ID: 1002639051

View in Genome Browser
Species Human (GRCh38)
Location 5:180621995-180622017
Sequence GGCCCCTCCAGGAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 0, 2: 8, 3: 57, 4: 842}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002639051_1002639068 26 Left 1002639051 5:180621995-180622017 CCTCCCTCTCTCCTGGAGGGGCC 0: 1
1: 0
2: 8
3: 57
4: 842
Right 1002639068 5:180622044-180622066 CACCAAAAGCCCAGGTCATCAGG 0: 1
1: 0
2: 0
3: 13
4: 155
1002639051_1002639062 18 Left 1002639051 5:180621995-180622017 CCTCCCTCTCTCCTGGAGGGGCC 0: 1
1: 0
2: 8
3: 57
4: 842
Right 1002639062 5:180622036-180622058 CCCCGCCCCACCAAAAGCCCAGG 0: 1
1: 0
2: 4
3: 157
4: 3460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002639051 Original CRISPR GGCCCCTCCAGGAGAGAGGG AGG (reversed) Intronic
900284223 1:1891409-1891431 GGCTCCTCCAGGGGCGGGGGTGG + Intergenic
900496506 1:2978387-2978409 GGCCCCACCAGAGGGGAGGGTGG + Intergenic
900595145 1:3477082-3477104 GGCCCATCCAGGAGGGAGGGTGG + Intronic
900644254 1:3701965-3701987 TGCCCATCCAGGAGAGGGGCAGG - Intronic
900690897 1:3979729-3979751 GGCCCTTCCAGGAGAGCTGGTGG - Intergenic
900878040 1:5359922-5359944 GGCTCAGCCAGGAGAGAAGGTGG - Intergenic
901054776 1:6444013-6444035 GGCCCCATCAGGAGACAGGCCGG + Intronic
902018780 1:13328733-13328755 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
902479583 1:16704588-16704610 GGCCCCATCAGGAGACAGGCCGG - Intergenic
902641567 1:17769635-17769657 GGGCCCTCCAGGAGAGACAGAGG + Intronic
902837935 1:19058671-19058693 AGCCAATGCAGGAGAGAGGGAGG - Intergenic
903081427 1:20815759-20815781 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
903426523 1:23257785-23257807 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
903637852 1:24833716-24833738 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
903884268 1:26531836-26531858 GGCACCTCCAGGAGTGGGGGAGG - Intronic
903921425 1:26803621-26803643 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
903993300 1:27289089-27289111 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
904043952 1:27599396-27599418 AGCCCCCCCAGGGGAGGGGGAGG - Intronic
904077497 1:27853274-27853296 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
904286081 1:29454014-29454036 GGCTCCTGCAGGTGTGAGGGTGG - Intergenic
904532185 1:31176843-31176865 GCCCCGTCCGGGAGAGAGGTGGG + Intergenic
904784715 1:32974900-32974922 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
905064690 1:35170456-35170478 GGCAGCTCCAGGTCAGAGGGAGG - Intergenic
905427531 1:37896754-37896776 GCCCCGTCCCGGAGGGAGGGAGG + Intronic
905427660 1:37897089-37897111 GCCCCGTCCAGGAGGGAGGTCGG + Intronic
905734796 1:40317435-40317457 CGCCCCTCGAGGACAGAGGGTGG - Intronic
906062559 1:42958248-42958270 GGCCCCTCCCGGTGCGGGGGAGG - Intronic
906066412 1:42984419-42984441 GGGTCAGCCAGGAGAGAGGGGGG + Intergenic
906102990 1:43274944-43274966 GGCACCTCCGGGTGAGAGAGAGG - Intergenic
906297515 1:44658293-44658315 GGCACCTCCTGGGTAGAGGGGGG - Intronic
906356945 1:45115283-45115305 GCCCCATCCAGGAGGGAGGTGGG - Intronic
906487363 1:46242289-46242311 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
906581811 1:46941230-46941252 GGCACATCCAGGAGGTAGGGAGG - Exonic
906601906 1:47137667-47137689 GGCACATCCAGGAGGTAGGGAGG + Exonic
906761769 1:48383188-48383210 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
907140667 1:52182107-52182129 CCCCCGTCCAGGAGAGAGGTGGG + Intronic
907857771 1:58320921-58320943 TGCTGCTCCAGGAGAGAGGGAGG - Intronic
908349348 1:63269112-63269134 AGCCACACCAGAAGAGAGGGTGG - Intergenic
