ID: 1002637385

View in Genome Browser
Species Human (GRCh38)
Location 5:180615077-180615099
Sequence CACCGCACGGAGCAAGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002637379_1002637385 -7 Left 1002637379 5:180615061-180615083 CCTGGGAGTCAGGACCCACCGCA 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 66
1002637376_1002637385 6 Left 1002637376 5:180615048-180615070 CCATAGGGCAGGCCCTGGGAGTC 0: 1
1: 0
2: 0
3: 27
4: 240
Right 1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 66
1002637378_1002637385 -6 Left 1002637378 5:180615060-180615082 CCCTGGGAGTCAGGACCCACCGC 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002637385 Original CRISPR CACCGCACGGAGCAAGGCGC GGG Intronic
902849234 1:19140756-19140778 CACAGCAAGGAGCACGGCTCAGG - Intronic
914755219 1:150558464-150558486 CACCGCACGGAGCACTGAGGGGG - Exonic
1064622194 10:17228374-17228396 GACCGCACACAGCAAGGCGATGG + Exonic
1069352072 10:67539566-67539588 CACCGCAGCCAGCAAGGCACGGG + Exonic
1070997282 10:80796889-80796911 CACAGCAAGGTGGAAGGCGCTGG - Intergenic
1073294820 10:102432544-102432566 CACCGCGCGGGACAAGTCGCCGG - Exonic
1075088885 10:119431746-119431768 CACAGCAGGGAGCCAGGCACTGG - Intronic
1077332473 11:1989567-1989589 CACCGGACAGAGCACGGGGCAGG + Intergenic
1085474846 11:76783317-76783339 CGCCGCGCGGAGAAAAGCGCTGG + Intronic
1088687968 11:112300408-112300430 CATCCCACTGAGCAAGGCGTGGG - Intergenic
1091003912 11:131934752-131934774 CACCGCAGGGAGCAAGTGTCCGG + Intronic
1202815454 11_KI270721v1_random:44743-44765 CACCGGACAGAGCACGGGGCAGG + Intergenic
1105027840 12:132861385-132861407 CACAGCACGGAGCATGGCAGCGG + Intronic
1109858833 13:68171148-68171170 CTCCGCGCGGGGCAGGGCGCGGG + Intergenic
1112580470 13:100673586-100673608 CACTGCACGGAGGAGGGCGGTGG - Intronic
1115203221 14:30874996-30875018 CACCCAGCGGAGCAAGGGGCCGG - Intronic
1129149965 15:73682457-73682479 CACCGCAAGGCACAAGGCACAGG + Intergenic
1130685356 15:86032353-86032375 CACCACACGCAGCCAGGGGCAGG - Intergenic
1138549702 16:57740678-57740700 CTCCGCAGGGAGCAAAGCACAGG - Intronic
1139954464 16:70686480-70686502 CACCGCACACAGCAGGGCGCGGG + Intergenic
1143106947 17:4534753-4534775 CTCAGCACGGAGCCAGGCGGTGG + Intronic
1145962819 17:28897411-28897433 CACCGCGCGGCGCAGGGCGCTGG - Intronic
1152063626 17:78097709-78097731 CACGGCACTGAGCAAGGTGGTGG - Intronic
1154267355 18:12890777-12890799 CACCCCCAGGAGCAAGGTGCTGG - Intronic
1160381203 18:78457413-78457435 CACGGCATGGAGGAAGGAGCAGG - Intergenic
1160678187 19:401443-401465 CACCCCACGGGGGAAGGTGCGGG + Intergenic
1161405351 19:4088415-4088437 CACCGCAGGGATCCTGGCGCGGG + Intergenic
1161983514 19:7642438-7642460 CACCGGGCTGAGCGAGGCGCGGG + Exonic
1165420047 19:35718049-35718071 CCCCGCGCGGAGCCAGGCCCGGG - Exonic
928692496 2:33815279-33815301 CACCGGAAGGAGCAAGGGGAAGG + Intergenic
929715618 2:44306407-44306429 CACCAGACGGAGAAAGGCTCTGG - Intronic
932288221 2:70554093-70554115 GAGCGCACCGAGCAGGGCGCGGG + Intronic
933832067 2:86219057-86219079 CACATCACAGAGCAAGGCCCAGG + Intronic
934503995 2:94877944-94877966 CACCGCACAGGCCAAGGCACAGG + Intergenic
937095833 2:119234604-119234626 CCCAGCATGAAGCAAGGCGCCGG - Intronic
940494358 2:154406448-154406470 CACTGCAGTGAGCAAGGGGCAGG - Intronic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
1180013240 21:45065078-45065100 CACCGCACGGTGGAGGGTGCTGG + Intergenic
1180567664 22:16688820-16688842 CAACGCACTGAGCAAGGCCGTGG + Intergenic
1184421587 22:44385494-44385516 CACCGCACGGAGTAAAGCCAGGG - Intergenic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
950663411 3:14480934-14480956 CACCGAACAGGGCAAGGCTCAGG + Intronic
954781628 3:53066250-53066272 CACTGCCCAGAGCAAGGCCCAGG - Intronic
956160795 3:66350220-66350242 CACTGCAGGGAGTAAGGGGCTGG + Intronic
960691325 3:120349250-120349272 CACCGCACGGCGCGTGGCGCCGG + Exonic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
962383742 3:134916491-134916513 CTCTGCACGGGGCAAGGCTCGGG - Intronic
969453069 4:7285996-7286018 CAGGGCACGGAGCACGGTGCCGG - Intronic
972423562 4:38912147-38912169 CACCGCACCCAGCCAAGCGCAGG + Intronic
972714612 4:41633098-41633120 CACACCACGGAGCAGAGCGCAGG - Intronic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
990546573 5:56827573-56827595 CACGGCACCCAGCAAGGCCCAGG - Intronic
992769599 5:80035200-80035222 GGCCGCAGGGAGAAAGGCGCGGG - Intronic
1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG + Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1012261671 6:97094580-97094602 CACCGCACGTAACAAGGAGGAGG - Intronic
1016461831 6:144286185-144286207 CATCGCGCGGTGCAGGGCGCTGG + Intronic
1019644933 7:2124063-2124085 CACCTCCAGGAGCAAGGCGAAGG + Intronic
1029278855 7:99424222-99424244 CACCCCAGGGAGCAAGGAGGTGG - Intronic
1038554051 8:28494313-28494335 CACCCCTTGGAGCCAGGCGCCGG + Exonic
1039460045 8:37736448-37736470 GACCGCACCGACCAAGTCGCGGG + Exonic
1043750217 8:83925731-83925753 CACAGCACAGAGCCAGGCACTGG + Intergenic
1055584212 9:77740254-77740276 CACCTCACTGAGCAGGGCTCAGG - Intronic
1059236223 9:112762840-112762862 TACCCCACGGAGGAAGCCGCTGG + Intronic
1062504397 9:136865867-136865889 AACCGGACGGGGCAAGGGGCAGG - Intronic
1203745224 Un_GL000218v1:37639-37661 CACCGCACAGGCCAAGGCACAGG - Intergenic
1203564884 Un_KI270744v1:81845-81867 CACCGCACAGGCCAAGGCACAGG + Intergenic