ID: 1002632445

View in Genome Browser
Species Human (GRCh38)
Location 5:180590767-180590789
Sequence TGCGCTGGAGTCGGCGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002632445_1002632454 2 Left 1002632445 5:180590767-180590789 CCTCCGCCGCCGACTCCAGCGCA 0: 1
1: 0
2: 2
3: 42
4: 481
Right 1002632454 5:180590792-180590814 GACAGGCTGGGCCACAGGCTTGG 0: 1
1: 0
2: 5
3: 47
4: 443
1002632445_1002632451 -10 Left 1002632445 5:180590767-180590789 CCTCCGCCGCCGACTCCAGCGCA 0: 1
1: 0
2: 2
3: 42
4: 481
Right 1002632451 5:180590780-180590802 CTCCAGCGCAGCGACAGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 132
1002632445_1002632453 -3 Left 1002632445 5:180590767-180590789 CCTCCGCCGCCGACTCCAGCGCA 0: 1
1: 0
2: 2
3: 42
4: 481
Right 1002632453 5:180590787-180590809 GCAGCGACAGGCTGGGCCACAGG 0: 1
1: 0
2: 1
3: 26
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002632445 Original CRISPR TGCGCTGGAGTCGGCGGCGG AGG (reversed) Exonic
900098893 1:952647-952669 GGCCCTGGAGTGGGCGGTGGAGG - Intronic
900116993 1:1033183-1033205 CGCGCGGGAGTCGGGGGCGCCGG + Intronic
900189984 1:1349227-1349249 CGCGCGGGAGCCGGGGGCGGCGG - Intronic
900512548 1:3067522-3067544 TGGGCAGGAGCTGGCGGCGGCGG - Intergenic
901026150 1:6279714-6279736 TGGCCTGGAGTTGGCAGCGGAGG + Intronic
901193724 1:7428031-7428053 AGCACTGGAGTCGGCGTCCGTGG + Intronic
902350103 1:15847938-15847960 GGCGGTGGCGTCGGCAGCGGCGG - Exonic
902400834 1:16155863-16155885 TGCGCTGGCCGCGGCCGCGGCGG - Exonic
902635689 1:17733666-17733688 TGTGCTGGTGTCGGGGCCGGGGG - Intergenic
902689945 1:18104843-18104865 TGAGCTGGAGTCCTTGGCGGAGG - Intergenic
902690586 1:18108104-18108126 TGCCCGGGAGCTGGCGGCGGTGG - Exonic
902823242 1:18956238-18956260 TGCCCTGGCGGGGGCGGCGGCGG - Exonic
903115630 1:21176579-21176601 GGCGGCGGAGGCGGCGGCGGCGG - Intronic
903263422 1:22143122-22143144 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
903475997 1:23619576-23619598 TGCTGTGGCGGCGGCGGCGGCGG - Intronic
904756169 1:32770007-32770029 GGCGCTGGAGGCGGAGGCGGAGG + Exonic
904822730 1:33256167-33256189 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
905553135 1:38859724-38859746 GGCGGTGGTGGCGGCGGCGGCGG - Exonic
909643099 1:77888588-77888610 GCTGCTGGAGACGGCGGCGGCGG + Intronic
912060387 1:105660781-105660803 TGTGGTGGAGTCGGGGGAGGGGG + Intergenic
912305205 1:108560114-108560136 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
912993491 1:114511130-114511152 GGGGCTGGGGGCGGCGGCGGCGG - Exonic
913565563 1:120069430-120069452 TGCCCAGGCGGCGGCGGCGGCGG - Exonic
913632567 1:120724123-120724145 TGCCCAGGCGGCGGCGGCGGCGG + Intergenic
914547188 1:148679549-148679571 TGCCCAGGCGGCGGCGGCGGAGG - Intronic
914619315 1:149390797-149390819 TGCCCAGGCGGCGGCGGCGGCGG + Intergenic
914730393 1:150364665-150364687 TCCTCTGGCGGCGGCGGCGGCGG - Intronic
914889769 1:151612289-151612311 TGCGCCGGGAACGGCGGCGGGGG + Exonic
915070516 1:153261775-153261797 TCCTCTGGAGGCGGCGGCGGCGG + Exonic
915200114 1:154220995-154221017 GGCGTTGGCGGCGGCGGCGGCGG + Intronic
915393272 1:155562880-155562902 GGGGCTGGCGGCGGCGGCGGCGG - Intergenic
917755391 1:178093778-178093800 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
917869598 1:179229638-179229660 GGCGGTGGCGGCGGCGGCGGCGG - Intronic
920684956 1:208102261-208102283 TGGGGTGGAGGCGGAGGCGGAGG - Intronic
920705010 1:208244299-208244321 CGCGGTGGCGGCGGCGGCGGCGG + Exonic
920827091 1:209432270-209432292 TACGGTGGTGGCGGCGGCGGTGG - Intergenic
922427968 1:225517417-225517439 GGCAGTGGAGGCGGCGGCGGAGG + Intronic
922526676 1:226309348-226309370 TCGGCCGGAGGCGGCGGCGGAGG - Exonic
924415164 1:243850287-243850309 GGAGCGGGAGGCGGCGGCGGCGG + Intronic
924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG + Exonic
1062874127 10:931591-931613 CGAGCTGGCGGCGGCGGCGGCGG + Exonic
1064230811 10:13528536-13528558 TGCGGGGAAGGCGGCGGCGGGGG + Intronic
1064230946 10:13528948-13528970 TGCGGTCGCGGCGGCGGCGGCGG + Intronic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065712825 10:28533495-28533517 CGCGCAGGCGGCGGCGGCGGCGG - Exonic
1068690155 10:59906294-59906316 GGCGGGGGAGGCGGCGGCGGTGG - Exonic
1070327925 10:75400097-75400119 GGCGGTGGAGGCGGTGGCGGTGG - Exonic
1070886576 10:79905064-79905086 CGGGCTGGGGTAGGCGGCGGTGG + Intergenic
1072562231 10:96586896-96586918 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1072915522 10:99535450-99535472 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1072950943 10:99846313-99846335 TGGGCTGCAGTGGGCGGAGGAGG - Intronic
1073268068 10:102240494-102240516 TGCGATGGGGTCGGCTGCGGTGG - Intronic
1074503357 10:114045007-114045029 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1074819704 10:117168766-117168788 TGGGATGGTGTCGGGGGCGGGGG - Intergenic
