ID: 1002626301

View in Genome Browser
Species Human (GRCh38)
Location 5:180531816-180531838
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 883
Summary {0: 2, 1: 24, 2: 111, 3: 150, 4: 596}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002626301_1002626309 21 Left 1002626301 5:180531816-180531838 CCACCAAAAAATGCAAGAACCAG 0: 2
1: 24
2: 111
3: 150
4: 596
Right 1002626309 5:180531860-180531882 TGCAATCCCAGGCACTCTGCAGG 0: 28
1: 238
2: 944
3: 954
4: 12510
1002626301_1002626307 10 Left 1002626301 5:180531816-180531838 CCACCAAAAAATGCAAGAACCAG 0: 2
1: 24
2: 111
3: 150
4: 596
Right 1002626307 5:180531849-180531871 CGGCGCGTGCCTGCAATCCCAGG 0: 35
1: 292
2: 665
3: 1141
4: 3574
1002626301_1002626311 27 Left 1002626301 5:180531816-180531838 CCACCAAAAAATGCAAGAACCAG 0: 2
1: 24
2: 111
3: 150
4: 596
Right 1002626311 5:180531866-180531888 CCCAGGCACTCTGCAGGCTGAGG 0: 29
1: 230
2: 1476
3: 17953
4: 233033
1002626301_1002626305 -10 Left 1002626301 5:180531816-180531838 CCACCAAAAAATGCAAGAACCAG 0: 2
1: 24
2: 111
3: 150
4: 596
Right 1002626305 5:180531829-180531851 CAAGAACCAGTCAGGCGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002626301 Original CRISPR CTGGTTCTTGCATTTTTTGG TGG (reversed) Intronic
901457385 1:9371084-9371106 CTGGTCCATTCTTTTTTTGGAGG - Intergenic
902452628 1:16507138-16507160 TAGCTCCTTGCATTTTTTGGGGG - Intergenic
902472688 1:16659801-16659823 TAGCTCCTTGCATTTTTTGGGGG - Intergenic
902486116 1:16747642-16747664 TAGCTCCTTGCATTTTTTGGGGG + Intronic
903087995 1:20881619-20881641 CTGATTTTTGTATTTTTTGTAGG - Intronic
903194521 1:21674878-21674900 CTGGTTCTGTCATTTGTTGGGGG + Intergenic
904831785 1:33310135-33310157 CTGGTTTTTGTATTTTTTGGTGG - Intronic
904930164 1:34081582-34081604 CTGGTTTTTGTATTTTTTGGTGG + Intronic
905113016 1:35611321-35611343 ATGGTTTTTGCTTTTTTTGGGGG + Intronic
905529154 1:38662728-38662750 CTGTTTCTTTCATTTTTGGGGGG + Intergenic
905673348 1:39807849-39807871 CTGGTTCTTGCATTTTTTGGTGG + Intergenic
905816884 1:40958110-40958132 CTAATTTTTGTATTTTTTGGTGG - Intergenic
905830637 1:41063833-41063855 CTGGTACTTTCCTTTTTTGAAGG - Intronic
906190602 1:43897085-43897107 CTGGTTTTTTTTTTTTTTGGTGG + Intronic
906308710 1:44738206-44738228 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
906360019 1:45147737-45147759 ATGGATCTTGTGTTTTTTGGGGG - Intronic
907106567 1:51888282-51888304 CTGTTTCTTTCTTTTTTGGGGGG + Intergenic
908211387 1:61903936-61903958 CTAATTTTTGAATTTTTTGGTGG + Intronic
908219535 1:61990732-61990754 GTGGTTCTTCAGTTTTTTGGGGG + Intronic
908602429 1:65755203-65755225 CTAATTTTTGTATTTTTTGGTGG - Intergenic
909001192 1:70219613-70219635 CTGGTTCTGGTATTTGTGGGAGG + Intronic
910190705 1:84592386-84592408 CTGGTCCTGGGCTTTTTTGGGGG - Intergenic
910891794 1:92026717-92026739 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
910958954 1:92740239-92740261 CTGGTTCCTGTACTTTTTGAAGG - Intronic
911209686 1:95126260-95126282 CTAATTTTTGTATTTTTTGGTGG - Intronic
911231563 1:95367342-95367364 CTGGGTTTTGCTTTTTTAGGTGG - Intergenic
911249225 1:95556481-95556503 CTAATTTTTGCATTTTTTGTAGG + Intergenic
912161429 1:106990219-106990241 CTGGTTCTTGACTTTTTTGATGG - Intergenic
912355629 1:109052814-109052836 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
912358286 1:109073530-109073552 CTGGTTTTTGTATTTTTTGGTGG + Intronic
912765674 1:112408010-112408032 CTAATTTTTGCATTTTTTGTAGG + Intronic
913142799 1:115958087-115958109 CTGGTTATTGCATTGGTTGGAGG - Intergenic
914374475 1:147061448-147061470 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
915851652 1:159330344-159330366 TTGTTTCTTGACTTTTTTGGTGG - Intergenic
915984702 1:160452750-160452772 CCTGTCCTTGCATTTCTTGGTGG + Intergenic
916006348 1:160664756-160664778 CTGATTGTGGCCTTTTTTGGTGG + Intergenic
916037209 1:160932825-160932847 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
916049920 1:161029129-161029151 CTGGTTTTCGTATTTTTTGGTGG + Intronic
916253627 1:162763728-162763750 TTGTTTCTTGGATTTTTCGGTGG + Intronic
916671886 1:167029410-167029432 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
916864013 1:168836917-168836939 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
917544832 1:175953219-175953241 CTGTTTCTTGTATTTTTTAATGG - Intronic
917730994 1:177874715-177874737 CTGATTTTTGTATTTTTTTGTGG - Intergenic
918115122 1:181489588-181489610 CTAGTAGTTGCATATTTTGGGGG - Intronic
918172345 1:182010390-182010412 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
918736195 1:188066602-188066624 CTGGTTCTTTCTCTCTTTGGGGG + Intergenic
918812625 1:189140444-189140466 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
918818686 1:189225216-189225238 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
919004862 1:191884407-191884429 CTGGTTCTTTCATGTTTTGGGGG - Intergenic
920072156 1:203309980-203310002 CTGATTTTTGTATTTTTTGTAGG + Intergenic
920144037 1:203842430-203842452 CTGGTGTTTGCATGTTTTGGTGG - Intronic
921109021 1:212014707-212014729 CTGGTTTTTGTATTTTTTGGTGG + Intronic
921192650 1:212724409-212724431 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
921514865 1:216078027-216078049 CTGGTGCTAACAGTTTTTGGTGG - Intronic
922221464 1:223611595-223611617 CTGGTCCTTGAATTTTTTCCTGG + Intronic
922306652 1:224350495-224350517 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
922387291 1:225099658-225099680 CTTGTTCTGCCATTTTTGGGTGG - Intronic
922644755 1:227275766-227275788 CTGGTTTTTGTATTTTTTGGTGG + Intronic
922693326 1:227711683-227711705 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
922699724 1:227751626-227751648 CTGTTTCTTGCATGTCCTGGAGG - Intronic
922954141 1:229585106-229585128 CTAATTTTTGTATTTTTTGGTGG + Intergenic
922993127 1:229932397-229932419 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
923174757 1:231453718-231453740 CTAGTTTTTGTATTTTTTGGTGG + Intergenic
923755620 1:236788690-236788712 TTGGTTTGTGAATTTTTTGGGGG - Intergenic
924125222 1:240843429-240843451 CTGATTTTTGTATTTTTTGTAGG + Intronic
924943617 1:248829934-248829956 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1062804560 10:407769-407791 GTTGTTGTTGCTTTTTTTGGTGG + Intronic
1063071185 10:2666839-2666861 CTCCTGCTTGCATTTTCTGGAGG - Intergenic
1063178263 10:3571368-3571390 CTGGGTCTTGCAGATTCTGGAGG - Intergenic
1063829985 10:9941565-9941587 TTGGCTCATGCAATTTTTGGAGG + Intergenic
1063836508 10:10020756-10020778 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1063896335 10:10686293-10686315 TGGGTTTTTGGATTTTTTGGGGG + Intergenic
1064002171 10:11672870-11672892 CTGATTTTTGCATTTTTAGTAGG + Intergenic
1064277180 10:13916854-13916876 CTGTTTCTTTCTTTTTTGGGGGG - Intronic
1065036826 10:21647875-21647897 CTGTTTTTTTTATTTTTTGGGGG + Intronic
1065058856 10:21876274-21876296 CTAATTTTTGTATTTTTTGGTGG + Intronic
1065901731 10:30214054-30214076 CTGGTTTTTGGGTTTTTTGGGGG + Intergenic
1066115364 10:32234105-32234127 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1066140648 10:32500878-32500900 CTGGTTTTCGTATTTTTTGGTGG - Intronic
1066192633 10:33069936-33069958 CTGGCTCTGGCATTTTTATGAGG + Intergenic
1066215646 10:33284411-33284433 TTAGTTCTTGAATTATTTGGGGG + Intronic
1066325235 10:34352509-34352531 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1066356318 10:34687568-34687590 CTGTTTCTTGCCCTTTGTGGAGG - Intronic
1066363997 10:34758743-34758765 CTAGTTCTTGCATTTTAGGTAGG - Intronic
1067260523 10:44686051-44686073 CTGGATCCTGCATTTTGTGATGG - Intergenic
1068673118 10:59743828-59743850 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1069215143 10:65811004-65811026 CTGGTTATTCCATTGTTAGGGGG + Intergenic
1070238043 10:74650936-74650958 CTGATTCTTGTATTGTTTGATGG + Intronic
1070367572 10:75751147-75751169 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1070390339 10:75964928-75964950 CTAATTTTTGTATTTTTTGGTGG + Intronic
1070807646 10:79279794-79279816 CTGGTTTTCCTATTTTTTGGTGG - Intronic
1071289858 10:84180918-84180940 CTGGTTTTCGTATTTTTTGGTGG - Intronic
1071311614 10:84348284-84348306 CTGGTTTTCGTATTTTTTGGTGG - Intronic
1071848073 10:89540262-89540284 CTAGTTTTTGTATTTTTTGTAGG + Intronic
1074024043 10:109615424-109615446 CTGGTTGTTTGATTCTTTGGGGG - Intergenic
