGAAGAGGG - Intronic
1104111658 12:125710298-125710320 GTTTTTATAGAAAGGGAGGAAGG + Intergenic
1104630858 12:130400962-130400984 CTTTTGGTGGGAAGGTGAGATGG + Intronic
1104654752 12:130565848-130565870 ATTTTGCTGGAGATGGAAGAGGG + Intronic
1105701151 13:22936495-22936517 CTTCTGATGGAGAGTGAACACGG - Intergenic
1105853984 13:24359546-24359568 CTTCTGATGGAGAGTGAACACGG - Intergenic
1106944862 13:34815907-34815929 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1107425109 13:40284647-40284669 CTTTGGATGAAAAGGAAACAGGG - Intergenic
1107455607 13:40551938-40551960 CTTTTTATGTTAAGGGCAGAAGG - Intergenic
1107659457 13:42624192-42624214 CTCATTATGGAAAGGGGAGAAGG - Intergenic
1107945305 13:45412718-45412740 CTTATTATGGAAAAGGAAGATGG - Intronic
1107962315 13:45569534-45569556 CTTTTGATGGAAAGTGAAGCTGG + Intronic
1108165363 13:47687520-47687542 CTTTTGATATTAAGGAAAGATGG + Intergenic
1108376671 13:49820453-49820475 TTGTAGATGGAAAGTGAAGAAGG + Intergenic
1108509088 13:51138629-51138651 CTGTTGATGGAAATGCAAAATGG + Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1108941290 13:55957854-55957876 CTTTTGTTGGAATGGGATAATGG - Intergenic
1109412433 13:61988981-61989003 AGTTTGATGGACAGGGAACAAGG - Intergenic
1109962185 13:69645198-69645220 CTCTGGATGGATAGGGAACATGG + Intergenic
1110248788 13:73357811-73357833 CTATTGTTGGAAAGTGAAGCAGG - Intergenic
1110283153 13:73719139-73719161 CTTTTTGTGGAAAGGTAGGAAGG + Intronic
1111648933 13:91065731-91065753 CTTTTAATGGAATGGGAGGCAGG - Intergenic
1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG + Intergenic
1114686999 14:24542705-24542727 CTTGTGATGGAAGGTGAAGTGGG - Intergenic
1115729482 14:36252980-36253002 CTATGGGTGGAAGGGGAAGAGGG + Intergenic
1116400085 14:44496034-44496056 CTTTTGAGGGAAAGCAAAGAAGG - Intergenic
1116501360 14:45626824-45626846 ATTTTCATAGAAGGGGAAGAAGG + Intergenic
1117232639 14:53736966-53736988 TTTATGTTGGAAAGGGATGAAGG + Intergenic
1117705049 14:58457042-58457064 CTTCTGTTGGAAAGGGAGGAAGG + Intronic
1119956233 14:78801421-78801443 AATCTGATGGAAAGGGAAGCTGG + Intronic
1120413941 14:84194890-84194912 CTTTTGCTGCAATGTGAAGAAGG + Intergenic
1121230984 14:92358254-92358276 CTTTAGATGGATGGAGAAGAAGG - Intronic
1122017786 14:98810846-98810868 CTTTTCAAGGAAAATGAAGAAGG + Intergenic
1122134285 14:99623957-99623979 TTATTGAAGGAAAAGGAAGATGG + Intergenic
1122188506 14:100021199-100021221 CGTTTCATGGTTAGGGAAGAGGG + Intronic
1123509287 15:20979942-20979964 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1123566511 15:21553689-21553711 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1123572364 15:21626815-21626837 CTTTTGGTGGAAATAGAAAATGG - Intergenic
1123602772 15:21990975-21990997 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1123608979 15:22069402-22069424 CTTTTGGTGGAAATAGAAAATGG - Intergenic
1124113010 15:26810295-26810317 GTTTATATGGAAAGGCAAGAGGG + Intronic
1124389262 15:29239221-29239243 CATTTGGTGGCAAGGGAAGGAGG - Intronic
1125388982 15:39171807-39171829 GCTTTGATGGAAAGGGGAGGGGG - Intergenic
1125936818 15:43644306-43644328 CTTGTGGTAGAAAGGGAGGAGGG - Intronic
1126174366 15:45721854-45721876 CTTTGGATGGCATGGGAAGGGGG + Intergenic
1126443621 15:48718378-48718400 ATTTTCAGGGAAAGAGAAGAGGG + Intronic
1126539649 15:49807909-49807931 CCTTTGATGGACAGGGAAGGGGG - Intergenic
1127453087 15:59135348-59135370 CTTATGATAACAAGGGAAGATGG + Exonic
1127496418 15:59516727-59516749 CTTTTGATGGTCAGAGAACAAGG + Exonic
1127743078 15:61932939-61932961 TTATTAGTGGAAAGGGAAGATGG + Intronic
1127831942 15:62758710-62758732 CTTTAGAAGGAAAAGGAAAAAGG + Intronic
1128386375 15:67151637-67151659 CTTTAGAGGGAAAGGAAAAAGGG - Intronic
1128708603 15:69855608-69855630 CTTTTAATGGGAGGAGAAGAGGG - Intergenic
1128775336 15:70316116-70316138 CCTTTGATGGGCAGGGAAGGGGG - Intergenic