908370273 1:63473453-63473475 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
908446210 1:64201402-64201424 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
908508302 1:64828037-64828059 GACCCTTCCAGGAGAAAGGCAGG - Intronic
909641058 1:77870099-77870121 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
910240222 1:85078521-85078543 GGAGCCTCCAGCAGAGTGGGAGG - Intronic
911351745 1:96762679-96762701 GCCCCATCCAGGAGGGAGGTGGG - Intronic
912751758 1:112293517-112293539 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
912825135 1:112898312-112898334 GCCCCGTCCAGGAGGGAGGTTGG - Intergenic
912928007 1:113930016-113930038 GGGCGCTCCAGGAGAGCCGGCGG - Intronic
913022752 1:114804461-114804483 GCCCCGTCCAGGAGGGAGGCGGG - Intergenic
913305789 1:117429442-117429464 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
913305968 1:117429816-117429838 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
913993826 1:143638010-143638032 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
914002299 1:143703271-143703293 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
914231014 1:145764736-145764758 GCCCCATCCAGGAGGGAGGTGGG + Intronic
914338625 1:146739348-146739370 GGCACCTCGGGGAGAGAGAGAGG + Intergenic
914788012 1:150851176-150851198 ACCCCGTCCAGGAGAGAGGCGGG + Intronic
914888091 1:151600607-151600629 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
914953876 1:152144731-152144753 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
915269425 1:154743133-154743155 GGCTGGTCCAGGTGAGAGGGTGG - Intronic
915334724 1:155134433-155134455 GCCCCCTCCAGGAGAGAGCCAGG + Exonic
915355923 1:155255188-155255210 GGCCGGTCCAGGAGTGAGGAGGG + Exonic
915411033 1:155701032-155701054 GCCCCCTCCGGGAGGGAGGTGGG + Intronic
915554258 1:156652678-156652700 GGTCCCTCGAGGAGAGAGCGAGG + Exonic
915737667 1:158094980-158095002 GTCCGCTCCAGGCCAGAGGGTGG - Exonic
916773421 1:167936076-167936098 GCCCCCGGCAGGAGAGAGGGAGG + Intronic
917375911 1:174349868-174349890 GCCCCATCCAGGAGGGAGGTGGG - Intronic
917860014 1:179135805-179135827 GCCCCGTCCGGGAGGGAGGGAGG + Intronic
917860067 1:179135937-179135959 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
917860118 1:179136065-179136087 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
918255034 1:182741192-182741214 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
919129763 1:193437618-193437640 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
919625221 1:199904480-199904502 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
920079572 1:203362469-203362491 GGACCCTCCTGAAGAGAGGCAGG + Intergenic
920284702 1:204871053-204871075 GGCTCCTTCAGGAGAGAGGTAGG + Intronic
920948346 1:210550552-210550574 TTCCCCTGCAGGAGAGAAGGGGG - Intronic
921140230 1:212298935-212298957 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
921142453 1:212320820-212320842 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
921238261 1:213152189-213152211 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
921565201 1:216709054-216709076 GGGGCCTGCAGGAGAGTGGGGGG + Intronic
922102520 1:222487938-222487960 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
922102657 1:222488245-222488267 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
922306506 1:224349851-224349873 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
922464803 1:225839439-225839461 GGACCCCCCAGGGGAGAGGAGGG + Intronic
922693057 1:227710767-227710789 GCCCCCTCCGGGAGGGAGGTGGG - Intergenic
922724058 1:227914438-227914460 GGCCTCCCCAGCAGGGAGGGAGG - Intergenic