1074648621 10:115492296-115492318 ATGGTTATTTCTTTTTTTGGAGG + Intronic
1075652303 10:124135905-124135927 CTGGGCCTTGCAGTTTTTGGTGG - Intergenic
1075893051 10:125970646-125970668 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1076011883 10:126995472-126995494 CTGGTTTTCGTATTTTTTGATGG - Intronic
1076049631 10:127321935-127321957 CTGATTTTTGTATTTTTTGTAGG - Intronic
1076114172 10:127884005-127884027 CTTGTTCTTGCATGGGTTGGAGG - Intronic
1076859323 10:133133135-133133157 TTGGTGCTTGCATTTCTCGGGGG + Intergenic
1077371681 11:2185233-2185255 CTGGTGCTTCCCTTCTTTGGGGG - Intergenic
1077555967 11:3226222-3226244 CTGGTTCTTCCTTGTTCTGGGGG + Intergenic
1077680635 11:4237335-4237357 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1077684916 11:4282733-4282755 CTGGTTTTTGTGTTTTTTGGTGG + Intergenic
1077690274 11:4335197-4335219 CTGGTTTTTGTGTTTTTTGGTGG - Intergenic
1077839536 11:5960423-5960445 CTGGTTGTCGTATTTTTTGGTGG + Intergenic
1078321510 11:10339237-10339259 CTAGTTCTTTTATTTTTTTGTGG + Intronic
1078687105 11:13543659-13543681 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1079163014 11:18012411-18012433 CCGGTTCTTGCATGTGTTGGGGG - Intronic
1079761768 11:24338400-24338422 CTAATTTTTGTATTTTTTGGGGG + Intergenic
1080196305 11:29613469-29613491 ATGTTTCTAGCATTTTTTGGGGG + Intergenic
1080538259 11:33243250-33243272 CTGCTTTTTGTATTTTTTGGTGG + Intergenic
1081634247 11:44710294-44710316 CTGCTTCTTGCAGGTTCTGGGGG + Intergenic
1081871780 11:46386032-46386054 CTTGTTCTGGCAGTTTGTGGTGG - Exonic
1082064960 11:47892453-47892475 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1082166585 11:48956358-48956380 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1082237605 11:49838264-49838286 CAGTTTCTTGTATTTGTTGGGGG + Intergenic
1082706085 11:56496724-56496746 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1082864353 11:57884985-57885007 CTGGTTCTGATATTTATTGGTGG + Intergenic
1082871137 11:57944465-57944487 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1082888570 11:58114028-58114050 TTGGTGATTGCATTTTTTGTGGG - Intronic
1083120667 11:60509767-60509789 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1083956892 11:65988826-65988848 CTGGTTTTTTTGTTTTTTGGGGG - Intergenic
1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1084814631 11:71639113-71639135 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1085159541 11:74327969-74327991 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1085490083 11:76907703-76907725 CTAATTTTTGTATTTTTTGGTGG - Intronic
1085822077 11:79804177-79804199 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1085851103 11:80121288-80121310 CTGGTTCTTGAATTATCAGGAGG - Intergenic
1086077650 11:82871606-82871628 GTGGTTTTTGCCTTTTTTGGAGG - Intronic
1086458209 11:86980099-86980121 CTGGTTCTTGCATTTTGGGGGGG + Intergenic
1086466310 11:87057439-87057461 CTGATTCTTGTATCTGTTGGGGG + Intronic
1086633834 11:89057993-89058015 CTGGTTCTGCCATTTATTGTAGG - Intronic
1086696735 11:89855986-89856008 CAGTTTCTTGTATTTGTTGGGGG - Intergenic
1086709423 11:89988504-89988526 CAGTTTCTTGTATTTGTTGGGGG + Intergenic
1086807158 11:91258092-91258114 CATGTTCTTCAATTTTTTGGTGG + Intergenic
1087033386 11:93729267-93729289 CTGATTTTTGTATTTTTTGTAGG - Intronic
1087789856 11:102394395-102394417 CTGATTTGTGCATTTTTTGGTGG + Intergenic
1088167260 11:106953643-106953665 CTGGTCCTTGCTTTTTTTTTTGG + Intronic
1088580080 11:111306972-111306994 ATGGCTCTTGGATTTTTTGATGG + Intronic
1089510289 11:118992349-118992371 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1089996459 11:122912574-122912596 CTAACTTTTGCATTTTTTGGTGG - Intronic
1090499351 11:127246752-127246774 TTGTTTCTTGCTTTTGTTGGTGG + Intergenic
1090686548 11:129128747-129128769 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1091365618 11:135017388-135017410 GTGGTTCTTGGATCTTTGGGAGG + Intergenic
1091876403 12:3937472-3937494 TTGGTACTTTCAGTTTTTGGTGG - Intergenic
1091902374 12:4154716-4154738 CTAGTTTTTGCATTTTTAGCAGG + Intergenic
1091941613 12:4488967-4488989 CTACCTCTTGCATTTTTTTGCGG - Exonic
1092267205 12:6990749-6990771 CTGGTTTTTGTATTTTTAGTAGG - Intronic
1092344949 12:7707201-7707223 CTAATTTTTACATTTTTTGGGGG + Intergenic
1092576798 12:9793074-9793096 TTGCATCTGGCATTTTTTGGGGG + Intergenic
1092850140 12:12618871-12618893 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1093328648 12:17809623-17809645 CTGGGCCTTGTATTTTTTGTGGG - Intergenic
1093413337 12:18892845-18892867 CTGGTCCTGGGCTTTTTTGGTGG + Intergenic
1093512360 12:19944560-19944582 GTGGTCCTTGCAATTGTTGGTGG + Intergenic
1093679357 12:21983240-21983262 CAGGTTCTTGGATTTTGTGCAGG + Intergenic
1094087488 12:26609439-26609461 CTGATTTTTGTATTTTTTGTAGG - Intronic
1094562129 12:31565226-31565248 CTGGTTTTTTTATTTTTTTGTGG - Intronic
1094776044 12:33729060-33729082 CTGGATTCTTCATTTTTTGGAGG + Intergenic
1094810091 12:34128085-34128107 CTGGTCCTTGGATTTTTTGTTGG - Intergenic
1095452967 12:42350796-42350818 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1096618279 12:52846930-52846952 CTGGTTATTGTCTTGTTTGGGGG - Intronic
1096968796 12:55648990-55649012 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
1097138385 12:56878900-56878922 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1097228749 12:57495832-57495854 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1097890964 12:64777512-64777534 CTGGGTATTGTATTTTTTTGTGG - Intergenic
1098333258 12:69375734-69375756 CCAGTTTTTGTATTTTTTGGTGG - Intronic
1098379673 12:69854177-69854199 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1098653131 12:73000117-73000139 CTTGTTCTTACATTTCTTGTGGG + Intergenic
1098774014 12:74588765-74588787 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1099931881 12:89084573-89084595 CTCCTTCCTGCAATTTTTGGAGG - Intergenic
1100048121 12:90410735-90410757 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1100705686 12:97197843-97197865 CTGTGCCTTGCATTTTCTGGTGG + Intergenic
1101946294 12:109139845-109139867 CTGCTTCTTGTCTTCTTTGGAGG - Exonic
1102223447 12:111210629-111210651 CTAATTTTTGCATTTTTTTGGGG - Intronic
1102323157 12:111956677-111956699 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1102463199 12:113112784-113112806 CTAATTTTTGTATTTTTTGGTGG - Intronic
1102468474 12:113144592-113144614 CTGGATCATTCATTTTTTGCTGG + Intergenic
1102656409 12:114485447-114485469 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1103045262 12:117730672-117730694 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1103522324 12:121544610-121544632 CTGATTTTTTCTTTTTTTGGGGG - Intronic
1103758330 12:123228905-123228927 TTGGTTCTTGTATTACTTGGTGG - Intronic
1104298283 12:127539013-127539035 CTGATTCTAGCATTTGTTAGTGG + Intergenic
1104392241 12:128400772-128400794 CTAATTTTTGCATTTTTTTGTGG + Intronic
1104444313 12:128821585-128821607 CTAGTTCTTACATTTTTAAGTGG - Intronic
1105450610 13:20495961-20495983 CTGATTTTTGTATTTTTTAGTGG + Intronic
1105522852 13:21146614-21146636 CTGGTACATGGAGTTTTTGGAGG + Intronic
1106285382 13:28314030-28314052 CTAATTCTTGTATTTTTTTGTGG - Intronic
1106574567 13:30962565-30962587 CTGGTTCTTACTTCTTTTGTAGG + Intronic
1106747832 13:32722188-32722210 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1106799402 13:33241704-33241726 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1107042716 13:35966668-35966690 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1107138287 13:36969289-36969311 ATAGTTCTTGTATTTGTTGGTGG - Intronic
1107523189 13:41203563-41203585 CTGGTTTTTAAATTTTTTTGTGG + Intergenic
1107562565 13:41571512-41571534 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1108405477 13:50096530-50096552 CTTCTTCTTACCTTTTTTGGGGG + Intronic
1108620025 13:52173086-52173108 TTGGTTTTTGTATTTTTTGTAGG - Intergenic
1108685758 13:52817636-52817658 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1109090782 13:58042103-58042125 GTGATTCTTGGATTTTTTAGAGG - Intergenic
1109390741 13:61688906-61688928 CCTGTTCTTGAATTTTCTGGAGG - Intergenic
1110229975 13:73157872-73157894 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1110506595 13:76294853-76294875 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1110602825 13:77395608-77395630 CTAATTCTTGTATTTTTTTGTGG - Intergenic