1129024246 15:72554315-72554337 CTGTTGATGGAAATGTAAAATGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129766074 15:78168672-78168694 CTCTTGATGCAAAGGGAGGCAGG - Exonic
1129825653 15:78633485-78633507 CTGTTGGTGGGAAGGGAGGAGGG + Intronic
1129941406 15:79500292-79500314 ATCATGATGGAAAGGGAAGCAGG - Intergenic
1131031862 15:89193124-89193146 TTTTTGAAGCAAAGGGAAGAGGG - Intronic
1131768098 15:95702034-95702056 TTTCTTACGGAAAGGGAAGAGGG + Intergenic
1132040225 15:98518893-98518915 CTTTTTTTAGAAAGGGAAAAAGG + Intergenic
1202974875 15_KI270727v1_random:280777-280799 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1202981220 15_KI270727v1_random:361202-361224 CTTTTGGTGGAAATAGAAAATGG - Intergenic
1136218878 16:28814672-28814694 ATTTTGGTGGCAGGGGAAGATGG + Intergenic
1136713635 16:32259796-32259818 CTTCGGAAGGCAAGGGAAGATGG - Intergenic
1136754276 16:32669635-32669657 CTTCGGAAGGCAAGGGAAGATGG + Intergenic
1136813837 16:33200730-33200752 CTTCGGAAGGCAAGGGAAGATGG - Intronic
1136820313 16:33310810-33310832 CTTCGGAAGGCAAGGGAAGATGG - Intergenic
1136826876 16:33367349-33367371 CTTCGGAAGGCAAGGGAAGATGG - Intergenic
1136831942 16:33466120-33466142 CTTCGGAAGGCAAGGGAAGATGG - Intergenic
1137023707 16:35453862-35453884 CTTCTGAAGGCAAGGAAAGATGG + Intergenic
1137727881 16:50669331-50669353 CTTATGGTGGAAGGGGAAGGGGG + Intronic
1138215805 16:55204354-55204376 CTTTTTATGTGAAGGGCAGAGGG - Intergenic
1138544393 16:57707012-57707034 CTATGGAAGGAAAGGAAAGAAGG - Intronic
1138725945 16:59139316-59139338 CTTTTGCTGGATAGGGAGGTAGG + Intergenic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1139252894 16:65513194-65513216 ATTGTGATGGGAAGGGGAGAAGG + Intergenic
1139556374 16:67713471-67713493 CTTTTGATGGCATTGGAAGTCGG - Intronic
1140851184 16:78936087-78936109 GTTGTGATTGAAAGGAAAGAAGG + Intronic
1140873091 16:79124653-79124675 CTGTTGATGGCAAGAAAAGAAGG + Intronic
1141258315 16:82425120-82425142 CTTTTGAGGGTAAGGCAAGATGG + Intergenic
1202992413 16_KI270728v1_random:23704-23726 CTTCGGAAGGCAAGGGAAGATGG - Intergenic
1203056423 16_KI270728v1_random:929966-929988 CTTCGGAAGGCAAGGGAAGATGG + Intergenic
1142871681 17:2825234-2825256 CCTGTGTTTGAAAGGGAAGATGG - Intronic
1143820146 17:9554590-9554612 CTTTTGATGTAAGGGAAAGGAGG - Intronic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1145897493 17:28468500-28468522 CTGTTGGTGGAAATGTAAGATGG + Intronic
1146516246 17:33491817-33491839 CTTAAGAGGGAAAGGCAAGAGGG + Intronic
1147020165 17:37525449-37525471 CTTTTTATGGAATGGTAGGATGG + Intronic
1147983212 17:44288032-44288054 TTCTTCATGGAAAGGGGAGATGG - Intergenic
1148515060 17:48209189-48209211 TTTTTGATGGAAAGAGGAGGAGG - Intronic
1149062081 17:52434437-52434459 CATATGGTGGAAAGGGCAGAAGG - Intergenic
1149382804 17:56110760-56110782 CTTTTGCAGGAAAGGAAAGTTGG + Intergenic
1149442614 17:56687582-56687604 CTTCTCATGGAAAAGGAAAAGGG + Intergenic
1149755084 17:59179823-59179845 CCTTTGCTGGAAAAGGAAGAGGG - Intronic
1149755374 17:59181691-59181713 CCTTTGCTGGAAAAGGAAGAGGG - Intronic
1149883371 17:60315479-60315501 CTGTTGATGGAAATGTAAAAGGG + Intronic
1150179151 17:63096823-63096845 CTTCTGGTGGAAATGTAAGACGG - Intronic
1150932440 17:69599705-69599727 CTTATGGTGGAAGGGGAAGCAGG - Intergenic
1150976610 17:70094353-70094375 CTTTGGAGGGTAAGGGAAGTTGG + Intronic
1151244830 17:72786456-72786478 ATCTTGATGGAAAGGCAAGATGG - Intronic
1151965575 17:77429547-77429569 GCTTTGATCGAAAGGGAACAGGG + Intronic
1152260035 17:79261842-79261864 CTTCTGATGGAACCCGAAGAGGG + Intronic
1153840045 18:8999083-8999105 CTTTTGATGACAAGGATAGATGG - Intergenic
1156210710 18:34938542-34938564 CTTATGTTGGAAAAGGAAGTGGG + Intergenic
1156727599 18:40148113-40148135 GTTTTGAAGGAGAGGGAAAATGG - Intergenic
1157014986 18:43701073-43701095 CATTTGATGGGAAGTTAAGATGG - Intergenic
1157219770 18:45820099-45820121 CATGTGATGGATAGGGTAGAGGG + Intergenic
1158267731 18:55678640-55678662 CTTTTTATAGATAAGGAAGAGGG - Intergenic