922842084 1:228650772-228650794 GGCACCTCCAAGGTAGAGGGAGG - Intergenic
923126795 1:231040330-231040352 GGGGCCTCGAGGAGAGGGGGCGG - Intergenic
923268158 1:232332458-232332480 GCCCCGTCCAGGAGGGAGGTCGG + Intergenic
923711068 1:236387353-236387375 GCCCCCTCCGGGAGGGAGGTGGG + Intronic
923863470 1:237915745-237915767 AGGCCCTCCACGAGAGATGGAGG - Intergenic
923864008 1:237919507-237919529 AGGCCCTCCACGAGAGATGGAGG + Intergenic
924766070 1:247032554-247032576 GCCACCTCCAGGAGGGAGGTGGG + Intergenic
1062902722 10:1157961-1157983 GGCTCATCCAGGATGGAGGGTGG + Intergenic
1063744985 10:8869274-8869296 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1063944318 10:11162284-11162306 GGCAGCGCCAGGAGAGAGGTTGG + Intronic
1064070671 10:12226315-12226337 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1064108587 10:12519948-12519970 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1066085454 10:31970170-31970192 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1066212125 10:33250866-33250888 GGCCCCACCTGGCTAGAGGGAGG - Intronic
1066342651 10:34551248-34551270 AGCCCCTCCAGGAAGCAGGGTGG + Intronic
1066496194 10:35944656-35944678 GGCTACTACAGGGGAGAGGGAGG + Intergenic
1067053662 10:43039211-43039233 AGCCCCACCCGGAGAGAGTGGGG - Intergenic
1067119993 10:43465199-43465221 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1067168116 10:43881690-43881712 CCCTCCTCCTGGAGAGAGGGAGG - Intergenic
1067354531 10:45512376-45512398 GCCCCGTCCAGGAGGGAGGTCGG + Intronic
1067536575 10:47114864-47114886 GGAGCCTCCAGGAGGCAGGGAGG + Intergenic
1067711737 10:48655992-48656014 GGGGCCTCCAGCAGAGCGGGCGG + Intronic
1068473777 10:57499113-57499135 GGCCTATCTAGGATAGAGGGTGG + Intergenic
1068762887 10:60732992-60733014 AGCATCCCCAGGAGAGAGGGGGG - Intronic
1069157796 10:65052277-65052299 GCCCCATCCAGGAGAGAGGTGGG + Intergenic
1069365824 10:67692097-67692119 GCCCCCTCCGGGAGGGAGGTGGG + Intronic
1070138350 10:73715608-73715630 GCCCCTTCCAGGAGGGAGGTGGG - Intergenic
1070317869 10:75333113-75333135 GCCCCGTCCAGGAGGGAGGTTGG - Intergenic
1070332786 10:75430358-75430380 GGCGCGTCCAGCAGAGAAGGAGG + Intergenic
1070832802 10:79430629-79430651 GGCCCTGTCAGGAGAGAGGATGG + Intronic
1070966519 10:80534294-80534316 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1070966665 10:80534646-80534668 GCCCCGTCCAGGAGGGAGGCGGG + Intergenic
1070966715 10:80534773-80534795 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1071616645 10:87081175-87081197 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1072013328 10:91323175-91323197 GCCCCCTCCGGGAGGGAGGTGGG - Intergenic
1072180370 10:92975505-92975527 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1072602314 10:96941420-96941442 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1072648826 10:97276987-97277009 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1072684268 10:97528183-97528205 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1072684587 10:97528905-97528927 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1072716445 10:97755775-97755797 GGAGCCTCCAGGACAAAGGGGGG - Intronic
1072949792 10:99839196-99839218 GGCCCGTCCGGGAGGGAGGTGGG - Intronic
1072956572 10:99892151-99892173 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1072980570 10:100093901-100093923 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1073594342 10:104785087-104785109 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1073865623 10:107800889-107800911 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1074136078 10:110627336-110627358 GGACCCTCCCAGAGAGAGGCTGG + Intergenic