1111020707 13:82445679-82445701 GTGGTGCTTTCATTTTTTAGTGG + Intergenic
1111388482 13:87561257-87561279 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1111414240 13:87917908-87917930 CTTATTTTTGCATTTTTTTGTGG - Intergenic
1111494207 13:89026649-89026671 CTGCTTCTTGCCTTTCTTAGTGG - Intergenic
1111866558 13:93776051-93776073 TTGTTTCTTTCTTTTTTTGGGGG + Intronic
1111936093 13:94558220-94558242 TTATTTCTTGCATTTTTTGTGGG - Intergenic
1112077411 13:95929026-95929048 CTGGTTTTCGTATTTTTTGGTGG - Intronic
1112085057 13:96021202-96021224 CAGGACCTTGCATTTTTTGCTGG + Intronic
1112390049 13:98974785-98974807 CTTTTTCTTTCTTTTTTTGGAGG - Intronic
1112765092 13:102733212-102733234 CTTGTTCTTCTATATTTTGGGGG + Exonic
1113032684 13:106012190-106012212 CTAGTTCTTACAGTTTTTGATGG - Intergenic
1113193856 13:107782217-107782239 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1114137123 14:19865874-19865896 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1114144396 14:19956902-19956924 CTTTTTCTTGCATGTTTTTGGGG + Intergenic
1114336561 14:21697453-21697475 CTGGTTTTTGTATTTTTTCGTGG + Intergenic
1114578625 14:23736493-23736515 CTGGTTTTTGTATTTTTTGCTGG + Intergenic
1114594446 14:23899036-23899058 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1114989380 14:28268483-28268505 CTGGTCCTGGCTTTTCTTGGGGG - Intergenic
1115480449 14:33856051-33856073 CTTGCTCTTCCAGTTTTTGGTGG - Intergenic
1116034536 14:39612192-39612214 CTAGTTTTTGTATTTTTTGTAGG + Intergenic
1116189781 14:41649249-41649271 CTGGTGCTTACTTTTTTTGGGGG - Intronic
1116340481 14:43716632-43716654 TTGGTTCTAACAGTTTTTGGTGG - Intergenic
1116671724 14:47850817-47850839 CTGGTTTTTGCTTGTTTTGATGG - Intergenic
1116805890 14:49493860-49493882 CTGGATCATGCAGTTTGTGGAGG + Intergenic
1116959759 14:50957064-50957086 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1117395528 14:55305528-55305550 CTAATTTTTGTATTTTTTGGTGG - Intronic
1118843681 14:69530100-69530122 CAGGTTCTTGCACTTTTTGCTGG - Exonic
1119003240 14:70901952-70901974 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1119051965 14:71377808-71377830 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1119077134 14:71652255-71652277 CTGGCTGTTGCCTATTTTGGTGG - Intronic
1119465655 14:74856028-74856050 ACAGTTCTTGTATTTTTTGGAGG + Intronic
1119722160 14:76898700-76898722 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1119807982 14:77495048-77495070 CTAATTTTTGTATTTTTTGGGGG + Intronic
1119889835 14:78174465-78174487 CTGGGTCTTGAAATTCTTGGTGG + Intergenic
1120170674 14:81245081-81245103 CTGGTTTCTTTATTTTTTGGTGG - Intergenic
1120193881 14:81462971-81462993 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1120462179 14:84811670-84811692 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1120771871 14:88388034-88388056 CTAATTTTTGTATTTTTTGGTGG - Intronic
1121543903 14:94749672-94749694 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1122451008 14:101807434-101807456 CTTGTTCTTTTATTTTTTGCAGG + Intronic
1122560751 14:102612498-102612520 CTGATTTTTGTATTTTTTGTAGG + Intronic
1122619632 14:103047990-103048012 CTGTGTCTTTCATCTTTTGGTGG - Intronic
1123136321 14:106030790-106030812 CTGGTTCTGGCCATTTATGGAGG + Intergenic
1123213386 14:106783140-106783162 CTAATTTTTGCATTTTTAGGAGG + Intergenic
1124037326 15:26066922-26066944 TTGGTTCTAACAGTTTTTGGTGG + Intergenic
1124607757 15:31184131-31184153 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1125001710 15:34777815-34777837 ACGGTTATTCCATTTTTTGGAGG - Intergenic
1125255982 15:37763389-37763411 TTGGATCTTACATTTTGTGGAGG - Intergenic
1125934152 15:43620085-43620107 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1125951843 15:43758809-43758831 CTAATTTTTGTATTTTTTGGTGG - Intronic
1126210839 15:46098634-46098656 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
1126558912 15:50022153-50022175 CTTGTTGTTGCATTTTTTTGTGG - Intronic
1126573051 15:50172306-50172328 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1126752054 15:51886498-51886520 CTGGTTTTTGTATTCTTTGGTGG - Intronic
1126755720 15:51923217-51923239 CTAATTTTTGCATTTTTTGGTGG - Intronic
1126816657 15:52460478-52460500 CTGGTTTTCGTATTTTTTGGTGG - Intronic
1126960501 15:53988523-53988545 CAAGCTCTTGCATCTTTTGGGGG + Intergenic
1127023949 15:54781927-54781949 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1127072592 15:55300918-55300940 ATGGTTATTGCATATTTTTGTGG - Intronic
1127637571 15:60886163-60886185 CATGTTCTTTGATTTTTTGGGGG - Intronic
1127937838 15:63660152-63660174 CTAATTTTTGTATTTTTTGGTGG - Intronic
1128843851 15:70872227-70872249 TTGGTTTTTGTATTTTTTGGTGG - Intronic
1129427667 15:75475971-75475993 CTAGTTTTTGTATTTTTTGTAGG - Intronic
1129932582 15:79424659-79424681 CTGGGTCTTGCATTTAGTTGTGG + Intronic
1130183661 15:81656425-81656447 CTGATTATTCTATTTTTTGGGGG + Intergenic
1130204956 15:81867196-81867218 CTGGTTCTAGCATTTCTTTTGGG + Intergenic
1132492542 16:241083-241105 CTAGTTTTTGTATTTTTTTGTGG + Intronic
1133368768 16:5232142-5232164 GTGGTTCTTGCCTTTTTGAGGGG + Intergenic
1133369855 16:5239450-5239472 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1133544373 16:6791070-6791092 CTAATTTTTGCATTTTTTGTAGG + Intronic
1133675972 16:8072346-8072368 CTTGTACTTGCATTTTTTATAGG - Intergenic
1134258764 16:12633700-12633722 CTAGTTTTTGTATTTTTTAGTGG - Intergenic
1134275051 16:12768564-12768586 CTTGTTCTTTGACTTTTTGGAGG - Intronic
1134750277 16:16619673-16619695 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1134995181 16:18733925-18733947 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1135223858 16:20638509-20638531 GTGGTCCTTGCTATTTTTGGTGG - Intronic
1135462072 16:22653318-22653340 CTGGTTTTTGCAATTTATAGGGG - Intergenic
1135783999 16:25331699-25331721 CTGGATATTGGACTTTTTGGAGG + Intergenic
1136493980 16:30630306-30630328 CTAATTTTTGCATTTTTTGTAGG + Intergenic
1136659575 16:31745075-31745097 TTGGTTCATTTATTTTTTGGAGG + Intronic
1137430929 16:48417335-48417357 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1137439181 16:48483678-48483700 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1137523154 16:49211035-49211057 CTGGTTTTCGTATTTTTTGGGGG - Intergenic
1137985359 16:53102843-53102865 CTGTCTCTTTCTTTTTTTGGGGG + Intronic
1138049380 16:53760409-53760431 CTGATTTTTGTATTTTTTGTAGG + Intronic
1139022807 16:62772825-62772847 CTTGTTGTTGCATTTTCTGGAGG + Intergenic
1139378250 16:66514283-66514305 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1139394626 16:66630502-66630524 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1140080995 16:71747412-71747434 CTAATTTTTGTATTTTTTGGTGG - Intronic
1140432662 16:74917867-74917889 CTGAATCTTACACTTTTTGGTGG + Intronic
1140988328 16:80181979-80182001 TTAGTTCCAGCATTTTTTGGTGG - Intergenic
1141577670 16:84975041-84975063 CTGGTTTGTACATTTTTTGCCGG - Intronic
1141999588 16:87656548-87656570 CTTGATCTTGCAGTGTTTGGGGG + Intronic
1142695908 17:1633516-1633538 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1142707690 17:1706999-1707021 CTAATTTTTGTATTTTTTGGTGG - Exonic
1142985127 17:3690806-3690828 GTGGTTCCTGCATTATATGGGGG - Intronic
1143244840 17:5475423-5475445 CTGATTTTTGTATTTTTAGGAGG + Intronic
1143545918 17:7595460-7595482 TTGGTTTTTGGTTTTTTTGGGGG + Intronic
1143571911 17:7764624-7764646 CTGATTTTTGTATTTTTTGTAGG + Intronic
1143667570 17:8373338-8373360 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1143961916 17:10728473-10728495 CTAATTTTTGTATTTTTTGGTGG + Intronic
1144100072 17:11935124-11935146 CCGGTTTTTGTATTTTTTAGTGG + Intronic
1144541212 17:16145063-16145085 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1144694433 17:17292474-17292496 CTGATTTTTGCATTTTTAGTAGG + Intergenic
1145086914 17:19950473-19950495 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1145127266 17:20312232-20312254 CTGGGTCTGGTATCTTTTGGAGG + Intronic
1145158282 17:20557118-20557140 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1146178804 17:30684282-30684304 CTGATTTTTGCATTTTTAGTAGG + Intergenic
1146273429 17:31499097-31499119 CTGGTCCATGCTTTTCTTGGGGG + Intronic
1147254265 17:39172843-39172865 CTGGTTCTTGTTTTTTGTGCTGG - Intergenic