1158366002 18:56736780-56736802 CTTTTGATGGAAAAAGAGGAGGG + Intronic
1158528748 18:58239266-58239288 TTTTTGCTGTAAAAGGAAGATGG - Intronic
1158882878 18:61797938-61797960 CTTTAGATGGAAAGGCAAATAGG + Intergenic
1162294538 19:9804040-9804062 ATATTAAGGGAAAGGGAAGATGG + Intergenic
1163251585 19:16129083-16129105 CTTCTGATGGTCAGGGAAAAAGG - Intronic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1163888740 19:19992250-19992272 CTTTTGATGCAAGGGGAGGGTGG + Intergenic
1163935215 19:20436345-20436367 CTTTTGATGGAAGGTGAGGGTGG - Intergenic
1164911118 19:32012724-32012746 CTTTTCAAGGACAAGGAAGATGG - Intergenic
1165212965 19:34250189-34250211 CTTTTAGGTGAAAGGGAAGAAGG - Intergenic
1165470604 19:36002125-36002147 CTTTTTATGCTAAGGGAAGGGGG - Intergenic
926561341 2:14420635-14420657 CATATGATGGAAATGGAGGAGGG - Intergenic
926748609 2:16180653-16180675 CTCTTGTTGGAAAAGCAAGAAGG + Intergenic
927464870 2:23329364-23329386 TCTTTAATGGAAAGGGAAGCTGG + Intergenic
928095652 2:28403445-28403467 CTGATGATGGGAAGGGAGGAGGG + Intronic
928669557 2:33587387-33587409 CTTTTGATGGCAAGATATGATGG - Intronic
928738509 2:34321447-34321469 CTTTGGATGGAAATGGATTAGGG + Intergenic
929126415 2:38526594-38526616 TTTTTGTTAGAAAGGGAGGAGGG + Intergenic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931509181 2:62970990-62971012 ATTTTTATGGAAAGGAAACAAGG + Intronic
932008811 2:67954853-67954875 CTTGTAATGTAAAGTGAAGAAGG + Intergenic
932130425 2:69182351-69182373 GTTTTGAGGGCCAGGGAAGAGGG - Intronic
932264704 2:70357706-70357728 CTTTTTATGGAAAGGTCAGCCGG + Intergenic
932548587 2:72742503-72742525 GTTTTGCTGGGAAGGGAAGAGGG - Intronic
933449805 2:82433624-82433646 CTTTTGGTGGAAATGCAAAATGG + Intergenic
933549516 2:83757998-83758020 CTTTTGTTGGAAATGTAAAATGG - Intergenic
934528198 2:95065767-95065789 TTTTTGATGGGAATGGAAAATGG - Intergenic
936637160 2:114271988-114272010 ATTTTGATGAAAAGGAAAAAGGG - Intergenic
936704629 2:115057567-115057589 ATTTTTATGGAAAGGACAGAAGG + Intronic
937028002 2:118715105-118715127 CTTTTCATGGGAAGAGAAGTGGG - Intergenic
937324678 2:120983411-120983433 CTTGTGGTGGAAAGGGAATTTGG - Intronic
937612165 2:123875387-123875409 CTCATGATGGAAGGAGAAGACGG - Intergenic
937843662 2:126553715-126553737 ATTTTGAAGGAAGGGGGAGAAGG + Intergenic
937886177 2:126901371-126901393 CTTTTACTGGCAAAGGAAGAAGG + Exonic
938881666 2:135595847-135595869 GTTTTGATGGAAAGTGACTAGGG - Intronic
939159038 2:138563663-138563685 CTGTTGATGGAAATGTAAAATGG + Intronic
940150529 2:150595509-150595531 CTCTTGATGGACAGTGAAGGGGG - Intergenic
940215328 2:151297669-151297691 GTTTTAATGGAAAGTTAAGATGG + Intergenic
940761535 2:157743930-157743952 CTTTTGAAGGAAAGGAAGGATGG - Intronic
941595938 2:167477205-167477227 CTTTTGGACAAAAGGGAAGAAGG + Intergenic
941748623 2:169112559-169112581 GGTTTGATGGAAAGTGGAGAAGG - Intergenic
941932154 2:170952984-170953006 GTTTTGATTGTGAGGGAAGAAGG + Intronic
942198139 2:173543322-173543344 CATGTTATGGAAAGGGAAGAGGG - Intergenic
942963225 2:181858226-181858248 TATTTGATGTAAAGGCAAGAGGG - Intergenic
943755802 2:191555757-191555779 ATTTTGATGGTGAGGGAATATGG + Intergenic
946462899 2:219885693-219885715 CTTATGATGGAAAGGGCCGAGGG - Intergenic
947081564 2:226403345-226403367 CTTTTAGTGGAATGGAAAGAAGG + Intergenic
947256782 2:228174795-228174817 GTTCTGATGGAAAAGGCAGATGG + Intronic
947547426 2:231020253-231020275 CTTTTTAGGGGAAAGGAAGATGG - Intronic
948046304 2:234948024-234948046 CTTATGGTGGAAAGCGAAGTGGG + Intergenic
948104519 2:235402545-235402567 CTTTTGATTGAAAGGGATCCAGG - Intergenic
948938954 2:241186761-241186783 CTTCTGAGGGAAAGGAAGGAAGG - Intergenic
1168761871 20:354830-354852 CTGTTTATTGAAAGGGAAGGTGG - Exonic
1168828394 20:829848-829870 CATCTGATGCAAAGGGAAGTTGG - Intergenic
1169262868 20:4150209-4150231 GTTTTGCTGTGAAGGGAAGAAGG - Intronic
1169485559 20:6028255-6028277 CTTTTTATGGGAGGGGGAGAAGG + Intronic