1075192882 10:120327465-120327487 TGAGCTGGAGTCGGCCCAGGTGG + Intergenic
1075629318 10:123991687-123991709 GGCGGTGGCGGCGGCGGCGGAGG + Intergenic
1075802147 10:125160357-125160379 CACCCTGGAGGCGGCGGCGGCGG + Intronic
1075816707 10:125270291-125270313 TGGGCAGGGGACGGCGGCGGGGG + Intergenic
1076554241 10:131311646-131311668 CGCGCTGACGGCGGCGGCGGGGG + Exonic
1076750086 10:132538057-132538079 GGCGCTGGGCTGGGCGGCGGCGG - Exonic
1077058597 11:607960-607982 GGCGCTGGAGTCGGAGCCGGTGG - Exonic
1077214543 11:1389990-1390012 GGCGCGGGCCTCGGCGGCGGCGG + Intronic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1081805143 11:45886165-45886187 TGCGCTGGAATTGGAGGAGGGGG + Intronic
1083670877 11:64299457-64299479 TGCGCTGGACAGGGCGGTGGAGG - Exonic
1083728871 11:64642721-64642743 GGCGGTGGAGGCGGCGGCAGGGG + Intronic
1083751970 11:64765969-64765991 GGCGGTGGAGGCGGCGGAGGGGG + Intronic
1083967659 11:66052430-66052452 TGGCCTGGAGGTGGCGGCGGCGG - Exonic
1084003830 11:66313135-66313157 TACACTGCAGTCGGAGGCGGGGG - Intergenic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1084345161 11:68542136-68542158 TGTGCTGGAGTGGGCGGGGGTGG + Intronic
1086887743 11:92224599-92224621 CGCGCGGGAGGGGGCGGCGGAGG - Intergenic
1088579120 11:111299287-111299309 TGCGCTGGGTGCGGCGGCCGAGG - Exonic
1088935988 11:114400668-114400690 TGAGATGGGGGCGGCGGCGGCGG + Exonic
1089253113 11:117179218-117179240 AGCGGTGGTGGCGGCGGCGGCGG - Exonic
1090537393 11:127658790-127658812 GGAGCAGGAGGCGGCGGCGGTGG - Intergenic
1091434231 12:460572-460594 GGCGCGGGGGTGGGCGGCGGCGG + Intronic
1091498303 12:991239-991261 TGCTGTGGCGGCGGCGGCGGCGG + Intronic
1091558585 12:1594170-1594192 TGGGCCCGAGGCGGCGGCGGCGG - Intronic
1091759457 12:3077382-3077404 TCCGCTGGCGGCGGCGGCGGCGG + Exonic
1093464990 12:19439895-19439917 GGCGGCGGAGGCGGCGGCGGAGG + Exonic
1094884562 12:34850234-34850256 TGCGGTGGGGTCGGGGGAGGGGG - Intergenic
1095752802 12:45729686-45729708 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1096482457 12:51951713-51951735 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1096593080 12:52675338-52675360 GGCTCTGGAGGCGGCGGCGGCGG - Exonic
1096593097 12:52675407-52675429 GGCTCTGGAGGTGGCGGCGGCGG - Exonic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096774403 12:53955365-53955387 GGCGGTGGCGACGGCGGCGGCGG + Exonic
1096779948 12:53985963-53985985 TGGGCTGGAGTCGGCAGCTTTGG - Exonic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096826214 12:54280079-54280101 TGCGCAGAAGGCGGCGGCGGTGG - Exonic
1097164877 12:57078669-57078691 GGCTCGGGAGTCGGGGGCGGTGG - Exonic
1100869442 12:98894979-98895001 TGCCCTGGCGGCAGCGGCGGCGG + Intronic
1101970689 12:109309958-109309980 GGCGGTGGCGGCGGCGGCGGAGG + Intergenic
1102197411 12:111034862-111034884 GGCTCTGGCGGCGGCGGCGGCGG - Intronic
1103342644 12:120229258-120229280 TGTGCTGCAGTCGGGGGTGGGGG - Intronic
1103479270 12:121240744-121240766 TGCGGGGGAGCCGGGGGCGGGGG + Exonic
1103725485 12:122995590-122995612 TGCGGTGGTGGCGGTGGCGGCGG - Exonic
1103779404 12:123389123-123389145 GGCGCTGGTGGCGGCGGCGAGGG + Intronic
1103779528 12:123389455-123389477 CGCGGTGGAGGCGGCGGCGGCGG + Exonic
1103800345 12:123533709-123533731 TGCTCCCGAGTGGGCGGCGGCGG + Exonic
1103954259 12:124567604-124567626 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1104637525 12:130447471-130447493 AGCGCTGGAGGCGGGGGAGGAGG + Intronic
1104983385 12:132583612-132583634 TGCGCCGAGGGCGGCGGCGGCGG - Exonic
1105217513 13:18297715-18297737 CGCGGTGGAGGCGGCGGCGGCGG + Intergenic
1107549125 13:41458289-41458311 GGCCCTGGACTCGGCGGCCGCGG + Exonic
1107624844 13:42272051-42272073 TGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1108063189 13:46553150-46553172 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1108685427 13:52815335-52815357 TGCCCAGGAGCCGGCGGCGGGGG + Intergenic
1109284853 13:60397592-60397614 TCCCCTGGAGGCGGCGGCGGCGG + Intronic
1110119741 13:71866468-71866490 GGCGGTGGCGGCGGCGGCGGTGG - Exonic
1110436464 13:75482105-75482127 AGCGCTGGAGCCGGCGGCCGCGG - Exonic
1110558514 13:76886262-76886284 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1111676810 13:91398651-91398673 GGCGGCGGAGGCGGCGGCGGCGG + Intergenic
1112158131 13:96839845-96839867 TGCGCTGGTGTGGGCAGCGAGGG - Intergenic
1112504967 13:99970081-99970103 GGAGCTGGTGGCGGCGGCGGCGG + Intronic
1112505035 13:99970408-99970430 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1113381804 13:109811606-109811628 TGCGCTGGAGTCAGAGGGGAGGG - Intergenic
1113841562 13:113364178-113364200 GGGGCTGGAGGCGGGGGCGGGGG + Intergenic
1114194011 14:20461328-20461350 TGAGCGGGAGGCGGCGGTGGCGG - Exonic