1147277761 17:39333309-39333331 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1147309915 17:39589399-39589421 CTGGTTTTTGTATTTTTTTTTGG - Intergenic
1147401439 17:40182476-40182498 CTACTTTTTGTATTTTTTGGTGG + Intronic
1147704338 17:42415543-42415565 CTAATTTTTGTATTTTTTGGTGG - Intronic
1147943324 17:44065946-44065968 TTGGTCCTTGCCTGTTTTGGGGG - Intronic
1148295379 17:46497344-46497366 CTGGTTATTTCTTTTTTGGGGGG + Intergenic
1149032948 17:52104366-52104388 CTAATTCTTGCATTTATTTGTGG + Intronic
1149312313 17:55406718-55406740 CTAATTTTTGTATTTTTTGGTGG - Intronic
1149966524 17:61170205-61170227 CTGGTGCCTGCATTTATTGAAGG - Intronic
1150046577 17:61919427-61919449 CTGGTTCTTGTGTCTCTTGGTGG - Exonic
1150407220 17:64912593-64912615 CTGGTTATTTCTTTTTTTGGGGG - Intronic
1150841180 17:68607248-68607270 ATAGTTCTAGTATTTTTTGGAGG + Intergenic
1150867269 17:68865871-68865893 CTGGATTTTGCATTTTTAGCAGG + Intergenic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1152104314 17:78319857-78319879 CTGGTTTTTACATTTTTAAGTGG - Intergenic
1152452884 17:80394289-80394311 CTGGTTCTGGCAGTTCTTTGCGG + Exonic
1152474246 17:80507548-80507570 TTTGTTTTTGTATTTTTTGGTGG - Intergenic
1153125694 18:1787690-1787712 TTGATTCGTTCATTTTTTGGAGG - Intergenic
1153255982 18:3171668-3171690 ATGGTTTTTGCATGTTTTAGTGG + Intronic
1153646944 18:7204066-7204088 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1154089498 18:11344209-11344231 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1154090277 18:11352604-11352626 CTGGTCCTGGACTTTTTTGGTGG - Intergenic
1154265014 18:12873451-12873473 CTGGTTTTCGTATTTTTTTGGGG + Intronic
1154973513 18:21434308-21434330 CTAATTTTTGTATTTTTTGGTGG - Intronic
1155035595 18:22022481-22022503 CTAGTTTTTGTATTTTTTGTAGG + Intergenic
1155314374 18:24557107-24557129 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1155642112 18:28030828-28030850 CTGGTTATTGATTTTTTTGTTGG - Intronic
1155729330 18:29133039-29133061 CGGGTTTTTTCTTTTTTTGGTGG + Intergenic
1156524680 18:37755758-37755780 TTGGCTCTTGCTTCTTTTGGAGG + Intergenic
1156892067 18:42202754-42202776 CTGGTTGTTTTTTTTTTTGGAGG + Intergenic
1157380115 18:47206643-47206665 ATGCTTGTTGCATCTTTTGGTGG - Intergenic
1157455766 18:47827644-47827666 CTGGTTTTTGTATTTTTTGGTGG + Exonic
1157857854 18:51117913-51117935 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
1158073400 18:53499986-53500008 CTGGTTCTGACATTTCTTTGTGG - Intronic
1158492881 18:57926324-57926346 TTTGTTTATGCATTTTTTGGTGG - Intergenic
1158646772 18:59255142-59255164 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1159169571 18:64747918-64747940 CTGGTTCTTGGCTATATTGGGGG + Intergenic
1159434180 18:68394703-68394725 TTGCTTCTTGCATATTCTGGTGG + Intergenic
1159615003 18:70570175-70570197 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
1160465609 18:79073460-79073482 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1161443893 19:4307218-4307240 CTCATTTTTGTATTTTTTGGTGG + Intronic
1161802426 19:6423894-6423916 CTGGCTCTTGGATGCTTTGGTGG - Intronic
1162602262 19:11677708-11677730 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1162979810 19:14231285-14231307 CTGATTTTTGCATTTTTAGTAGG - Intergenic
1163014529 19:14446170-14446192 CTAATTTTTGCATTTTTTTGTGG + Intronic
1163732915 19:18960405-18960427 CTGTGTCTTACATTTTTAGGGGG + Intergenic
1163769882 19:19184763-19184785 CTAGTTTTTGTATTTTTTGTAGG + Intronic
1163865414 19:19769656-19769678 ATGGTTTTCGTATTTTTTGGTGG + Intergenic
1163963550 19:20721260-20721282 CTGGTCCTGGACTTTTTTGGTGG + Intronic
1164012275 19:21213272-21213294 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1164034912 19:21444271-21444293 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1164054906 19:21614455-21614477 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1164168673 19:22703686-22703708 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1164218526 19:23172730-23172752 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1164231328 19:23290641-23290663 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1164662476 19:29988699-29988721 TGGGTGCTTCCATTTTTTGGCGG + Intronic
1164737381 19:30551814-30551836 CTGGCTCTTGCATTTGCTTGGGG + Intronic
1164779876 19:30883732-30883754 CTGGTTCTGGCATTTGTCAGGGG - Intergenic
1165298943 19:34955200-34955222 CTTGTTTTTGTTTTTTTTGGTGG - Intergenic
1165558798 19:36660313-36660335 CTAGTTTTTGTATTTTTTGTAGG + Intronic
1166611560 19:44203493-44203515 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1167165710 19:47798551-47798573 CTGCTTCTTGGAGTGTTTGGAGG - Intergenic
1167195682 19:48026448-48026470 CTGATTTTTGTATTTTTTTGTGG - Intergenic
1167303089 19:48690853-48690875 CTAATTTTTGCATTTTTTGTAGG + Intergenic
1167588843 19:50391529-50391551 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1167988279 19:53336526-53336548 CTTTTGCTTTCATTTTTTGGTGG - Intronic
1202705081 1_KI270713v1_random:16621-16643 TAGCTCCTTGCATTTTTTGGGGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926322801 2:11760513-11760535 CTGGTTTTCGTATTTTTTGGTGG - Intronic
927112306 2:19872197-19872219 CTGTGTCTAGTATTTTTTGGGGG + Intergenic
927305379 2:21565638-21565660 CCGGTTCTTGCCCTTTTGGGGGG - Intergenic
927367281 2:22313073-22313095 CAGGTATTTGTATTTTTTGGTGG + Intergenic
927406958 2:22781513-22781535 TTGGTTTTTGCATTTCTTTGGGG + Intergenic
927752800 2:25684970-25684992 CATGTTCTTGATTTTTTTGGCGG - Intergenic
927902698 2:26832342-26832364 CTAGTTTTTGTATTTTTTAGTGG + Intergenic
928826579 2:35429011-35429033 CTGGTGCTTACACTCTTTGGAGG - Intergenic
929066236 2:37978152-37978174 CTGGTTTTCGTATTTTTTGGTGG - Intronic
929932982 2:46273044-46273066 CTGTTTTTTTCTTTTTTTGGAGG - Intergenic
930363498 2:50411190-50411212 CTGGTTTTCATATTTTTTGGTGG + Intronic
930723825 2:54663669-54663691 CTGGTTCTGTCTTTGTTTGGGGG + Intronic
931028974 2:58148986-58149008 CTGCTTCTTAAATTTTATGGAGG - Intronic
931036427 2:58249034-58249056 CTAATTCTTGTATTTTTTTGTGG + Intergenic
931621773 2:64217673-64217695 CTGGTTCTTGCTCATTTTCGGGG + Intergenic
932240381 2:70151642-70151664 CTTGTTTTTTTATTTTTTGGGGG - Intronic
932253930 2:70267621-70267643 CTGGTTTTCGTATTTTTTGGTGG - Intronic
932473394 2:71980571-71980593 CTGGTTCTGGGATTTTTTGTTGG - Intergenic
932683539 2:73848293-73848315 TTTGTTCATGCCTTTTTTGGGGG + Intronic
933027689 2:77282175-77282197 CTGGATACTTCATTTTTTGGTGG + Intronic
933046628 2:77546184-77546206 CTAATTTTTGTATTTTTTGGTGG - Intronic
933063106 2:77762503-77762525 CTATTTCATGCATTTTTTGGTGG + Intergenic
933865786 2:86515980-86516002 CTGGTTTTTGTATTTTTTAGTGG - Intronic
933957263 2:87381513-87381535 CTGGTTCTGGCCAGTTTTGGAGG + Intergenic
933979783 2:87540239-87540261 CTTGTTTCTGCATCTTTTGGAGG + Intergenic
934070739 2:88381722-88381744 CTGATTTTTGCATTTTTAGTAGG + Intergenic
934128235 2:88920082-88920104 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
934241381 2:90273405-90273427 CTGGTTCTGGCCAGTTTTGGAGG + Intergenic
934271793 2:91543281-91543303 CTGGTTCTGGCCAGTTTTGGAGG - Intergenic
935007396 2:99092786-99092808 CTGGTCCTTGACTTTTTTTGTGG - Intronic
936158338 2:110064474-110064496 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
936186323 2:110306852-110306874 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
936314038 2:111410552-111410574 CTTGTTTCTGCATCTTTTGGAGG - Intergenic
936345490 2:111672240-111672262 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
937734986 2:125277615-125277637 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
938253300 2:129833184-129833206 CTGGTTTGTGTATTTTTTGGTGG + Intergenic
938865910 2:135419831-135419853 GTGGTTTTTGCAGTCTTTGGTGG + Intronic
939027546 2:137032003-137032025 CTGATTTTTGTATTTTTTTGTGG + Intronic
939376297 2:141372503-141372525 CTGGTCCTGGCGTTTTTTAGGGG + Intronic
939471111 2:142621568-142621590 TTAGTTCTTGCATTTTCTTGAGG - Intergenic
939683431 2:145168037-145168059 CTTGTTGTTGTCTTTTTTGGTGG - Intergenic
940233178 2:151480933-151480955 CTGGTTTTTACATTTTTTAATGG + Exonic
940817422 2:158311303-158311325 CTGGTTCTTGTATTTTTTGGTGG - Intronic
940973633 2:159920566-159920588 CTGATTTTTGTATTTTTTGGTGG + Intergenic
941024974 2:160448458-160448480 CTGGTTTTTGCATTTTTTGATGG + Intronic
941822493 2:169856664-169856686 CTGGTTTTTGTATTTTTTGGTGG - Intronic