1170799560 20:19579772-19579794 TGTTTCATGGAAAGGGAAGTGGG + Intronic
1171171452 20:23019214-23019236 CATTGGACGGTAAGGGAAGAGGG + Intergenic
1171788964 20:29500962-29500984 CTCATGATGGAAGGTGAAGAGGG + Intergenic
1172984310 20:38971017-38971039 TTTTTGTTTGAAAGGGAAAAAGG - Intronic
1172997379 20:39081255-39081277 CTTTTGATAGAAAGGGATAGTGG + Intergenic
1175628763 20:60513269-60513291 CATTGACTGGAAAGGGAAGAGGG - Intergenic
1176076210 20:63249406-63249428 CTTTTCCTGTAAAGGGCAGATGG - Intronic
1176274282 20:64255201-64255223 CTTTGAATGGAATGGGAAGCAGG + Intergenic
1176677848 21:9797306-9797328 CTTTTGAAGAAAATGGAAGTAGG - Intergenic
1177093733 21:16804302-16804324 CTTATGATAGGTAGGGAAGAAGG - Intergenic
1178080755 21:29062231-29062253 TTTTTGATAGAAAAGGAAGATGG - Exonic
1178396246 21:32246263-32246285 CATTTGCTGGAAAGAGAAGCTGG + Intergenic
1178701415 21:34836338-34836360 CTTCTGAGGGAAAGGGATGATGG - Intronic
1179350684 21:40607922-40607944 CTTTGGATGGAGAAGGAAGTTGG + Intronic
1179549490 21:42135050-42135072 CCAGTGAGGGAAAGGGAAGAAGG - Intronic
1180860818 22:19080882-19080904 CCAGTGATGGAAAGTGAAGAAGG + Intronic
1182311725 22:29413383-29413405 GTTTTGAGGGAAAGGAAAGTGGG + Intronic
1182585432 22:31341994-31342016 CTGTTGGTGGCAAGGGGAGAGGG - Intronic
1182688613 22:32140450-32140472 GTTTTGAGGGAAAGGAAAGTGGG - Intergenic
1183087217 22:35493802-35493824 CTTCTGAGAGAGAGGGAAGAAGG - Intergenic
949371747 3:3342365-3342387 CTTTTTATAGGAAGGGAAGGTGG - Intergenic
949714797 3:6917505-6917527 TTTTTTTTGGAAAGAGAAGATGG + Intronic
950935675 3:16836493-16836515 TTTGTGAGGGAAAGGGAAAAGGG + Intronic
952625356 3:35396298-35396320 CAGGTTATGGAAAGGGAAGAGGG + Intergenic
952656637 3:35794000-35794022 CCTTTGATGGAAGAGGAACAAGG + Exonic
955585282 3:60471126-60471148 CTTCTGAAACAAAGGGAAGAAGG + Intronic
955590585 3:60530707-60530729 CTTTAGATGGCAAGTCAAGATGG + Intronic
955594336 3:60572704-60572726 CCATTGATGGAAAGGATAGAAGG + Intronic
955600292 3:60637838-60637860 CTTTTCACGGAAAGGGACCAGGG + Intronic
956333906 3:68142353-68142375 CATGTGATGGAAAGGCAAGCTGG + Intronic
956428080 3:69157248-69157270 CACTTGCTGGAAAGGGAAGTAGG + Intergenic
956800570 3:72754307-72754329 CCTTTGGTGGAACGGGAAGAGGG - Intronic
957563222 3:81852209-81852231 CTTTTGATCAAAATGAAAGAAGG - Intergenic
959032643 3:101318532-101318554 ACTTTGATGAGAAGGGAAGAAGG + Intronic
959171112 3:102845299-102845321 ATTTTGAAGGAAAGGTAAAATGG + Intergenic
959758437 3:109927459-109927481 GCTTTGATGGAAAGGGAACAGGG - Intergenic
961197573 3:125015582-125015604 CTATTGATGGGGATGGAAGAGGG + Intronic
961918746 3:130404116-130404138 CCTTCCATGGAAAGGGAAGTCGG + Intronic
962865524 3:139445467-139445489 CCTCTGAAGTAAAGGGAAGAAGG - Intergenic
963640833 3:147859468-147859490 CTCATGGTGGAAAGTGAAGAGGG + Intergenic
963795696 3:149628609-149628631 CTTTTGAAGGTTAGGGAAAATGG + Intronic
963939964 3:151087440-151087462 CTTTTGCTGGCCAGGGACGAAGG + Intronic
964080306 3:152746206-152746228 CTCTTAAAGGAAAGTGAAGAGGG + Intergenic
964175411 3:153821823-153821845 ATTTGGCTGGTAAGGGAAGACGG + Intergenic
964298330 3:155258928-155258950 CTTTAGAAGGAAAGGGCAGCAGG + Intergenic
965189036 3:165505492-165505514 ATTATGGTGGAAGGGGAAGAAGG + Intergenic
966175718 3:177136006-177136028 CTATTGGAGTAAAGGGAAGATGG - Intronic
966285563 3:178291353-178291375 TTTTTGATGGAAAGGTAAAATGG - Intergenic
966949179 3:184800709-184800731 CTTCTGATGGGAAGGGAAAGCGG - Intergenic
967199750 3:187062225-187062247 CTGTTGATGGGAATGGAAAATGG + Intronic
968427340 4:532668-532690 CTCTGCATGGAAAGGGAGGAAGG + Intronic
969129969 4:4983941-4983963 CTGTTGAAGGAAAGCGAACACGG + Intergenic
969527708 4:7712426-7712448 CGCTTGATGGACAGGGAAGGAGG - Intronic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
970022826 4:11588248-11588270 ATTTTGCTGCAAAGGGAAGAGGG - Intergenic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970125854 4:12809823-12809845 CTTTGCAAGGAAAGGGTAGAAGG + Intergenic