1114519003 14:23321466-23321488 GGCGATGGCGGCGGCGGCGGCGG + Exonic
1115399315 14:32939411-32939433 GGCGGCGGAGGCGGCGGCGGCGG - Intronic
1115810299 14:37099589-37099611 TGAGGGGGAGTCGGTGGCGGGGG - Intronic
1117424422 14:55580253-55580275 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
1117602571 14:57390638-57390660 TGCGAAGGAGGCGGCGGCGGTGG + Exonic
1117803105 14:59464974-59464996 AGCGCGGGAGGCGGGGGCGGCGG - Exonic
1117875779 14:60249215-60249237 CGCGCTAGAGGCGGCGGCGGCGG + Intronic
1118186538 14:63543125-63543147 TGCCCCGGACCCGGCGGCGGCGG + Exonic
1118836822 14:69484086-69484108 TGCGCGCTAGGCGGCGGCGGCGG + Intergenic
1121283857 14:92719261-92719283 GGCGGTGGCGGCGGCGGCGGTGG - Intronic
1121283865 14:92719285-92719307 GGCGGTGGCGGCGGCGGCGGCGG - Intronic
1121283873 14:92719309-92719331 GGCGGTGGCGGCGGCGGCGGTGG - Intronic
1121368090 14:93332873-93332895 GGTGCTGGTGGCGGCGGCGGCGG - Exonic
1121417508 14:93789096-93789118 GGCGCTGGCGGCGGCGGCGGGGG - Intergenic
1122081696 14:99271316-99271338 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1122130724 14:99603445-99603467 AGCGGTGGCGGCGGCGGCGGGGG - Exonic
1122291965 14:100685688-100685710 TGCGGTGGAGGGGGCTGCGGTGG - Intergenic
1122292035 14:100685874-100685896 TGCGGTGGAGGGGGCTGCGGTGG - Intergenic
1122292093 14:100686028-100686050 TGCGGTGGAGGGGGCTGCGGTGG - Intergenic
1122292146 14:100686166-100686188 TGCGGTGGAGGGGGCTGCGGTGG - Intergenic
1122292163 14:100686210-100686232 TGCGGTGGAGGGGGCTGCGGTGG - Intergenic
1122470826 14:101964841-101964863 CGCGCTGGAGGCGGCGCTGGAGG + Exonic
1122558293 14:102592963-102592985 GGCGGCGGAGGCGGCGGCGGCGG - Exonic
1122635333 14:103127075-103127097 GGAGCTGGCGGCGGCGGCGGCGG + Exonic
1122736672 14:103847523-103847545 TGAGGTTGAGGCGGCGGCGGCGG - Exonic
1123739934 15:23226415-23226437 TGCGCGCGAGTCGGAGGCCGCGG - Intergenic
1124291158 15:28455383-28455405 TGCGCGCGAGTCGGAGGCCGCGG - Intergenic
1124484434 15:30102501-30102523 TTCCCTGGTGGCGGCGGCGGTGG - Intergenic
1124519149 15:30394723-30394745 TTCCCTGGTGGCGGCGGCGGTGG + Intergenic
1124539507 15:30571498-30571520 TTCCCTGGTGGCGGCGGCGGTGG - Intergenic
1124650265 15:31469133-31469155 TGGGCAGAAGTCGGGGGCGGGGG - Intergenic
1124759143 15:32436074-32436096 TTCCCTGGTGGCGGCGGCGGTGG + Intergenic
1127144110 15:56007288-56007310 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144118 15:56007306-56007328 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144126 15:56007324-56007346 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144134 15:56007342-56007364 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144142 15:56007360-56007382 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127763574 15:62164450-62164472 CGCGCAGGAGGCGGCAGCGGCGG + Exonic
1128374788 15:67066732-67066754 GGGGCGGGAGGCGGCGGCGGAGG - Intronic
1129016721 15:72474868-72474890 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1129676039 15:77632810-77632832 AGCGCAGGCGGCGGCGGCGGCGG - Intronic
1131514249 15:93066625-93066647 CGAGGTGGAGGCGGCGGCGGTGG - Intronic
1132877961 16:2148666-2148688 TCCCCTGGCGGCGGCGGCGGCGG - Exonic
1132885170 16:2179259-2179281 GGCGCTGTGGGCGGCGGCGGCGG + Exonic
1133661645 16:7924174-7924196 TGAGCTGGGGTCGGGGGTGGCGG - Intergenic
1133859877 16:9584637-9584659 TGCGGTGGGGTCGGGGGAGGGGG - Intergenic
1134149871 16:11797187-11797209 AGCGGTGGCGGCGGCGGCGGCGG + Intronic
1134656110 16:15949617-15949639 AGCGCTGGCGGCGGCGGCGGCGG - Exonic
1135517668 16:23149155-23149177 CGCGCTGGCGGCGGCGGCGCGGG - Exonic
1135597456 16:23755122-23755144 TGCGCCCGCGTCGGCGGCTGCGG + Intronic
1135712495 16:24729674-24729696 GGCGGCGGTGTCGGCGGCGGCGG + Intronic
1136110890 16:28063197-28063219 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1136519498 16:30786826-30786848 AGCGCGGGGGTCGGTGGCGGGGG - Intronic
1136913646 16:34162598-34162620 GGGGATGGAGTCGGCGGGGGAGG - Intergenic
1137655256 16:50153549-50153571 TGCGCCTGAGGCGGCGGCGGCGG + Intronic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1138247623 16:55479277-55479299 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1139466139 16:67155125-67155147 TGGGCAGGTGGCGGCGGCGGCGG + Exonic
1139652483 16:68369443-68369465 TGGGCTGGGGTAGGGGGCGGGGG + Intronic
1139676447 16:68526983-68527005 TGCGCAGGAGCCTGGGGCGGGGG - Intergenic
1140187412 16:72787702-72787724 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1140223248 16:73058688-73058710 CGCGCTGCTGGCGGCGGCGGCGG + Intronic
1140927588 16:79599214-79599236 AGCGCTGGGGGCGGCGGCGGCGG - Exonic
1141797928 16:86287095-86287117 AGCGCGGGAGTGAGCGGCGGCGG - Intergenic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1142799709 17:2337548-2337570 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1143063371 17:4222237-4222259 GGAGCTGCAGTCGGCGGCCGCGG + Intronic