942113019 2:172700835-172700857 CTGGTTTTTATATTTTTTGGTGG - Intergenic
943100209 2:183478713-183478735 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
943700897 2:190987379-190987401 CTGGTGCTTACATTTATTGAGGG - Intronic
943788726 2:191908201-191908223 ATGCTTCCTGCATTTTTGGGTGG - Intergenic
943863079 2:192893644-192893666 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
944279058 2:197873417-197873439 CAGGTTCTTACACTTTGTGGCGG + Intronic
944421531 2:199536185-199536207 ATGGTTCTTACAACTTTTGGAGG - Intergenic
944570717 2:201042120-201042142 CTGGTTTTCGTATTTTTTGGTGG + Intronic
945685685 2:212966545-212966567 CTGCTACTTACATTGTTTGGGGG + Intergenic
946447484 2:219751831-219751853 CTGGTTTTCGTATCTTTTGGTGG - Intergenic
946974872 2:225137274-225137296 CTGATTCATACATTTTATGGAGG + Intergenic
947032508 2:225813351-225813373 CTAGTTTTTGTATTTTATGGTGG - Intergenic
947935579 2:234000842-234000864 CTGGTTTTTGTATTTTTAGTAGG + Intronic
1169247815 20:4037713-4037735 CTAATTTTTGTATTTTTTGGCGG + Intergenic
1172233335 20:33352051-33352073 CTGATTTTTGGATTTTTTGTAGG - Intergenic
1172451577 20:35028822-35028844 TTGCTTCATGTATTTTTTGGGGG + Intronic
1172583930 20:36069314-36069336 CTGGTTATGGCATCTTTTGGGGG - Intergenic
1172738882 20:37150451-37150473 CTGGTTTTTGTGTTTTTTGGTGG + Intronic
1173086448 20:39923524-39923546 CTATTTCTTGCACTTTTTGTTGG + Intergenic
1173473133 20:43338861-43338883 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1173667154 20:44771228-44771250 CTGGTTCTTGCAGTCTTTTGTGG - Intronic
1174105943 20:48162146-48162168 TTGGTGGTTGCATTTTTGGGAGG - Intergenic
1174511746 20:51058621-51058643 ATGGTTCTGGCATTTTCTAGCGG + Intergenic
1174915514 20:54649254-54649276 CTAATTCTTGGATTTTTTGTAGG - Intronic
1175017236 20:55804832-55804854 TTTGGTCTTGCATTTTTAGGAGG - Intergenic
1175565101 20:59968423-59968445 CTTGTACATGTATTTTTTGGAGG + Intronic
1175596927 20:60242710-60242732 TGGGTTTTTGGATTTTTTGGGGG - Intergenic
1175623869 20:60474298-60474320 CTGGTATGTGCACTTTTTGGGGG + Intergenic
1175627221 20:60499691-60499713 ATGGTTTTTACATTTTTTGATGG + Intergenic
1176656882 21:9594830-9594852 CTGTTTCTTGCACGTTTTGCTGG - Intergenic
1177504768 21:22006203-22006225 CTTGTTGTTGCATCCTTTGGAGG + Intergenic
1177897596 21:26872852-26872874 CTTCTTCATTCATTTTTTGGGGG - Intergenic
1178182462 21:30177941-30177963 CTGATTTTTGTATTTTTTGTAGG + Intergenic
1179113192 21:38465044-38465066 CTGGGGCTTGCATTCCTTGGAGG - Intronic
1179232544 21:39518207-39518229 CTGATTTTTGTATTTTTTGTAGG - Intergenic
1179298000 21:40080399-40080421 CTGATGCTTGCATTTTGTGTGGG + Intronic
1179637988 21:42725858-42725880 CTGGTGCTTGCATCTTTAGTTGG + Intronic
1179803212 21:43821750-43821772 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1181434287 22:22901147-22901169 CTTGTTGTTGCTTTGTTTGGAGG - Intergenic
1181435223 22:22906513-22906535 CTTGTTGTTGCTTTGTTTGGAGG - Intergenic
1181438274 22:22922765-22922787 CTTGTTGTTGCTTTGTTTGGAGG - Intergenic
1182180881 22:28347096-28347118 CTAATTTTTGTATTTTTTGGGGG - Intronic
1182330998 22:29551949-29551971 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1182564144 22:31184747-31184769 CTGGTTTTCATATTTTTTGGTGG - Intronic
1182629288 22:31672478-31672500 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1183051056 22:35261774-35261796 ATGTCTTTTGCATTTTTTGGGGG - Intronic
1183110297 22:35643836-35643858 CTAATTTTTGCATTTTTTTGTGG + Intergenic
1183436110 22:37796373-37796395 CTGGTTTTTGCCTTTTTTTCTGG + Intergenic
1183537322 22:38410529-38410551 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1183847980 22:40558764-40558786 TTGGTTTTTGTTTTTTTTGGGGG + Intronic
1184145362 22:42607275-42607297 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1184201225 22:42971249-42971271 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1184878003 22:47287553-47287575 CTGTTTGTTGCATTTTGTGCAGG + Intergenic
1185122959 22:48984058-48984080 CTGCTTCTGGCCTTTTTTGCTGG - Intergenic
949330557 3:2917133-2917155 CTGGTTTTTATATTTTTTGGTGG - Intronic
950225383 3:11229295-11229317 CAGGTTCTTTCAGTTTTTGGGGG - Intronic
950232448 3:11287997-11288019 ATGGTTTTTGCATTTTTTTAAGG + Intronic
950859208 3:16132642-16132664 CTGATTCTTTTTTTTTTTGGAGG - Intergenic
951534865 3:23731294-23731316 CTGCTTCTTCCAGTTTCTGGTGG + Intergenic
952894126 3:38065170-38065192 CTGGTTTTCGTGTTTTTTGGTGG - Intronic
953084753 3:39655456-39655478 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
953144473 3:40261731-40261753 CTGGTTTTTGTATTTTTAGTAGG + Intergenic
953165537 3:40461532-40461554 CTGGTCCTTTCTTTTTTTGGAGG + Intronic
953440258 3:42910184-42910206 CTGGTTTTCGTATTTTTTGGTGG - Intronic
953757154 3:45656681-45656703 CTGGTTTTTGTATTTTTAGTAGG + Intronic
953874744 3:46660276-46660298 CTGGTTCCTGCATTTCTTTCAGG - Intergenic
954352230 3:50054240-50054262 TTGTTTCTTTCATTTTTGGGGGG + Intronic
954467686 3:50666081-50666103 CTGTTTTTTGTATTTTTTAGTGG - Intergenic
954567200 3:51608658-51608680 CTGGTTTTCGTATTTTTTGGTGG - Intronic
954669658 3:52282781-52282803 CTAATTTTTGTATTTTTTGGTGG - Intronic
955359593 3:58261647-58261669 CTGGTTCTTTCTTTTTATTGTGG + Intronic
955626714 3:60927163-60927185 CTGGTTTTTGTATTTTTTGGTGG + Intronic
955670196 3:61394218-61394240 CTGGTTTTCATATTTTTTGGTGG - Intergenic
955973876 3:64462503-64462525 GTTATTTTTGCATTTTTTGGCGG - Intergenic
955989218 3:64607516-64607538 TTGGTTGTTGCATACTTTGGTGG - Intronic
956177306 3:66484990-66485012 CTAATTTTTGTATTTTTTGGGGG - Intronic
957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG + Intergenic
957501248 3:81059781-81059803 CTGGTTCTTGCATTTCTGGCTGG - Intergenic
957817230 3:85317116-85317138 GTGGTGTTTGCTTTTTTTGGGGG + Intronic
958028083 3:88072750-88072772 CTGATGCTTTCATTTTTTTGTGG - Intronic
958503954 3:94948624-94948646 CTATTTCTTGCATTTTTGTGGGG + Intergenic
958829454 3:99069477-99069499 TTGGATTTTGGATTTTTTGGGGG + Intergenic
959849084 3:111067376-111067398 CTGGTTTTGGTTTTTTTTGGGGG + Intergenic
960073515 3:113458376-113458398 CTGGTTTTCGTATTTTTTGGTGG + Intronic
960293409 3:115914127-115914149 CTAGGTCTTCCATTTTTTTGAGG - Intronic
960344767 3:116518797-116518819 CTGGTTTTCGTATTTTTTGGTGG + Intronic
960561747 3:119091976-119091998 TTGGTTTTTGGTTTTTTTGGGGG + Intronic
960577370 3:119242129-119242151 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
960770905 3:121191371-121191393 CTGGTTTTCATATTTTTTGGTGG - Intronic
960866207 3:122202250-122202272 CTGGTTTTCGGATTTTTTGGTGG - Intronic
961276325 3:125730135-125730157 CTTCTTCTTGCATTATTAGGAGG + Intergenic
961811756 3:129526046-129526068 CTAGTTTTTGTATTTTTTGTAGG - Intergenic
962048977 3:131792931-131792953 CTGGTTTTGGCATGTTTTGTTGG - Intronic
962761692 3:138520972-138520994 CTGGTTTTTGTATTTTTTGGTGG + Intronic
962787819 3:138784593-138784615 CTGGTTTTTGTATTTTTTGGTGG + Intronic
962945261 3:140163375-140163397 TTGATTCATGCATTTTGTGGGGG - Intronic
962962801 3:140326617-140326639 CAGGTTCTTGAATCTTTGGGAGG - Intronic
963190806 3:142470865-142470887 CTCCTTCTTGAATTTTTTAGGGG + Intronic
963234574 3:142944571-142944593 CTGCTTTTTTCATTGTTTGGAGG + Intergenic
963825297 3:149946441-149946463 CTGGTCCTGGCCTTTTTTGTTGG + Intronic
964348218 3:155776618-155776640 CTGATTTTTACATTTTTTTGTGG - Intronic
965136828 3:164784097-164784119 CTGATTTTTGTATTTTTTGGTGG + Intergenic
965253850 3:166378512-166378534 CTGGTTCTAGGATTTTTTTTTGG + Intergenic
965302214 3:167018268-167018290 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
966141564 3:176762920-176762942 CTGCTTCATGATTTTTTTGGGGG - Intergenic
966350870 3:179032166-179032188 CTGGTTTTCGTATTTTCTGGTGG + Intronic
966591050 3:181683352-181683374 CTGTTTCTTGGATTTCTTGTTGG - Intergenic
966617337 3:181926501-181926523 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
966981872 3:185144386-185144408 CTGCTTTTTGCTTTTTTTGGAGG + Intronic
967209366 3:187153652-187153674 CTGGTTCTAACTTTTTTTGTTGG - Intronic
967578644 3:191125615-191125637 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
968156424 3:196385166-196385188 CTGGTTTTCGTATTTTTTGGTGG + Intronic
968852941 4:3095358-3095380 CTGGTTTTCGTGTTTTTTGGTGG - Intronic
969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG + Intergenic