970177357 4:13352866-13352888 CTTTTGATGGAATACGAAGAAGG - Intergenic
970432441 4:16001270-16001292 CTCTGGAAGGAAAGAGAAGATGG + Intronic
970450451 4:16161566-16161588 CTTTTGTTGGTAAAGGGAGATGG + Exonic
970778936 4:19712160-19712182 ATTTTGATACAAAGGGAGGAAGG - Intergenic
971140881 4:23923725-23923747 CCTCAGATGGAAAAGGAAGAGGG + Intergenic
971377802 4:26069141-26069163 CTTTTGCTGGATAGGGAACTGGG + Intergenic
971499557 4:27303727-27303749 CTTTTAAGGGAAAGAGAAGAGGG + Intergenic
971608180 4:28685726-28685748 CTTTTGATAGAAAGGGGAGATGG - Intergenic
971763598 4:30801457-30801479 ATTGTGATAGAAAGGAAAGAAGG + Intronic
973185411 4:47322115-47322137 CTTTTGTGGGGAAGGGATGAGGG + Intronic
974888840 4:67853718-67853740 CTTTAGTTGGATAAGGAAGAGGG + Intronic
975244463 4:72103399-72103421 CTTGTGATGACACGGGAAGAAGG + Intronic
975493169 4:75010981-75011003 CTTATGGTGGAAGGGGAAGTGGG + Intronic
975587618 4:75966080-75966102 GTTTTGAAGGAAAAGGAAGCAGG - Intronic
975924123 4:79428301-79428323 TGTTTGAAGGAAAGGGAAGAAGG - Intergenic
976482388 4:85559818-85559840 ATTTTAATGGAAAGTGAAGACGG - Intronic
978753428 4:112278025-112278047 TTTCTGATGGAGAAGGAAGATGG - Exonic
980027571 4:127783667-127783689 CTTTTTATGGAAAGGTAATTTGG + Intronic
980794409 4:137662284-137662306 GTTTTTATGGACTGGGAAGAGGG - Intergenic
981112109 4:140947424-140947446 CCTTTGATGCAAAGGGGATAGGG + Intronic
981852386 4:149246230-149246252 CTTTTAGTGGAAAGGGGAGCTGG - Intergenic
982187390 4:152816383-152816405 CTTTTCAAGGAATGGCAAGAAGG - Intronic
983577317 4:169272477-169272499 CTTCTAATGGAAGGGGAAGTGGG - Intergenic
983736246 4:171065483-171065505 CTGTTGATGGGAATGGAAAATGG + Intergenic
984643697 4:182198369-182198391 CTTTTGATTGATTGGGAATAAGG + Intronic
985397678 4:189561483-189561505 CTTTTGAAGAAAATGGAAGTAGG + Intergenic
985443940 4:190009137-190009159 ATTTTAATGGGAAGGGGAGAAGG - Intergenic
986371795 5:7087655-7087677 CAGTTGGTGGAAAGGGGAGATGG + Intergenic
986482552 5:8203405-8203427 ATTATGGTGGAAAGGGAAGCAGG + Intergenic
986506098 5:8453331-8453353 TATTTTATGGAAAGGGAAGCAGG - Intergenic
986709365 5:10477480-10477502 CTGTTGATGGACAGGAAGGAAGG + Intergenic
987553459 5:19413805-19413827 ATCATGATGGAAAGCGAAGAGGG - Intergenic
987797439 5:22647228-22647250 CTTTAGCAGGAAAGGGAGGAAGG + Intronic
988185680 5:27858675-27858697 CTTTTGAAGGAAATGGAATAAGG + Intergenic
988833938 5:35013400-35013422 CTTTTGAGGTATATGGAAGAGGG - Intronic
988885431 5:35552406-35552428 CTTTCGAAGAAAAGAGAAGAAGG - Intergenic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
991311808 5:65251904-65251926 TCTTTGGTGGAAAGGGAACAGGG - Intronic
991354271 5:65751344-65751366 CTTGTGATGATGAGGGAAGATGG + Intronic
992090219 5:73310472-73310494 CTTTTGGTGGAAGGTGAGGAAGG + Intergenic
992189545 5:74277539-74277561 CTTTTGATGCATAGGGAAAGGGG + Intergenic
993204830 5:84865113-84865135 CTGGTGATGGAGAGGGGAGAGGG - Intergenic
993756399 5:91735475-91735497 GTTTTCATGGACTGGGAAGAGGG + Intergenic
993840849 5:92876645-92876667 CTTATGAAGGAAAGGTAAGCTGG - Intergenic
993928397 5:93902020-93902042 TATTTGATGGAAAGGAAAAATGG + Intronic
994362553 5:98869704-98869726 TTTTCTATGGAAAGGGAATATGG - Intronic
995550889 5:113280240-113280262 TTTTTCATGGAAAGGGAACCTGG + Intronic
997895649 5:137714228-137714250 CTGTTGATGGAAATGTAAAATGG + Intronic
998031342 5:138871546-138871568 CTGCTGCTGAAAAGGGAAGAGGG - Exonic
998310718 5:141127203-141127225 CTTTTGATAGTAAAAGAAGAGGG - Intronic
999726734 5:154444855-154444877 CGTTTTATGGGCAGGGAAGAGGG - Intergenic
1000128695 5:158273655-158273677 TTTTTGAGGGTGAGGGAAGAGGG + Intergenic
1000388394 5:160697764-160697786 CCTTTGTGGGAAAGGAAAGATGG + Intronic
1000719542 5:164690058-164690080 CTGTTAATGGAAATGTAAGATGG + Intergenic
1000932693 5:167271095-167271117 CATTCAATGGAATGGGAAGAGGG + Intergenic
1001172844 5:169437486-169437508 TTTTTGGTGGAAGGGGAAGTTGG + Intergenic