1143494976 17:7307658-7307680 GGCGGTAGAGGCGGCGGCGGCGG + Intronic
1143539763 17:7562011-7562033 GGCGCTGGTGGCGGCGGTGGCGG + Exonic
1143590774 17:7885032-7885054 AGCGGTGGCGGCGGCGGCGGCGG - Exonic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1144766850 17:17737798-17737820 TTCTCTGGAGTAGGCGGAGGTGG - Intronic
1145925654 17:28644951-28644973 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1145980092 17:29005993-29006015 GGCGCTGGCGGCGGCAGCGGCGG - Exonic
1146173453 17:30650030-30650052 TGCGGGGGAGTCGGCGTTGGTGG + Intergenic
1146346910 17:32066060-32066082 TGCGGGGGAGTCGGCGTTGGCGG + Intergenic
1146403673 17:32519464-32519486 GGCTCTGGCGGCGGCGGCGGGGG + Intronic
1147285911 17:39402285-39402307 GGCGGGGGAGGCGGCGGCGGCGG - Intronic
1147395665 17:40140663-40140685 AGCGCCGGAGGCGGCGGCAGCGG + Exonic
1147406976 17:40219363-40219385 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1147967222 17:44199774-44199796 CGGGCTGGAGTGGGGGGCGGGGG - Intronic
1147971148 17:44219608-44219630 TGCTGTGGCGGCGGCGGCGGCGG + Intronic
1148060099 17:44830241-44830263 GGAGCGGGAGGCGGCGGCGGCGG - Intronic
1148178038 17:45584723-45584745 TGGGGTGGGGCCGGCGGCGGCGG + Intergenic
1148406992 17:47424153-47424175 TCCGGTGGACTAGGCGGCGGCGG - Intronic
1148437173 17:47693985-47694007 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1148551067 17:48551100-48551122 GGCGGTGGCGGCGGCGGCGGGGG - Exonic
1148551082 17:48551139-48551161 GGCGGTGGCGGCGGCGGCGGAGG - Exonic
1150645825 17:66976902-66976924 TGGGCTGGAGACGGAGGGGGCGG - Intronic
1151558692 17:74859883-74859905 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
1152520197 17:80851602-80851624 TGCCTGGGAGTCGGCGTCGGAGG - Intronic
1152725281 17:81942055-81942077 TGCGCGGGAGGCGGAGGTGGGGG - Intronic
1152797264 17:82314561-82314583 TGCCCTGGGGTCGGCCTCGGAGG + Intergenic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1156099672 18:33578483-33578505 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
1157384296 18:47248306-47248328 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1157867059 18:51196780-51196802 TGCCCGGGAGGCGGCGGCCGCGG - Exonic
1157867200 18:51197232-51197254 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1158259097 18:55588112-55588134 GGCGCAGGAGCAGGCGGCGGCGG - Intronic
1159040575 18:63320029-63320051 TTCGCTGGCAGCGGCGGCGGCGG + Exonic
1160025390 18:75211668-75211690 CGCTCAGGAGGCGGCGGCGGCGG - Intronic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160725377 19:615947-615969 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1160773427 19:843881-843903 GGCGCTGGGGTCTGCGGGGGTGG - Exonic
1160810565 19:1011275-1011297 GGCGCTGGAGGCGGGGGTGGTGG - Intronic
1160994437 19:1876150-1876172 GGCAGTGGAGACGGCGGCGGCGG - Intergenic
1161080596 19:2308162-2308184 AGCCCGGGAGGCGGCGGCGGCGG - Intronic
1161124206 19:2546789-2546811 GGCGGTGGGGTCGGCGGGGGCGG + Intronic
1161450698 19:4343848-4343870 AGCGGAGGAGGCGGCGGCGGCGG + Exonic
1161494995 19:4581669-4581691 CGCGCTGGCGTCGGCTCCGGGGG + Intergenic
1161801109 19:6417147-6417169 TGCGCTGGAGGCGGCGTTGCAGG - Intronic
1161851406 19:6739726-6739748 TGCGGTGGTGGCTGCGGCGGCGG + Exonic
1162030915 19:7916919-7916941 CGCGATGGCGGCGGCGGCGGCGG - Exonic
1162100214 19:8334650-8334672 TGCGGAGGAGGCAGCGGCGGGGG - Exonic
1162381235 19:10333181-10333203 TGCGCGGGGGTCGTTGGCGGGGG - Intronic
1162752685 19:12838513-12838535 AGCGGCGGAGGCGGCGGCGGCGG - Exonic
1162988969 19:14290030-14290052 TGCGGGGGAGTCGGCGTTGGCGG - Intergenic
1163138815 19:15332515-15332537 TGCGCTGGCGGCGGCGGCGGCGG - Intronic
1163146152 19:15380234-15380256 TCCTCTGGGGGCGGCGGCGGTGG + Exonic
1163586948 19:18169338-18169360 TGCGCCGGAGGCTGCGGCGGCGG + Exonic
1165080046 19:33301843-33301865 TGCGAGGGCGGCGGCGGCGGCGG + Exonic
1165300322 19:34964252-34964274 AGGGCTGCAGGCGGCGGCGGTGG - Intergenic
1165995481 19:39840637-39840659 GGAGGTGGAGGCGGCGGCGGCGG - Exonic
1166769939 19:45275581-45275603 TGCGCTGGAGGTGGCAGTGGTGG + Intronic
1166888058 19:45973452-45973474 TGCGGCGGCGGCGGCGGCGGGGG + Exonic
1166975112 19:46601290-46601312 GGGGCGGGAGGCGGCGGCGGCGG + Exonic
1167104035 19:47419973-47419995 TGCGCTGGGGGCGGCGGGGGTGG + Intergenic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167456152 19:49597465-49597487 GGCGCGGGAGGCGGCGGTGGCGG - Exonic
1167461436 19:49626468-49626490 GGCGCTGGAGTGGGTGGCAGTGG + Intergenic
1168072677 19:53961606-53961628 TGGGCTGGAGATGGCGGGGGGGG + Intergenic
1168076346 19:53982595-53982617 GGCGCCGGGGGCGGCGGCGGAGG + Exonic