969384886 4:6837745-6837767 CTGGTTTTTGTATTTTTTGGTGG - Intronic
969527693 4:7712359-7712381 GTGGTCCTTGCATTGTTTTGCGG - Intronic
969737291 4:9000404-9000426 CTGTGTCTTGCATGATTTGGAGG - Intergenic
969796494 4:9531992-9532014 CTGTGTCTTGCATGATTTGGAGG - Intergenic
970632706 4:17968807-17968829 ATGGTTCTTACATTTTTTAATGG - Intronic
971282190 4:25250051-25250073 CTGGTTTTCGTATTTTTTGGTGG - Intronic
972938339 4:44167506-44167528 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
973112425 4:46412402-46412424 CTTGTTGTTGCATTCTTTGAAGG + Intronic
973263236 4:48186021-48186043 CTGGTTTTTGCATTTTTTGGTGG + Intronic
974597742 4:64036809-64036831 CTGGTTTTTGCACTTTTTGGTGG + Intergenic
974711820 4:65607456-65607478 TTTGTTTTTGTATTTTTTGGGGG - Intronic
975063690 4:70037117-70037139 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
975125506 4:70778065-70778087 CTAATTTTTGTATTTTTTGGTGG - Intronic
975175932 4:71288956-71288978 CTGGTTCTTGACTTTTTGGTGGG + Intronic
975519911 4:75289653-75289675 CTTGTTCATTCATTTTTTGTAGG + Intergenic
975790254 4:77941491-77941513 CTGGTCCTGGAATTTTTTGTTGG + Intronic
975796048 4:78007717-78007739 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
975908653 4:79244791-79244813 CTGGTTTTTGTATTTTTTGGTGG + Intronic
976204284 4:82609684-82609706 CTAATTTTTGTATTTTTTGGTGG - Intergenic
976235043 4:82888208-82888230 CTAGTTTTTGTATTTTTTAGTGG - Intronic
976427684 4:84924903-84924925 CTGGTTCTTGCAAATTTTCAAGG - Intronic
976944838 4:90752228-90752250 TTGGTTCTGCCATTTATTGGAGG - Intronic
976989087 4:91341705-91341727 CTAATTTTTGTATTTTTTGGTGG + Intronic
977349488 4:95863211-95863233 ATTTTTCTTCCATTTTTTGGAGG + Intergenic
977542281 4:98331128-98331150 CTGGTTTTTGTATTTTTTGGTGG - Intronic
978224783 4:106320910-106320932 CTGGTTTTTGTATTTTTTGGTGG + Intronic
978354510 4:107857345-107857367 CTGGTGTTTTCATTTTTTTGGGG + Intronic
978519673 4:109603259-109603281 CTGGTTTTTGTATTTTTTGGTGG + Intronic
978539771 4:109804273-109804295 CTGATTCTTTCACTCTTTGGAGG - Intergenic
978888600 4:113796075-113796097 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
979273601 4:118791688-118791710 CTGGTTTTCGTATTTTTTGGTGG + Intronic
979295047 4:119022490-119022512 CTAATTTTTGCATTTTTTGTAGG + Intronic
979475606 4:121153967-121153989 CTAGTTCATTCATGTTTTGGAGG - Intronic
979702391 4:123684481-123684503 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
979724051 4:123939232-123939254 CTTGTTATTTCAGTTTTTGGTGG - Intergenic
979917289 4:126452285-126452307 CTGTTTCTCCCTTTTTTTGGGGG - Intergenic
979941642 4:126770767-126770789 CTGGTTTTCATATTTTTTGGTGG + Intergenic
980400183 4:132273474-132273496 CTGGGAATTGCATTTCTTGGGGG + Intergenic
980883562 4:138738959-138738981 CTGGTTTTCGTATTTTTTGCGGG + Intergenic
981166071 4:141559119-141559141 CTGGTTCTGGGATTTTTTGGGGG - Intergenic
981993559 4:150953527-150953549 CTGGTTTTCGTATTTTTTGGTGG + Intronic
981994704 4:150963349-150963371 CTGGTTTTCGTATTTTTTGGTGG + Intronic
982010957 4:151105856-151105878 CTAATTTTTGCATTTTTTAGTGG + Intronic
982183002 4:152765952-152765974 CTGGTTTTTGTATTTTTTGGTGG - Intronic
982255153 4:153444297-153444319 GTGGTTCAAGCATTTTCTGGTGG + Intergenic
983219573 4:165031647-165031669 CTGATTGTTGTATTTTTTGGTGG - Intergenic
983498533 4:168473054-168473076 CTTTTTATTGCTTTTTTTGGGGG - Intronic
983613887 4:169679722-169679744 CTGATTTTTGTATTTTTTGGTGG - Intronic
983628639 4:169827967-169827989 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
983664587 4:170166912-170166934 CTGGTTTTCGTATTTCTTGGTGG - Intergenic
983978916 4:173970285-173970307 CTGGGTTTTTCATTTTTGGGAGG + Intergenic
984821636 4:183887681-183887703 CTGGATCTTGCACTTATTAGAGG - Intronic
984831113 4:183974770-183974792 CTTGTTCTTGCAATTATTGGGGG - Intronic
985392169 4:189501257-189501279 CTGGTTTTTCCTTTTTGTGGAGG - Intergenic
985418827 4:189763067-189763089 CTGTTTCTTGCACGTTTTGCTGG + Intergenic
985762636 5:1758349-1758371 CTTGTTCTTGCATTTTTTGCTGG - Intergenic
985938990 5:3119329-3119351 CTCATTCTTCCATATTTTGGGGG + Intergenic
986593112 5:9391859-9391881 CAGGATCTTGCATTTTAGGGAGG - Intronic
987173560 5:15284184-15284206 TTGCTTCCTGCAGTTTTTGGTGG - Intergenic
987233510 5:15919818-15919840 CTGGGTTTTGCATGATTTGGAGG + Intronic
988777944 5:34494099-34494121 CTGTTTCTTGATTTTTTTGGGGG - Intergenic
989001602 5:36766571-36766593 TTGATTCTTCCAGTTTTTGGTGG + Intergenic
989437753 5:41434518-41434540 CAGGTACTTGCCTTTTTTGTAGG + Intronic
989471059 5:41819352-41819374 CTGGCTCTTCCTTTTTTGGGGGG + Intronic
989648904 5:43666424-43666446 CTGGTTTTCGTATTTTTTGGTGG - Intronic
989656063 5:43746921-43746943 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
990485863 5:56258684-56258706 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
991027776 5:62049606-62049628 CTAATTCTTGTATTTTTTAGTGG - Intergenic
991937602 5:71817360-71817382 TTGGGTCATGCATTTTATGGTGG - Intergenic
992195551 5:74335524-74335546 CTGGTGCATGCATTTTTTCTAGG - Intergenic
992415944 5:76551686-76551708 CTGGTTTTTGCATTTTTTGGTGG - Intronic
992585696 5:78237465-78237487 ATGCTTCTTGCTTTTTTTGGGGG - Intronic
993047372 5:82882833-82882855 CTGGTCCTGGCTTTTTTGGGTGG + Intergenic
993101949 5:83551344-83551366 CTAATTTTTGTATTTTTTGGTGG - Intronic
993934552 5:93985587-93985609 CTGGATTTTGTATTTTTTGGTGG + Intronic
994019874 5:95010748-95010770 GTTGTTTTTGTATTTTTTGGCGG + Intronic
994219730 5:97182006-97182028 CTGGTTCTTGCATTATGTTAAGG - Intronic
995456726 5:112360437-112360459 CTGGTTTTTGTATTTTTTGGTGG + Intronic
995471017 5:112502300-112502322 CTAGGTATGGCATTTTTTGGGGG - Intergenic
996022328 5:118604995-118605017 TTGGTTGTTCCATTTTTGGGAGG + Intergenic
996057594 5:118998655-118998677 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
996541679 5:124636391-124636413 ATGGAGCTTTCATTTTTTGGTGG - Intergenic
997412079 5:133697990-133698012 TGGGTTCTAGCATTTTCTGGAGG + Intergenic
998460808 5:142308716-142308738 CTGGTTCTTGGTTTTTCTAGGGG - Intergenic
999194109 5:149770410-149770432 CTGGATCTTCAACTTTTTGGAGG - Intronic
999535361 5:152510831-152510853 ATGGTGCTGGCATCTTTTGGGGG - Intergenic
999734444 5:154502205-154502227 CTGGTTCTTTCAGTTTTTCTTGG + Intergenic
999978926 5:156940120-156940142 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1000103573 5:158037827-158037849 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1000237340 5:159374331-159374353 CTGGTTCTGGGCTTTTTTGTTGG + Intergenic
1000493939 5:161953882-161953904 CAGGTTCTGCCATTTTTTAGAGG + Intergenic
1000529214 5:162398300-162398322 CTAGTTCTAATATTTTTTGGAGG - Intergenic
1000630384 5:163584417-163584439 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1000978741 5:167793668-167793690 CTAATTTTTGCATTTTTTGGTGG - Intronic
1002009712 5:176268372-176268394 TTGGTTCTTGCTTTTTTTTTTGG - Intronic
1002208699 5:177582505-177582527 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1002217009 5:177643920-177643942 TTGGTTCTTGCTTTTTTTTTTGG + Intergenic
1002626301 5:180531816-180531838 CTGGTTCTTGCATTTTTTGGTGG - Intronic
1004038836 6:11953856-11953878 CTGGTTCTTCCATTTTCCAGAGG + Intergenic
1004802199 6:19161423-19161445 CTGGTTTTTGCATTTGGTGGAGG + Intergenic
1004953161 6:20697532-20697554 CTGGTTCTTGATTATTTTTGAGG + Intronic
1004987912 6:21103599-21103621 CTGCGTCCTGCATTTTTTGCGGG - Intronic
1005158609 6:22835898-22835920 CTGGTTTTCGTATTTTTGGGTGG + Intergenic
1005364300 6:25061761-25061783 CTCATCCTTGCATTCTTTGGCGG + Intergenic
1005414614 6:25586786-25586808 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1005446801 6:25932207-25932229 CTAATTTTTGCATTTTTTTGTGG - Intergenic
1005624758 6:27653066-27653088 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1005710745 6:28501719-28501741 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1005764378 6:28996339-28996361 CTGGTTCTTTCCTTTTTTGCAGG + Exonic
1005933302 6:30499314-30499336 TTTGTTTTTGTATTTTTTGGTGG - Intergenic
1006225232 6:32531707-32531729 CTGGTTTTCGCATTTTTTGGTGG + Intergenic
1006437291 6:34032704-34032726 CTGATTCCTGCCTTTTTAGGAGG - Intronic
1006534149 6:34684077-34684099 CTGGTTTTTTGTTTTTTTGGGGG - Intronic
1007545117 6:42687316-42687338 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1008106436 6:47444468-47444490 CCGGTTTTTGTATTTTTTGGTGG - Intergenic