1001189553 5:169615739-169615761 ATCATGATGGAAAGGGAAGCAGG - Intergenic
1001558511 5:172653136-172653158 GTTTTGAGGGAAAGGTAAGTGGG + Intronic
1001823548 5:174727789-174727811 CTCTTGTTGGAAATGGAAGCTGG + Intronic
1002624038 5:180511946-180511968 CTTTTGATGGAAAGGGAAGAAGG - Intronic
1003787791 6:9506404-9506426 CTTGTGATGGAGATGGAAAAGGG + Intergenic
1004002316 6:11606648-11606670 CTTTTGTTGGAAAAGGTAGCAGG - Intergenic
1004277785 6:14253603-14253625 GTTTTGTAGGAAAGAGAAGAAGG - Intergenic
1004370111 6:15044897-15044919 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1004794404 6:19064969-19064991 CTTTTGTTGTAAAAGGAAGAAGG + Intergenic
1006175621 6:32119773-32119795 CGAGTGATGGGAAGGGAAGAGGG - Intronic
1006570138 6:34996029-34996051 CTTCTGATGGAAACGCAAAATGG - Intronic
1007266346 6:40599211-40599233 AACTTGATGGAGAGGGAAGAAGG - Intergenic
1007674805 6:43584684-43584706 CTTGTGATGGAAAGGAAGGAGGG - Intronic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008650442 6:53555900-53555922 CTTTGGATGGAATGGGAGGCAGG - Intronic
1008683947 6:53903628-53903650 CTTTAGGTGGAAAGAGCAGAAGG + Intronic
1010700721 6:79042852-79042874 CTTTTGATCGAACTGGCAGACGG - Exonic
1010899468 6:81408409-81408431 CAGATGATGGAAATGGAAGAAGG - Intergenic
1010941136 6:81918878-81918900 CTTCTGAAGGAAGGAGAAGAGGG - Intergenic
1011239986 6:85261131-85261153 CTTTTGATGAAAAGTGGAGTAGG + Intergenic
1011389648 6:86837927-86837949 CTTTAGAGGAAAATGGAAGAGGG + Intergenic
1011526512 6:88271153-88271175 CTTTTGATGGAAATGGAAGTGGG + Intergenic
1011972255 6:93240976-93240998 CTTTACAGGGAAAGGGGAGAAGG - Exonic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012286753 6:97399630-97399652 ATTTTAATGGATAGGGATGATGG - Intergenic
1013575031 6:111474433-111474455 CTTTTGTGGGAAAGGGATCATGG - Intronic
1014330658 6:120059851-120059873 CTGGTGATAGAAAGTGAAGAGGG + Intergenic
1014344733 6:120253914-120253936 ATATTGATGGAAAGGGCATATGG + Intergenic
1015075490 6:129151633-129151655 CTTATGATCAAAGGGGAAGAGGG + Intronic
1015321270 6:131878080-131878102 TTTTTGATGAAAAGGACAGAAGG - Intronic
1015334457 6:132021323-132021345 CTTTTCATTGAAAGAGATGAAGG - Intergenic
1015892223 6:137980303-137980325 GTTTTGCTGTAAAAGGAAGAAGG - Intergenic
1016197411 6:141362024-141362046 ATTTTGATGTGAAGGGAAGTAGG - Intergenic
1016505350 6:144772909-144772931 CTTTTTATTGAAATGGGAGAGGG - Intronic
1016607031 6:145941581-145941603 CTTTTGAGGGCTGGGGAAGAAGG - Intronic
1016860973 6:148718510-148718532 GTCATGATGGAAAGGGAAGCAGG + Intergenic
1017316758 6:153039913-153039935 CTTATAAAGAAAAGGGAAGAAGG + Intronic
1020045382 7:5036657-5036679 CCTTTGCTGGAAAAGGAAGAGGG - Intronic
1020093950 7:5357271-5357293 CTTTAGCTGGAGAGGGAAGGTGG + Exonic
1020290776 7:6720886-6720908 TTTTTGCTGGAAAAGGAAGAGGG - Intergenic
1020517991 7:9149217-9149239 CTTATCATGGAAAGGAGAGAAGG + Intergenic
1021986027 7:26099372-26099394 CTTTTGCTGGAGCTGGAAGATGG - Intergenic
1022355804 7:29613345-29613367 ATTTGGATACAAAGGGAAGAAGG + Intergenic
1023545398 7:41312969-41312991 AATTTTATGGTAAGGGAAGAAGG + Intergenic
1023824692 7:44001100-44001122 CCTTGGCTGGAAAAGGAAGAGGG + Exonic
1023824932 7:44002624-44002646 CTTTTGCTGGAAAAGGAAGATGG + Exonic
1024455125 7:49597168-49597190 ATTTTGAAGGAAGGGGAATAAGG - Intergenic
1025075149 7:55936349-55936371 CTTTTGAGGGAAGAGGTAGAAGG + Intronic
1025783652 7:64623916-64623938 CTTTTATTGCCAAGGGAAGAGGG - Intergenic
1026088242 7:67279852-67279874 CCTTGGCTGGAAAAGGAAGAAGG + Intergenic
1026088483 7:67281408-67281430 CTTTTGCTGGAAAAGGAAGAGGG + Intergenic
1026346712 7:69480792-69480814 CTTTGGATAGAAAGGGAGGCAGG + Intergenic
1026725769 7:72868944-72868966 CTTTTGCTGGAAAAGGAAGATGG - Intergenic