1168695460 19:58401496-58401518 TGCGCTGGAGATTGCGACGGGGG + Intronic
926090028 2:10043626-10043648 TGGGCTGCGGGCGGCGGCGGCGG - Exonic
927606503 2:24491242-24491264 GGCGGTGGCGGCGGCGGCGGTGG + Intergenic
929175499 2:38971413-38971435 TGCCCTGCAGTCGGCCACGGTGG + Intronic
929511451 2:42568684-42568706 TGAGGAGGAGGCGGCGGCGGCGG + Intronic
929778340 2:44942231-44942253 GGCGCGGGAGGCGGCAGCGGCGG + Exonic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
933908138 2:86914498-86914520 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
934011476 2:87824867-87824889 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
934296792 2:91748935-91748957 CGCGCTGGAGGCGGCGGCGGCGG - Intergenic
935592884 2:104857038-104857060 TGCGGAGGCGGCGGCGGCGGCGG - Exonic
938338999 2:130523055-130523077 GGCGCGGGAGTTGGCGCCGGGGG + Intronic
938350839 2:130597695-130597717 GGCGCGGGAGTTGGCGCCGGGGG - Intronic
939757283 2:146130333-146130355 TGCTCTGGAGTCAGTGGGGGTGG + Intergenic
941686841 2:168456304-168456326 CGCGGAGGAGGCGGCGGCGGCGG + Exonic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
942241028 2:173964410-173964432 TGCGGTGGCGGCGGCAGCGGCGG - Exonic
942346216 2:175005258-175005280 CGCACTGGCGGCGGCGGCGGCGG + Intronic
942565917 2:177264654-177264676 GGCTCTGGTGGCGGCGGCGGCGG + Exonic
942748647 2:179264407-179264429 GCCGGTGCAGTCGGCGGCGGCGG - Intronic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944933634 2:204545562-204545584 GGGGCTGGAGTGGGCGGCGGCGG - Intergenic
947215470 2:227745963-227745985 TGCGGTGGTGGCTGCGGCGGTGG + Intergenic
947416358 2:229900750-229900772 TGCTCTGGAGGCTGCGGCAGGGG + Intronic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
1169065640 20:2692999-2693021 GGCGCTGGCGCTGGCGGCGGCGG + Exonic
1170150450 20:13221552-13221574 TGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1172331162 20:34077054-34077076 GGCGCCGGCGGCGGCGGCGGTGG + Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1173672932 20:44810484-44810506 TGTGCTGCTGGCGGCGGCGGCGG + Intergenic
1173681537 20:44885724-44885746 GGCTCCGGAATCGGCGGCGGCGG - Exonic
1174804674 20:53594441-53594463 GGAGGCGGAGTCGGCGGCGGGGG - Intronic
1175139449 20:56849002-56849024 TGGGCTGCAGTGGACGGCGGAGG + Intergenic
1175326158 20:58129851-58129873 AGCGCTGGAGACGGCTGCGGAGG - Intergenic
1175715510 20:61252432-61252454 GGCGGTGGTCTCGGCGGCGGCGG + Exonic
1176142111 20:63549288-63549310 TGGGGAGGAGACGGCGGCGGGGG - Intronic
1176145038 20:63561799-63561821 TGCGCCGGGGTCGGCGGTGGGGG - Intronic
1176549398 21:8214744-8214766 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176557293 21:8258973-8258995 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176568326 21:8397778-8397800 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176576235 21:8442008-8442030 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1176952685 21:15065054-15065076 CGCGGCGGACTCGGCGGCGGAGG - Intergenic
1178961735 21:37072667-37072689 TGCGCTCGAGGCGGGGGCGCGGG - Exonic
1179537325 21:42060985-42061007 TGTGCTGGTGTGGGCGGAGGCGG + Intergenic
1179561596 21:42219241-42219263 TGCCCCGGGGGCGGCGGCGGCGG - Exonic
1179775527 21:43659544-43659566 TGCACAGAAGGCGGCGGCGGCGG - Exonic
1181085142 22:20436424-20436446 GGCCCGGGAGTCCGCGGCGGCGG + Intronic
1181793072 22:25282860-25282882 TCAGCTGGCGGCGGCGGCGGCGG + Intergenic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182338002 22:29598143-29598165 TGCGCAGGAGCCCACGGCGGTGG + Intergenic
1182586360 22:31346203-31346225 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1183524975 22:38317408-38317430 AGCGCGCGAGCCGGCGGCGGGGG - Exonic
1184037606 22:41926150-41926172 TGAGCTGGAGGCGGCGACAGCGG - Exonic
1184072044 22:42152550-42152572 AGGGTTGGAGTGGGCGGCGGAGG - Intergenic
1184523808 22:45009883-45009905 CGCGCGGGAGGAGGCGGCGGCGG - Intronic
1184891018 22:47379231-47379253 GGCGAAGGAGGCGGCGGCGGAGG + Intergenic
1184891044 22:47379312-47379334 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891049 22:47379327-47379349 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891054 22:47379342-47379364 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1184891059 22:47379357-47379379 GGCGGCGGAGGCGGCGGCGGCGG + Intergenic
1185055291 22:48575933-48575955 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1185335792 22:50270378-50270400 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1203254285 22_KI270733v1_random:131066-131088 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1203262341 22_KI270733v1_random:176145-176167 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
949709923 3:6861352-6861374 TGCGGTGGCGGCGGCGGCGCTGG - Exonic
950007993 3:9703887-9703909 TGCCGCGGTGTCGGCGGCGGCGG - Exonic