1008193808 6:48493746-48493768 CTGGTTTTTTAATTTTTTGAAGG - Intergenic
1008229096 6:48961493-48961515 TTAGTTTTTGCATTTTTTTGTGG - Intergenic
1009041911 6:58190196-58190218 CTGGTTTTCATATTTTTTGGTGG + Intergenic
1009217764 6:60944464-60944486 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1009374393 6:62949587-62949609 CTGGTTCATTGATTTTTTGAAGG - Intergenic
1010055537 6:71559928-71559950 TTGTTTCTTGCATTTTTATGGGG + Intergenic
1010248623 6:73685066-73685088 CTAATTTTTGCATTTTTTAGTGG + Intergenic
1011209482 6:84939508-84939530 CTGGTCCTGGACTTTTTTGGTGG - Intergenic
1011607646 6:89119704-89119726 CTGTTTCTTCCAGTCTTTGGTGG + Intergenic
1012023912 6:93963438-93963460 CTTGTTCTTGTATTTTTTAATGG + Intergenic
1012533021 6:100261347-100261369 CTGGCTCTTGGATTTTCCGGTGG - Intergenic
1012742258 6:103033074-103033096 CTGGTGCCTGCTCTTTTTGGAGG - Intergenic
1012767202 6:103383134-103383156 CTGGGTCTGAGATTTTTTGGGGG - Intergenic
1014463772 6:121730233-121730255 CTGGTTTTTGTATTTTATGGTGG - Intergenic
1014677455 6:124384791-124384813 CTAGTTCTTGTATTTTTTTGCGG + Intronic
1014975047 6:127870021-127870043 CTGGGTCTTACATCTTTTGAAGG + Intronic
1015235745 6:130968965-130968987 GTTTTGCTTGCATTTTTTGGTGG - Intronic
1015403469 6:132812761-132812783 ATCCTTCTTGCCTTTTTTGGAGG - Intergenic
1016480002 6:144470858-144470880 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1017044834 6:150337661-150337683 CTTATTTTTGTATTTTTTGGCGG - Intergenic
1017063354 6:150507131-150507153 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1017224910 6:152009605-152009627 CTGGTGCTTTCATGTTTTGCTGG + Intronic
1017670873 6:156768522-156768544 CTTATTTTTGTATTTTTTGGTGG + Intergenic
1017815454 6:158012999-158013021 CTGGTTCTTAACCTTTTTGGGGG + Intronic
1017856361 6:158352701-158352723 CTGGTTCTTTAACTTTTGGGAGG + Intronic
1017913169 6:158812621-158812643 CTGGTCCTTTAATATTTTGGGGG + Intronic
1017914866 6:158823782-158823804 CTAGTTTTTGTATTTTTTGTAGG + Intergenic
1017981784 6:159406905-159406927 CTGGTTTTTGTACTTTTTGGTGG + Intergenic
1018028632 6:159824687-159824709 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1018239204 6:161755532-161755554 CTGGTACTTTCATATGTTGGGGG + Intronic
1018920605 6:168169795-168169817 GTGATTCTCGCATGTTTTGGGGG + Intergenic
1019191934 6:170256563-170256585 TTGATTTTTGGATTTTTTGGGGG - Intergenic
1019627414 7:2024816-2024838 CTGGTGCTTTCCTTTTTGGGAGG - Intronic
1019651413 7:2161270-2161292 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1019850638 7:3553395-3553417 CTGTTTCTTGCATTATTTCTGGG - Intronic
1020701215 7:11485741-11485763 CTGTTTCTTGACTTCTTTGGAGG - Intronic
1020762527 7:12286184-12286206 CTAATTCTTGTATTTTTTTGTGG + Intergenic
1020840107 7:13206283-13206305 CTAGTTCTAACATTTTTTGGTGG + Intergenic
1021078760 7:16337863-16337885 CTGGTTCTGGGCTTTTCTGGGGG - Intronic
1021186836 7:17574939-17574961 TTGGTTGTTGAATTTTGTGGAGG - Intergenic
1021739076 7:23667397-23667419 CTGATTCTTGTATTTTTGGTAGG + Intergenic
1022187737 7:27986819-27986841 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1022317950 7:29263192-29263214 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1022700194 7:32753336-32753358 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1022825608 7:34009501-34009523 CTGCTACTTGCATTTTGAGGTGG - Intronic
1022847414 7:34224839-34224861 CTTGTTCTTGCAGAATTTGGGGG - Intergenic
1023344048 7:39252957-39252979 CTGGAGCTTACATTCTTTGGGGG - Intronic
1023817294 7:43960976-43960998 CTGGTTACCGAATTTTTTGGGGG + Intergenic
1024305008 7:47922076-47922098 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1025612553 7:63089640-63089662 CTTCTTTTTGCATTTTTTGTAGG - Intergenic
1025775029 7:64553749-64553771 CTGGTTTTCGCATTTTTTGGTGG + Intronic
1025828852 7:65033125-65033147 CTGGTTTTCGTATTTTTTTGTGG + Intergenic
1025966080 7:66273043-66273065 CTAGTTCTAACAATTTTTGGTGG - Intronic
1025968394 7:66297505-66297527 CAGGTTCTTGAATTGTTTTGGGG - Intronic
1025996529 7:66530794-66530816 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1026264589 7:68785137-68785159 CTGGTTCTGGAATTTTCTGGAGG + Intergenic
1026354861 7:69548691-69548713 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1026462631 7:70628584-70628606 CTGATTACTGGATTTTTTGGGGG - Intronic
1026808248 7:73441522-73441544 GTGGTTTTTTTATTTTTTGGGGG + Exonic
1026918988 7:74141195-74141217 CTAGTTTTTGTATTTTTTAGTGG + Intergenic
1026988589 7:74570195-74570217 CTAATTTTTGTATTTTTTGGTGG - Intronic
1027826682 7:83124918-83124940 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1028655305 7:93198579-93198601 CTGTTACTTTCATTTGTTGGAGG - Intronic
1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1029479865 7:100805801-100805823 CTGGATCTGTTATTTTTTGGGGG - Intronic
1029697592 7:102224370-102224392 CTGGTTTTTGTATTTTTAGTAGG + Intronic
1029997996 7:105028495-105028517 CTCTTTCTTGCTTTTTTTTGAGG + Intronic
1029998996 7:105037526-105037548 CTAGTTTTTGTATTTTTTGTAGG + Intronic
1030088625 7:105838232-105838254 GTCGTTCTTTCTTTTTTTGGTGG + Intronic
1030329236 7:108255330-108255352 CTCGTTTTTGTATTTTTTGGTGG + Intronic
1030652542 7:112131113-112131135 CTGCTTCTTGTAGTTTTTGAGGG + Intronic
1030914929 7:115301173-115301195 CTTGTTCTGGCATTATTTTGGGG - Intergenic
1031589836 7:123576827-123576849 CTAGTCCTTGCATTTCTTGCAGG + Intronic
1031601993 7:123721568-123721590 AAGGTTCTTGGATTCTTTGGTGG - Intronic
1031926284 7:127641973-127641995 ATGGTCCTTGCATTTTTTTCAGG - Intergenic
1032028524 7:128463027-128463049 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1032890393 7:136189161-136189183 CTGCTTCTTGCTTGTTTTGGGGG - Intergenic
1033565567 7:142575088-142575110 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1033567120 7:142589554-142589576 CTAATTTTTGCATTTTTTGTAGG + Intergenic
1033602342 7:142897283-142897305 CTTGTTCTTTCTTTTTTTGGGGG - Intergenic
1034019866 7:147630341-147630363 CTGGTTCTGGACTTTTTTGTTGG - Intronic
1034903429 7:154922466-154922488 CTGATTTTTGCATTTTTAGTAGG - Intergenic
1036242389 8:7091667-7091689 CTGTTTCTTCCATGATTTGGAGG - Intergenic
1036705746 8:11045250-11045272 CTAATTTTTGTATTTTTTGGTGG + Intronic
1036899426 8:12659763-12659785 CTGTTTCTTCCATGATTTGGAGG + Intergenic
1036900494 8:12665910-12665932 CTGTTTCTTCCATGATTTGGAGG + Intergenic
1037134715 8:15446559-15446581 CTCGTTTTTGTATTTTTTGGTGG - Intronic
1037774283 8:21822714-21822736 CTGGTACTTGCCTAATTTGGGGG - Intergenic
1038153899 8:24968876-24968898 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1038167834 8:25102597-25102619 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1038274984 8:26113903-26113925 CTAATTTTTGCATTTTTTGTAGG - Intergenic
1038616090 8:29096462-29096484 CTGATTTTTGTATTTTTTTGTGG + Intronic
1039075092 8:33683063-33683085 TTGGTTCCTGATTTTTTTGGGGG + Intergenic
1039104089 8:33971491-33971513 CTGGATTTTTTATTTTTTGGTGG + Intergenic
1039555777 8:38473860-38473882 TTGGTTTTTGTATTTTTTTGTGG + Intergenic
1040041469 8:42919774-42919796 CTGGTTTTCATATTTTTTGGTGG - Intronic
1040514347 8:48122509-48122531 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1040616385 8:49042123-49042145 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1041747310 8:61222136-61222158 CTGGTTCGTTGATATTTTGGAGG + Intronic
1041899981 8:62971469-62971491 CTGGTTTTTGTATTTTTTGTAGG - Intronic
1041985712 8:63920448-63920470 CTTTTTCTTTCTTTTTTTGGGGG - Intergenic
1042720096 8:71818268-71818290 CTGTTTCTTTCAGCTTTTGGTGG - Intergenic
1042786918 8:72558032-72558054 CTTATTCATTCATTTTTTGGGGG + Intronic
1042912707 8:73844311-73844333 CTGGTTTTCGTATCTTTTGGTGG + Intronic
1042929197 8:73996723-73996745 CTAATTTTTGTATTTTTTGGGGG + Intronic
1043045364 8:75316272-75316294 CTTTTTCTTTCTTTTTTTGGTGG + Intergenic
1043394666 8:79824991-79825013 CTGATTTTTGTATTTTTTTGTGG + Intergenic
1043958677 8:86390526-86390548 CTGGTTTTTGTATTTTTTGGTGG - Intronic
1044228070 8:89741955-89741977 GTTTTTATTGCATTTTTTGGGGG - Intergenic
1044828581 8:96222671-96222693 ATGGTGGTTTCATTTTTTGGAGG - Intergenic
1044969307 8:97604518-97604540 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1045022038 8:98052349-98052371 CTGGTTTTTGTATTTGTTGGTGG - Intergenic
1045022234 8:98053693-98053715 CTAATTTTTGTATTTTTTGGCGG + Intergenic