1075137116 10:119795088-119795110 GCCCCGTCCGGGAGGGAGGGAGG - Intronic
1075395873 10:122126668-122126690 GAACCATCCTGGAGAGAGGGAGG + Intronic
1075453108 10:122567219-122567241 GGTCCCTCCAGGAGAGTGCTCGG - Intronic
1075617905 10:123904877-123904899 GGGCCCTCCAGGTGGGTGGGTGG - Intronic
1075741163 10:124697428-124697450 GGCCCCTCCAGGTAAGAAGGCGG + Intronic
1076038423 10:127221457-127221479 GGCCTCTCCAGGTGAGAGGGTGG + Intronic
1076827424 10:132976113-132976135 GGCCTCTCCAGGAGCCAGTGTGG + Intergenic
1076830533 10:132992220-132992242 GGAGCCTCGAGGACAGAGGGTGG + Intergenic
1076912711 10:133399684-133399706 GTCCCCTCCAAGAAAGATGGTGG - Intronic
1077096949 11:803099-803121 GGCCCCTGCAGAAGACAGGCAGG + Intronic
1077192291 11:1260506-1260528 TGGCCCTCCAGGACCGAGGGTGG - Intronic
1077207047 11:1349706-1349728 GCCCTCGCCAGGAGAGAGTGAGG - Intergenic
1077315567 11:1918016-1918038 GGCCCCACCATGGGAGAGGATGG + Intergenic
1077538145 11:3134251-3134273 GGCCCCTGGAGGAGAGCAGGAGG - Intronic
1077564909 11:3291534-3291556 GGCCTCTCCAGGAAAGGGCGAGG + Intergenic
1077668792 11:4138081-4138103 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1078008694 11:7552755-7552777 GGGCATTCCAGGAGAGGGGGGGG - Intronic
1078164549 11:8871028-8871050 AGCCGCTCCTGCAGAGAGGGCGG + Intronic
1078573187 11:12476685-12476707 AGCCTCTCCAGGACAGAGGCTGG + Intronic
1079018369 11:16888244-16888266 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1079371913 11:19860001-19860023 GCCCCATCCGGGAGGGAGGGGGG - Intronic
1079444902 11:20548723-20548745 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1081627461 11:44663978-44664000 GCCCCCTCCAGGAGGGAGGTGGG + Intergenic
1081667157 11:44923323-44923345 TGCCCACCCAGCAGAGAGGGAGG + Intronic
1081700592 11:45150176-45150198 GGCCTCATCAGGAGAGGGGGTGG - Intronic
1081934970 11:46898109-46898131 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1081950130 11:47037984-47038006 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1082233707 11:49798345-49798367 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1082844486 11:57716220-57716242 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1082844773 11:57716849-57716871 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1083079165 11:60073154-60073176 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1083118948 11:60491810-60491832 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1083131002 11:60622875-60622897 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1083307860 11:61770228-61770250 GGGCTCTGCAGGAGAGATGGGGG - Exonic
1083382712 11:62279685-62279707 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1083645640 11:64171354-64171376 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1083739641 11:64701933-64701955 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1083741188 11:64712540-64712562 GGCCCCTGAAGGACAGTGGGTGG - Intronic
1083832099 11:65239557-65239579 GCCCCGTCCAGGAGGGAGGTCGG + Intergenic
1083938584 11:65883123-65883145 AGCCCCTTCAGGTGAGATGGGGG + Exonic
1084204423 11:67583718-67583740 GGACCCTCCAGAAGAGCGGCCGG + Exonic
1084264571 11:67998175-67998197 GACCCAGCCAGGAGAGTGGGTGG - Intronic
1084561722 11:69909364-69909386 CGCCCTTCCAGGAGGGAGGGAGG + Intergenic
1084624423 11:70295788-70295810 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1084696312 11:70757650-70757672 GTCCCCTCAAGGAGAGAGGGAGG + Intronic
1085111903 11:73896987-73897009 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1085116490 11:73936322-73936344 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1085270775 11:75268714-75268736 GACCCCACCAGGAGACAGTGAGG - Intronic