950478912 3:13232624-13232646 TGAGCTGGAGTCAGGGGCGCAGG + Intergenic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
951208322 3:19947262-19947284 AGCGCCGGCGGCGGCGGCGGCGG + Exonic
951901589 3:27663026-27663048 TGTGATGGAGTCGGCAGGGGTGG - Intergenic
953563500 3:44012683-44012705 TGCGCTGGAGACGGCGGAGATGG - Intergenic
954210411 3:49093930-49093952 TGCAGCGGAGGCGGCGGCGGCGG - Exonic
955769237 3:62372522-62372544 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
955769243 3:62372540-62372562 GGCGGCGGAGGCGGCGGCGGCGG - Exonic
956659486 3:71583799-71583821 AGCGCCGGTGGCGGCGGCGGCGG + Intronic
956978924 3:74614448-74614470 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
960638954 3:119809523-119809545 GGAGCTGGAGAAGGCGGCGGGGG + Intronic
961377436 3:126476063-126476085 GGCGCCGGAGGCGGAGGCGGGGG + Intergenic
961684531 3:128620530-128620552 GGTGCTGAAGTCGGCGGTGGAGG - Exonic
961698822 3:128726139-128726161 TCCGCTCGGGGCGGCGGCGGTGG + Exonic
961827174 3:129605297-129605319 GGCGGTGGCGGCGGCGGCGGCGG - Intronic
962199170 3:133387533-133387555 AGCACTGGACTCGGGGGCGGAGG + Intronic
962793992 3:138835007-138835029 CGCGGTGGCGGCGGCGGCGGCGG + Intergenic
964219124 3:154324289-154324311 TCCGGAGGAGGCGGCGGCGGCGG - Exonic
966866515 3:184261465-184261487 TGGGCAGGCGGCGGCGGCGGCGG + Intronic
967055646 3:185826163-185826185 AGCGCTGGGGTCAGCGGCCGGGG + Intergenic
969413156 4:7042794-7042816 GGAGCTGGAGTCGGAGCCGGAGG - Exonic
970195096 4:13544526-13544548 CGCGCAGCAGTGGGCGGCGGCGG - Exonic
970332881 4:15003256-15003278 AGCGGCGGAGGCGGCGGCGGCGG - Exonic
972671444 4:41216399-41216421 CGCGGTGGAGTCCGCGGCGGCGG + Intronic
973279216 4:48341707-48341729 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
973820551 4:54658400-54658422 TGCGCGGGGGGCGGAGGCGGGGG + Intronic
975342532 4:73258358-73258380 GGCGGTGGAGGCGGCGGTGGAGG - Exonic
975778980 4:77819664-77819686 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
977257547 4:94757913-94757935 CGCGGTGGCGGCGGCGGCGGCGG + Intergenic
978072533 4:104491315-104491337 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
978072612 4:104491497-104491519 GGCGGTGGCGGCGGCGGCGGTGG + Exonic
978361101 4:107931780-107931802 TGGGCTGGAGCTGGCTGCGGAGG + Exonic
978720378 4:111900663-111900685 TGTGGTGGGGTCGGCGGAGGGGG + Intergenic
978998007 4:115179507-115179529 TGCACAGGAGTCCACGGCGGGGG + Intergenic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
979785648 4:124712704-124712726 TGCCCTGACGGCGGCGGCGGCGG - Exonic
981093361 4:140755924-140755946 GGCGATGGAGGCGGCGGCGGCGG - Exonic
984668101 4:182449201-182449223 GGCGGTGGTGGCGGCGGCGGCGG + Intronic
986330463 5:6713469-6713491 TGCGGCGGCGGCGGCGGCGGCGG - Intergenic
986330587 5:6713855-6713877 TGGGCCGGTGGCGGCGGCGGCGG - Intergenic
986330672 5:6714121-6714143 GGCGCTGGACACGGCGGCCGCGG + Intergenic
987258265 5:16179469-16179491 GGCGGCGGCGTCGGCGGCGGCGG + Exonic
987572876 5:19687690-19687712 TGCTCTGGAGATGGCGGCAGTGG - Intronic
988609537 5:32711852-32711874 GGCGGTGGCGTTGGCGGCGGCGG + Exonic
988609539 5:32711858-32711880 GGCGTTGGCGGCGGCGGCGGTGG + Exonic
989812572 5:45695876-45695898 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
990210765 5:53480139-53480161 GGCGCTGGAGGCGGTGGCGGGGG - Intergenic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
991676503 5:69094092-69094114 TGAGCCGGAGCCGGCGACGGCGG + Exonic
992052750 5:72956199-72956221 TGCGCTTCGGGCGGCGGCGGCGG + Intronic
992105589 5:73447416-73447438 TGCGGTGGCGGGGGCGGCGGGGG + Exonic
994043624 5:95284668-95284690 GGCGCTGGCGGTGGCGGCGGCGG + Intergenic
994043626 5:95284674-95284696 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
995052721 5:107724736-107724758 TGGGCGGGAGGCGGCAGCGGTGG - Intergenic
995106237 5:108381012-108381034 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
995650560 5:114363040-114363062 AGCACTGGAGGAGGCGGCGGCGG + Exonic
996404258 5:123090462-123090484 TGCGGTGGTGGTGGCGGCGGCGG + Exonic
996862817 5:128084239-128084261 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
997732787 5:136193019-136193041 TGCGGTGGCGGCGGCGCCGGAGG - Intergenic
997980717 5:138465966-138465988 GGCGGTGGAGGCGGCGGGGGCGG + Exonic
999166183 5:149551305-149551327 TGGGCCGGAGCCGGCGGCAGTGG - Intronic
1001724884 5:173888408-173888430 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1002029304 5:176416300-176416322 TGCCCCGGAGGCGGCGGAGGAGG - Exonic
1002189456 5:177471173-177471195 TGAGCTGGAGTCGGGGGCTGAGG + Intronic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002591072 5:180291977-180291999 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1002926696 6:1609455-1609477 AGCGCTGGCGTCGGCGGGGCTGG + Intergenic