1045235664 8:100350922-100350944 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1045888839 8:107130327-107130349 CTGTTTCTTCCATTTCTTGTTGG + Intergenic
1045982919 8:108212802-108212824 CTTTTTCTTTCTTTTTTTGGGGG - Intronic
1046475802 8:114741470-114741492 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1046599138 8:116297219-116297241 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1046967276 8:120181784-120181806 CTAATTTTTGTATTTTTTGGGGG - Intronic
1048211899 8:132461397-132461419 CTAGTTTTTGTATTTTTTAGTGG - Intronic
1048285197 8:133136149-133136171 GTGCTTCTTTCTTTTTTTGGAGG + Intergenic
1048729529 8:137422823-137422845 CTTATTCTTGCCATTTTTGGGGG - Intergenic
1049515912 8:143055585-143055607 GTGGTTCTTACGTATTTTGGGGG - Intronic
1050114562 9:2250478-2250500 CTGGTTTTTTAATTTTTTTGTGG - Intergenic
1050229815 9:3510326-3510348 TTGTTTGTTGCTTTTTTTGGGGG - Intronic
1050676526 9:8061926-8061948 CTGGATATTGCATTCTTGGGTGG + Intergenic
1050677150 9:8069241-8069263 CTAGTTTTTGTATTTTTTGTAGG + Intergenic
1050790504 9:9462891-9462913 ATGATTCTTTCATTTTTTGTGGG - Intronic
1050862208 9:10449203-10449225 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1051271229 9:15356841-15356863 CTGGTTCCTTCAGTTTTTAGAGG - Intergenic
1051639369 9:19210748-19210770 CTAATTTTTGTATTTTTTGGGGG + Intergenic
1052236339 9:26215729-26215751 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1052274692 9:26663819-26663841 CTGCTTTTTGTATTTTTTGGTGG + Intergenic
1052338504 9:27342630-27342652 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1055297873 9:74852655-74852677 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1055632642 9:78238999-78239021 CTGGTTTTTTTATTTTTTGTAGG - Intronic
1056166668 9:83947677-83947699 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1056338199 9:85598884-85598906 CTAATTTTTGTATTTTTTGGTGG + Intronic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1056736481 9:89214466-89214488 TTCTATCTTGCATTTTTTGGGGG - Intergenic
1057084801 9:92199382-92199404 CTGTTTTTTGCCTTTTTTTGGGG - Intergenic
1057129699 9:92645222-92645244 CTAGTTTTTGAATTTTTTGTAGG - Intronic
1057371171 9:94474524-94474546 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1057603784 9:96483296-96483318 CAGATCCTTGCCTTTTTTGGGGG + Intronic
1057630627 9:96716347-96716369 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1057817266 9:98304762-98304784 CCTGTTCTTTCCTTTTTTGGAGG + Intronic
1058244327 9:102604102-102604124 CTAGTTTTTGTATTTTTTGGTGG - Intergenic
1058390544 9:104490411-104490433 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1059595852 9:115719971-115719993 CTTTTTCTTTTATTTTTTGGAGG - Intergenic
1059815402 9:117907206-117907228 CTGTCTCTTTCTTTTTTTGGAGG + Intergenic
1059880079 9:118678879-118678901 CTGGTTTCTGTATTTTTTGGTGG - Intergenic
1059953138 9:119488656-119488678 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1060620217 9:125058346-125058368 CTAATTTTTGTATTTTTTGGTGG - Intronic
1060635484 9:125196717-125196739 CTGGTTCTGCCATTTTATGTGGG + Intergenic
1060834836 9:126747490-126747512 CAATTTCTTGGATTTTTTGGGGG - Intergenic
1061072337 9:128318860-128318882 ATGGTTTTTGCATTTTTCAGTGG + Intronic
1061131679 9:128712073-128712095 CTGGTTTTTGTATTTTTAGTTGG + Intronic
1061767546 9:132891034-132891056 CTGGTTCTTGGTTTTTCTGTAGG + Intergenic
1061977176 9:134075323-134075345 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
1203771100 EBV:50533-50555 TTTGTGCTTGCGTTTTTTGGGGG + Intergenic
1203634591 Un_KI270750v1:98302-98324 CTGTTTCTTGCACGTTTTGCTGG - Intergenic
1186057649 X:5667070-5667092 CTAATTTTTGTATTTTTTGGTGG + Intergenic
1186083965 X:5965901-5965923 CTGCTTCTTGGATTTTTTATGGG - Intronic
1186368457 X:8920883-8920905 CTGTTTATTGTATATTTTGGTGG + Intergenic
1186559986 X:10601348-10601370 ATGGTTCTTACATTTTTAAGTGG + Intronic
1186818024 X:13257230-13257252 GTTGTTTTTGCATTTTTAGGTGG - Intergenic
1187130757 X:16500519-16500541 CTGGTTCATTAATTTTTTGAAGG - Intergenic
1187193635 X:17060134-17060156 CTAATTTTTGTATTTTTTGGTGG - Intronic
1187635600 X:21224651-21224673 CTGGTTATTGTATTTCTGGGTGG - Intergenic
1187770113 X:22686264-22686286 CTGCTTCCTGTTTTTTTTGGAGG - Intergenic
1188086286 X:25905420-25905442 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1188825887 X:34834168-34834190 CTAATTTTTGTATTTTTTGGAGG - Intergenic
1188888771 X:35583490-35583512 CTGGTACTTGCAGCTTTTGCAGG - Intergenic
1188931293 X:36114450-36114472 CTGGTTCTTTCAAATTTTTGTGG + Intronic
1188951792 X:36384851-36384873 TTGGCTTTTGCATTTTTTGGTGG - Exonic
1189239709 X:39515932-39515954 ATGGTTCTTTCATTTTTAGGGGG - Intergenic
1189342049 X:40211603-40211625 CTGGTTTTTGCAGTTTTTGGTGG - Intergenic
1189879408 X:45473341-45473363 CTTGTTCTAGCATTTATGGGTGG + Intergenic
1189882274 X:45504711-45504733 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1190158916 X:48016468-48016490 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1190174613 X:48138733-48138755 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1190505406 X:51120325-51120347 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1190848409 X:54215354-54215376 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1190906688 X:54735960-54735982 CTGGTTTTCGTATTTTTTGGTGG + Intergenic
1191014864 X:55798245-55798267 CTGATTTTTGCATTTTTTTGTGG - Intergenic
1191160843 X:57328663-57328685 CTGGTTCTTTCTTATTTTTGTGG + Intronic
1191679483 X:63826150-63826172 CTGGTTTTCGTATTTTTTGGTGG - Intergenic
1191778183 X:64841242-64841264 CTGGTCCTCGAATTTTTTGTTGG + Intergenic
1191828568 X:65391929-65391951 CTGGTTTTTGTATTTTTTGGTGG + Intronic
1191894321 X:65975876-65975898 CTGTTTTTTGTATTTTTTGGTGG - Intergenic
1192105226 X:68309086-68309108 CTGGTTCTTGCATTTTTAAAGGG + Intronic
1192217133 X:69167847-69167869 CTAGTTTTTGTATTTTTTAGTGG + Intergenic
1192256549 X:69465490-69465512 CTGGCTCTTGCATTATTTCCTGG + Intergenic
1192324701 X:70122607-70122629 CTGGTTTCCGTATTTTTTGGTGG + Intergenic
1192426015 X:71077269-71077291 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1192500279 X:71645700-71645722 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1192739788 X:73881850-73881872 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
1192982905 X:76366379-76366401 CTGGTTCTTTCTCATTTTGGGGG + Intergenic
1193194187 X:78610201-78610223 CTGCTTCTTTCTCTTTTTGGGGG - Intergenic
1193689427 X:84622558-84622580 CTGGTTCTAGAGTTTCTTGGAGG + Intergenic
1193890119 X:87033805-87033827 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1194442752 X:93953409-93953431 CTGGTTCTTGGGTTTTTTTTAGG + Intergenic
1194800389 X:98265441-98265463 CTAGTTTTTGTATTTTTTAGGGG - Intergenic
1195238747 X:102929415-102929437 CTGGATCTTTCATCCTTTGGAGG + Intergenic
1195888832 X:109670789-109670811 CTGGTTTTCGTATTTTTTGGTGG + Intronic
1196949622 X:120864058-120864080 CTGGTCCTGGGTTTTTTTGGGGG + Intergenic
1198108771 X:133484483-133484505 CTGCTTTTCGTATTTTTTGGTGG - Intergenic
1198189255 X:134286542-134286564 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1198378553 X:136062918-136062940 CTGGTTTTTGTATTTTTAAGTGG + Intergenic
1198478722 X:137020743-137020765 CTAGTTTTTGTATTTTTTGTAGG - Intergenic
1198839556 X:140841738-140841760 CTGATGCCTGCTTTTTTTGGGGG + Intergenic
1199079808 X:143564248-143564270 CTGGTGGTTTTATTTTTTGGGGG - Intergenic
1199600007 X:149536213-149536235 CTTGTTCTTACATCTTTTGCAGG - Intergenic
1199743158 X:150754857-150754879 CTAATTTTTGTATTTTTTGGCGG - Intronic
1199836892 X:151600096-151600118 CTGGTTTTCGTATTTTTTGGTGG - Intronic
1199885917 X:152021926-152021948 CTAATTTTTGTATTTTTTGGTGG - Intergenic
1200618712 Y:5413910-5413932 CTGGTTTTTGTATTTCTTTGGGG + Intronic
1200714127 Y:6518232-6518254 CTAGTCCTTGATTTTTTTGGGGG - Intergenic
1201019697 Y:9642923-9642945 CTAGTCCTTGATTTTTTTGGGGG + Intergenic
1201268395 Y:12230862-12230884 TTTGTTCTTTCCTTTTTTGGGGG - Intergenic
1201440369 Y:14001394-14001416 CTGGTTTTTGTATTTTTTGGTGG - Intergenic
1201444202 Y:14041314-14041336 CTGGTTTTTGTATTTTTTGGTGG + Intergenic
1201948193 Y:19535363-19535385 CTCGTTTTTGTATTTTTTGGTGG + Intergenic
1202178833 Y:22122009-22122031 ATGGTTCCTGCCTTTTGTGGAGG - Intergenic
1202212528 Y:22464385-22464407 ATGGTTCCTGCCTTTTGTGGAGG + Intergenic