1026747842 7:73026797-73026819 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1026751492 7:73054936-73054958 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1026755141 7:73083050-73083072 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1027034048 7:74912091-74912113 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1027088615 7:75282402-75282424 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027092258 7:75310330-75310352 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027095901 7:75338297-75338319 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027117842 7:75495190-75495212 CCTTGGCTGGAAAAGGAAGAGGG + Intergenic
1027118083 7:75496708-75496730 CTTTTGCTGGAAAAGGAAGATGG + Intergenic
1027273721 7:76538760-76538782 CTTTTGCTGGAAAAGGAAGAGGG - Intergenic
1027273964 7:76540290-76540312 CCTTGGCTGGAAAAGGAAGAAGG - Intergenic
1027323440 7:77029395-77029417 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1027327170 7:77057811-77057833 CTTTTGCTGGAAAAGGAAGAGGG - Intergenic
1027327409 7:77059342-77059364 CCTTGGCTGGAAAAGGAAGAAGG - Intergenic
1029719419 7:102353332-102353354 CTTTTGCTGGAAAAGGAAGATGG - Intergenic
1029719656 7:102354865-102354887 CCTTGGCTGGAAAAGGAAGAGGG - Intergenic
1029752958 7:102554393-102554415 CCTTGGCTGGAAAAGGAAGAGGG + Exonic
1029753195 7:102555934-102555956 CTTTTGCTGGAAAAGGAAGATGG + Exonic
1029770909 7:102653485-102653507 CCTTGGCTGGAAAAGGAAGAGGG + Exonic
1029771147 7:102655018-102655040 CTTTTGCTGGAAAAGGAAGATGG + Exonic
1030228968 7:107185135-107185157 CTTTTGAGGGGAAGAAAAGAGGG + Intronic
1030798118 7:113815086-113815108 CTTATGATGGAAGGTGAAGTGGG + Intergenic
1032066356 7:128774467-128774489 CATTTGATAGTCAGGGAAGAAGG - Intronic
1032383791 7:131507646-131507668 CCTTTGCTAGAAAAGGAAGATGG - Intronic
1033372756 7:140726190-140726212 CTTTTGATGGTCAGGCATGATGG - Intronic
1034873827 7:154707097-154707119 TTTTTGAAGGAAAGGGCAGAGGG + Intronic
1035304470 7:157922638-157922660 CTTTTGCTGGGAAGGAAAAAGGG + Intronic
1035388089 7:158488147-158488169 CTTTTGATGATAATGGAAGCAGG - Intronic
1035400552 7:158562466-158562488 TTTTTCATGTAAAGGGCAGATGG - Intronic
1035676987 8:1462918-1462940 CTTCTCATGGAATGGGATGAGGG - Intergenic
1036503798 8:9337015-9337037 CCTTTGATGGCAAGTGAGGAAGG + Intergenic
1038624850 8:29181294-29181316 CTTTTCATGGAAAAGAAATATGG - Intronic
1039167349 8:34698287-34698309 CTCTTCCTGGAAATGGAAGAGGG - Intergenic
1039271647 8:35887828-35887850 CTTTTGGTGTTAAGGGAAAAAGG + Intergenic
1040802307 8:51356755-51356777 CTTTTAAGGAAAAGGGAAAAGGG - Intronic
1040891517 8:52322076-52322098 CTGTTGATTGAAATGGAAGTGGG + Intronic
1041208416 8:55522363-55522385 CTTTTGTGGGAAAGGCAATAAGG + Intronic
1041797321 8:61759253-61759275 CTGTTGATGGAAATATAAGATGG - Intergenic
1041831720 8:62162247-62162269 CTTTTGGTGGGAAGGGACTAAGG - Intergenic
1041846552 8:62335785-62335807 GTTTTTATGGAAAAGGAGGATGG - Intronic
1042327435 8:67542913-67542935 AGTTTGATGGAAAGGGGTGATGG - Intronic
1043912187 8:85875820-85875842 CTTTTGATGGTATTTGAAGAGGG + Intergenic
1043975900 8:86584214-86584236 AATTTCATAGAAAGGGAAGAAGG - Intronic
1044754879 8:95451110-95451132 CTATTGATGGAAGGAGAGGAGGG - Intergenic
1045742883 8:105383017-105383039 TATTTGATGGAAAGGGAAATAGG + Intronic
1045829985 8:106447290-106447312 CTTTTAATATAAAGGGAAAATGG + Intronic
1046302075 8:112307879-112307901 TTTTTGGTCGAAATGGAAGATGG - Intronic
1046699742 8:117386768-117386790 TTGTTGATCCAAAGGGAAGATGG - Intergenic
1046774926 8:118153761-118153783 CTTTTGAAGGATATGGAGGAAGG - Intergenic
1047128882 8:121995726-121995748 GTCATGGTGGAAAGGGAAGAGGG + Intergenic
1047182353 8:122601605-122601627 CTTTTTCTGCAAAGGCAAGATGG - Intergenic
1047336100 8:123938122-123938144 CTTTTCAAGGACAGAGAAGAAGG + Intronic
1048147956 8:131863946-131863968 CTCTTGCTGAAAATGGAAGAAGG - Intergenic
1048760769 8:137792634-137792656 GTTTTGTTAGCAAGGGAAGAGGG - Intergenic
1048854819 8:138677421-138677443 ACTTTGATGGAAAAGGAAAAAGG + Intronic
1048909699 8:139123301-139123323 TAATTGATGGAAAGGGAAGATGG + Intergenic
1050260786 9:3838730-3838752 ATTTTGATGGGAAAGGAAAAGGG + Intronic