1003069710 6:2936102-2936124 TGCGCGGGAGCCCACGGCGGCGG - Intergenic
1003645532 6:7910644-7910666 GGCCCAGGAGGCGGCGGCGGCGG - Exonic
1004043935 6:12009115-12009137 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1004663349 6:17729038-17729060 CGCGCAGGAGCCGGCGGTGGTGG - Intergenic
1005808951 6:29501760-29501782 TGCTCTGGAGGCGTCGGGGGAGG + Intergenic
1006089678 6:31620919-31620941 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1006180383 6:32150510-32150532 TGGGCTGGCGCCGGCGGGGGCGG + Exonic
1006337545 6:33428238-33428260 CGCGGTGGCGGCGGCGGCGGCGG + Intronic
1006516816 6:34549957-34549979 TGGGCTGGAGTCAGGGGCTGTGG + Intronic
1006558569 6:34889517-34889539 GGCTCTGGGGGCGGCGGCGGCGG + Exonic
1007665296 6:43509941-43509963 TGCGGCGGAGGCTGCGGCGGGGG + Exonic
1008670911 6:53768020-53768042 TGGGCTGGAGTGGGCGGGGGAGG - Intergenic
1009431631 6:63572570-63572592 GGCGATGCAGGCGGCGGCGGGGG - Exonic
1010386334 6:75284735-75284757 GGCGCTGGTGGCTGCGGCGGCGG - Exonic
1010414868 6:75601805-75601827 CGCGCTGGGGGCGGCGGCGTCGG + Intronic
1010703129 6:79077106-79077128 CGCGCGAGAGTCGGCGGCGGCGG - Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1012167753 6:95980046-95980068 TGTGGTGGGGTCGGCGGAGGGGG - Intergenic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1014029118 6:116681133-116681155 TGCACTCGACGCGGCGGCGGCGG - Intergenic
1014137542 6:117907194-117907216 GGCGCCGGCGGCGGCGGCGGCGG - Intergenic
1015251890 6:131135714-131135736 TGGGCTGGCGGCAGCGGCGGTGG - Exonic
1016733745 6:147453541-147453563 TGTGCTGGGGTGGGGGGCGGGGG - Intergenic
1017103156 6:150865925-150865947 GGCGGCGGAGGCGGCGGCGGTGG + Exonic
1017164214 6:151391768-151391790 AGTGCTGCAGGCGGCGGCGGCGG - Intergenic
1017671866 6:156777263-156777285 TGCGCCGGGGCGGGCGGCGGCGG + Intergenic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1018156650 6:160991701-160991723 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
1018156731 6:160992013-160992035 GGCGGTGGTGGCGGCGGCGGCGG - Exonic
1018420904 6:163640628-163640650 AGCGCTGGCGTGGGCGACGGTGG - Intergenic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1018902489 6:168058541-168058563 TGTGGTGGAGCCGGGGGCGGGGG + Intronic
1019509664 7:1411558-1411580 TGCGGAGGAATCGGGGGCGGCGG + Intergenic
1019711488 7:2520026-2520048 CGGGCTGGGGGCGGCGGCGGCGG + Exonic
1019731508 7:2631928-2631950 TGCGGAGGGGGCGGCGGCGGCGG + Intergenic
1019989614 7:4682462-4682484 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1020204545 7:6104906-6104928 TGACCCGGAGGCGGCGGCGGCGG + Exonic
1021451277 7:20785406-20785428 CGAGCTGGAGGCGGCGGCTGCGG + Exonic
1022090048 7:27102141-27102163 TGCGGCGGTGGCGGCGGCGGCGG + Exonic
1022090049 7:27102144-27102166 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1022101089 7:27169597-27169619 AGCGGCGGAGGCGGCGGCGGCGG - Intronic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022375281 7:29806603-29806625 GGAGCCGGAGGCGGCGGCGGCGG + Exonic
1022960183 7:35418902-35418924 GGCGGTGGTGGCGGCGGCGGCGG + Intergenic
1023000436 7:35801829-35801851 TGTGGTGGAGGCGGCGGCGGCGG + Intronic
1023417892 7:39949852-39949874 TCTGCTGGCGGCGGCGGCGGCGG + Intergenic
1024043861 7:45574559-45574581 CGCGGCGGAGGCGGCGGCGGAGG + Exonic
1025916893 7:65873252-65873274 GGCGGTGGTGGCGGCGGCGGCGG + Intronic
1027121897 7:75527903-75527925 AGCCCCGGAGTCGGCGGCGCTGG - Intergenic
1027539886 7:79453600-79453622 GGTGGTGGCGTCGGCGGCGGCGG + Intergenic
1028774963 7:94665647-94665669 TAAGATGGAGGCGGCGGCGGTGG - Exonic
1028985553 7:97006116-97006138 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1029222353 7:99000586-99000608 AGTGCTGGAGACGGCGGCAGTGG - Intronic
1029238795 7:99144026-99144048 GGCGGCGGAGGCGGCGGCGGAGG - Exonic
1029456215 7:100673839-100673861 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1029738608 7:102478895-102478917 GGCTCTGGTGGCGGCGGCGGCGG - Exonic
1030102098 7:105955886-105955908 TGCGCAGGAGCCCACGGCGGCGG + Intronic
1030739070 7:113086584-113086606 TGCGGTGGCGAGGGCGGCGGCGG + Intronic
1033033216 7:137846764-137846786 CGGGCTGGCGGCGGCGGCGGCGG + Exonic
1033899301 7:146116209-146116231 GGAGCTGGCGGCGGCGGCGGCGG + Intergenic
1034317716 7:150148957-150148979 TGGGCTGGAGACAGCGGCAGTGG - Intergenic
1034441074 7:151086396-151086418 TGTGCCGGAGCCGGCGGGGGCGG + Intronic
1034441152 7:151086680-151086702 CGCGGCGGAGGCGGCGGCGGCGG - Intronic
1034775042 7:153818268-153818290 TGGGCTGGAGACAGCGGCGGTGG + Intergenic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1037535229 8:19817438-19817460 CGCGGTGGCGGCGGCGGCGGCGG + Exonic
1037788895 8:21919678-21919700 GGCGACGGCGTCGGCGGCGGCGG + Exonic
1038575641 8:28701612-28701634 CGCGCAGGCGGCGGCGGCGGCGG + Exonic
1038789787 8:30658138-30658160 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1039453885 8:37695810-37695832 GGCGGTGGCGGCGGCGGCGGAGG + Exonic
1043388252 8:79768308-79768330 CGCGCTGGCGGCGGCGGCGGCGG + Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043841283 8:85107292-85107314 TGCTATGGAGGCGGCGGCGGCGG + Exonic
1044115252 8:88327522-88327544 CGGGCTGGAGGCGGCGGCGGCGG - Intronic
1044115269 8:88327586-88327608 GGAGCTGGGGGCGGCGGCGGCGG - Intronic
1046183020 8:110677296-110677318 AGAGCTGGAGTGGGAGGCGGGGG + Intergenic
1046547208 8:115667931-115667953 TGCAGTGGCGGCGGCGGCGGCGG + Intronic
1046659965 8:116938477-116938499 CGTGCAGGAGGCGGCGGCGGCGG + Exonic
1046770367 8:118111689-118111711 CCGGCTGGAGGCGGCGGCGGCGG + Exonic
1047100155 8:121667522-121667544 TGCGCAGGAGCCCCCGGCGGGGG + Intergenic
1047203247 8:122783058-122783080 GGAGGTGGAGGCGGCGGCGGAGG + Intronic
1047418939 8:124690161-124690183 TGCGATGGTGGTGGCGGCGGCGG - Intronic
1048244142 8:132775398-132775420 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1049154120 8:141056559-141056581 TGAGCTGGAGCCAGCGGCGTAGG + Intergenic
1049585629 8:143431175-143431197 TCCGCTAGCGGCGGCGGCGGCGG + Intergenic
1049828615 8:144685818-144685840 TGGGCCGGCGGCGGCGGCGGAGG - Intergenic
1050744120 9:8857661-8857683 GGCGCGGGAGGCGGTGGCGGCGG - Intronic
1052048533 9:23821697-23821719 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1052495164 9:29214806-29214828 CTCGATGGAGACGGCGGCGGTGG - Intergenic
1053114610 9:35490122-35490144 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1054781938 9:69174014-69174036 GGGGCGGGAGGCGGCGGCGGCGG - Intronic
1055266311 9:74498818-74498840 GGCGGTGGCGGCGGCGGCGGCGG + Intronic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1057869709 9:98708682-98708704 GGCGGTGGCGGCGGCGGCGGCGG + Exonic
1057922018 9:99105250-99105272 CGTGCTGGCGGCGGCGGCGGCGG + Exonic
1058286611 9:103187217-103187239 TGCCCTGGAGCAGGGGGCGGAGG - Intergenic
1058687354 9:107490022-107490044 GGCAGTGGTGTCGGCGGCGGCGG + Intronic
1060468707 9:123930056-123930078 ACCCCTGGAGGCGGCGGCGGCGG - Exonic
1060849189 9:126860672-126860694 TGGCCTGGCGCCGGCGGCGGCGG + Intronic
1060998213 9:127886766-127886788 TGCGCTGGAGGCGGGGCCGCTGG + Exonic
1061084948 9:128393192-128393214 TGCGGTGGCGGTGGCGGCGGTGG + Intergenic
1061541079 9:131278037-131278059 TCCGCAGGCGGCGGCGGCGGCGG + Intergenic
1061737360 9:132670512-132670534 GGCGCTGGGGGTGGCGGCGGCGG + Exonic
1061818103 9:133208078-133208100 TGCACTGGGGTTGGCGGTGGGGG + Intronic
1062444504 9:136587969-136587991 TGCGGGGGAGGCGGGGGCGGGGG + Intergenic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062653540 9:137590464-137590486 GGCGGTGGCGGCGGCGGCGGCGG - Exonic
1062742328 9:138184071-138184093 TGCGGTGGGGTCGGGGGAGGGGG - Intergenic
1203470686 Un_GL000220v1:114210-114232 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1203478507 Un_GL000220v1:158182-158204 GGCGGTGGCGGCGGCGGCGGCGG + Intergenic
1186561742 X:10620252-10620274 TGCGCTGGCGGCGGAGGGGGCGG - Intronic
1187181402 X:16946745-16946767 GGCGGTGGTGGCGGCGGCGGCGG + Exonic
1189446418 X:41085365-41085387 AGCGGTGGCGGCGGCGGCGGCGG - Intergenic
1189821482 X:44873374-44873396 GGCGGTGAAGGCGGCGGCGGCGG - Intronic
1190285376 X:48957720-48957742 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1191612095 X:63127827-63127849 TGTGCTGGAGTTGGAGGCAGTGG + Intergenic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192211132 X:69128755-69128777 GGCGGTGGTGGCGGCGGCGGCGG + Intergenic
1192237611 X:69305975-69305997 CGCGCTGGAGCCGGCGGAGCCGG - Intergenic
1192924997 X:75747073-75747095 GGCGGTGGCGGCGGCGGCGGCGG - Intergenic
1195163733 X:102197025-102197047 TGAGCTGAAGCGGGCGGCGGGGG - Intergenic
1195803257 X:108735669-108735691 CGCGCTGGCGGCGGCAGCGGCGG - Exonic
1196684187 X:118496329-118496351 TGCGGAGGAGGCGGAGGCGGAGG + Intronic
1196707340 X:118727684-118727706 TGCGCCGGCGGCGGGGGCGGGGG + Exonic
1197446008 X:126552757-126552779 CGCGCGGGAGAGGGCGGCGGTGG + Exonic
1197782481 X:130171847-130171869 TGCGCTGGAGGAGGAGGAGGGGG + Exonic
1199445114 X:147912073-147912095 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1199772395 X:150983432-150983454 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1200100662 X:153688033-153688055 GGCGGTGGCGGCGGCGGCGGCGG - Intronic
1200100668 X:153688051-153688073 GGCGGTGGTGGCGGCGGCGGCGG - Intronic
1200229540 X:154437167-154437189 TGCGGTGGCGGCGGCGGCGGTGG + Exonic
1200231022 X:154443978-154444000 TCCACAGGAGCCGGCGGCGGGGG + Intergenic
1201017886 Y:9624035-9624057 AGCCCTGGAGTCGGAGGCCGAGG - Intergenic
1202109425 Y:21405507-21405529 AGCCCTGGAGTCGGAGGCCGAGG - Intergenic