1051194514 9:14548210-14548232 CTCATGGTGGAAAGTGAAGAGGG + Intergenic
1051375692 9:16400204-16400226 CTTGTGTTGGATTGGGAAGAAGG - Intergenic
1053377587 9:37621060-37621082 AAATTGATGGAGAGGGAAGAAGG + Intronic
1056030740 9:82550860-82550882 CTTCTGAAGCAAATGGAAGAAGG - Intergenic
1056162171 9:83907551-83907573 CATTTGTTGGAAATGGGAGAAGG - Intronic
1056251266 9:84750712-84750734 CTTTTGCTGTAAAGGTCAGATGG - Intronic
1056358168 9:85823930-85823952 CATTTGTTGGAAATGGGAGAAGG + Intergenic
1056886819 9:90450805-90450827 CATTTGGTGGAAATAGAAGATGG + Intergenic
1056940322 9:90949932-90949954 CTTATGAGGGAAAGTGGAGAAGG - Intergenic
1057398785 9:94704065-94704087 CTTTTAATGTTAAGGGCAGAGGG - Intergenic
1058304307 9:103418121-103418143 ATTATGGTGGAAAGGGAAGCAGG - Intergenic
1058543204 9:106033581-106033603 CTTGCGAAGGAAAGGCAAGAAGG - Intergenic
1059759608 9:117325535-117325557 AGTCTGCTGGAAAGGGAAGAGGG - Intronic
1059904190 9:118963651-118963673 ATTTTGACAGACAGGGAAGAAGG - Intergenic
1060034778 9:120245353-120245375 CTTTTGATGGGAATAGAAAATGG + Intergenic
1060152452 9:121297499-121297521 CGTTTGCTGGAAAGGGAAGAAGG - Intronic
1060298339 9:122358273-122358295 CTCATGATGGCATGGGAAGAAGG + Intergenic
1060969183 9:127728483-127728505 CTATTGATGGCAAGGGATGCTGG - Intronic
1061504884 9:131026240-131026262 CATTTTATGGAAGGGGAAGGAGG - Intronic
1061999469 9:134208646-134208668 CTATTTAAGGAATGGGAAGACGG - Intergenic
1188507590 X:30899250-30899272 CTGATGTTGGAAAGGGAAAAGGG + Intronic
1188580440 X:31705372-31705394 CTTTTGATGGGAAATGAACAGGG + Intronic
1189055118 X:37691125-37691147 CAGTTGATGGAAATGAAAGAAGG - Intronic
1189076919 X:37925755-37925777 GACTTGAGGGAAAGGGAAGAGGG - Intronic
1189094581 X:38124762-38124784 ACTTTGAGGGACAGGGAAGATGG + Intronic
1189319625 X:40079869-40079891 CTTTTGTTAGAAAGGGCAGCAGG - Intronic
1189612126 X:42748329-42748351 ATCATGATGGAAAGGGAAGCAGG - Intergenic
1189675302 X:43455277-43455299 CTTTTGATGGAGAGACTAGAAGG - Intergenic
1190236070 X:48616748-48616770 CAGTTGATGTAAAGGGAAGGAGG + Intergenic
1191640906 X:63429132-63429154 ATTTTGTTGGAAAGGGGAGGAGG + Intergenic
1191952998 X:66614928-66614950 ATTTTGAAGGAAAAGGAGGAAGG - Intronic
1193225093 X:78973023-78973045 CTTATGTTGGAAAGTGAAGTGGG + Intergenic
1193226245 X:78987647-78987669 ATTTTGATGGAGATGGAAGGAGG - Intergenic
1193410973 X:81162575-81162597 CCTCTCATGGAAATGGAAGAGGG - Intronic
1193686177 X:84579757-84579779 CTTATGATTAAAAGGGAAGTAGG + Intergenic
1194092035 X:89589927-89589949 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1194127561 X:90039144-90039166 CTTGTGATGGATAGAGATGAAGG + Intergenic
1194922644 X:99785807-99785829 CTGTTGATGGAAAGGTAAAATGG - Intergenic
1195150696 X:102066712-102066734 CTTTGAATAGAAAGGGAGGAAGG - Intergenic
1197366397 X:125568719-125568741 CTTAACATGGAAAGGAAAGATGG + Intergenic
1197427275 X:126313067-126313089 CTTTTGATAGGAAGGGTCGAAGG - Intergenic
1197430283 X:126354236-126354258 CTGTTGATGGGAAGGCAAAATGG + Intergenic
1198294354 X:135271209-135271231 CTTTTTATGGCAACTGAAGATGG - Intronic
1198308115 X:135402491-135402513 CTTTTTATGGCAACTGAAGATGG - Intergenic
1198479085 X:137024079-137024101 CTTTTGCTGGAAAGGAATAACGG - Intergenic
1198558867 X:137826474-137826496 ATTTGGCTGGAGAGGGAAGAAGG - Intergenic
1199400653 X:147395049-147395071 CTTATGTTGAAAAGGGAAGCAGG + Intergenic
1199441900 X:147877927-147877949 ATTATGATGGAAAGTGAAGAGGG - Intergenic
1199708674 X:150452425-150452447 ATGGTGATGGAAAGGGTAGAAGG + Intronic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1200056053 X:153461779-153461801 CTGCTGCTGGAAAAGGAAGATGG + Intronic
1200397380 X:155999137-155999159 CCTGTGATGGGGAGGGAAGATGG + Intronic
1200444667 Y:3245965-3245987 CTTCTTAGGGAAAAGGAAGATGG - Intergenic
1201762080 Y:17551504-17551526 ATTGTGATGGGAAGGGGAGAAGG - Intergenic
1201839472 Y:18354484-18354506 ATTGTGATGGGAAGGGGAGAAGG + Intergenic