1085292486 11:75410174-75410196 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1085360070 11:75877920-75877942 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1086104527 11:83133537-83133559 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1086366131 11:86110877-86110899 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1086881729 11:92158266-92158288 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1088759771 11:112918455-112918477 GGCCCCTCCTGGGGAGAGGCAGG + Intergenic
1089098123 11:115936740-115936762 CTCCCCTCTAGGAGAGAAGGAGG + Intergenic
1089111664 11:116062323-116062345 GGCAGCTCCAGGAAGGAGGGAGG + Intergenic
1090203332 11:124871051-124871073 GGCAGCTCCTGGAGAGAGCGTGG + Exonic
1091027999 11:132159178-132159200 AGCCCCTCAAGGAGAGAGGGGGG - Intronic
1091405255 12:204694-204716 GGCTCCTGCAGAAGAGAGAGAGG + Exonic
1091553362 12:1553704-1553726 GGCTCATCCAGGAGAGATGTGGG - Intronic
1091727308 12:2855080-2855102 GCCCCATCCAGGAGGGAGGGGGG + Intronic
1091840009 12:3614006-3614028 GGCCCCCACAGGAAAGTGGGTGG - Intronic
1091845230 12:3650650-3650672 GGCCACCCCTGGAGAGAGGCAGG - Intronic
1092295963 12:7199934-7199956 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1092401947 12:8184581-8184603 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1092401997 12:8184708-8184730 GGCCCGTCCAGGAGGGAGGTGGG + Intronic
1092827587 12:12414118-12414140 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1092827786 12:12414568-12414590 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1092922742 12:13246863-13246885 GGCCCCTCCAGGAAGGAGCCTGG - Intergenic
1093453354 12:19340346-19340368 GCCCCGTCCAGGAGGGAGGCGGG + Intronic
1093730345 12:22559302-22559324 GGCCCTTCCAAGAGTGAGGCAGG - Intergenic
1094103377 12:26785409-26785431 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1094103430 12:26785535-26785557 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1095323414 12:40858248-40858270 GGCCCTTCCAGAAGAGAAAGGGG - Intronic
1095439607 12:42228001-42228023 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1095794253 12:46199786-46199808 GGCCCTTGCAGGAGACAGGAGGG - Intronic
1095867001 12:46983344-46983366 GGCTGATCCAGGTGAGAGGGTGG - Intergenic
1096039292 12:48500362-48500384 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1096082405 12:48842204-48842226 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1096167295 12:49436407-49436429 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
1096441238 12:51645311-51645333 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1096773368 12:53950210-53950232 GGCCCCACCAGGAGGCAGGTGGG - Intergenic
1097028492 12:56075794-56075816 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1097127805 12:56789090-56789112 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1097149163 12:56963782-56963804 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1097178242 12:57156026-57156048 GGGATCTCCAGGACAGAGGGAGG + Intronic
1097719243 12:63002499-63002521 GGAGCCTCCAGCAGAGAGGCCGG - Intergenic
1098370874 12:69759616-69759638 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1098412750 12:70202272-70202294 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1098884009 12:75942469-75942491 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1099255284 12:80307573-80307595 GCCCCGTCCAGGAGGGAGGTTGG - Intronic
1099255305 12:80307622-80307644 GTCCCATCCAGGAGGGAGGTGGG - Intronic
1099255405 12:80307880-80307902 GCCCCGTCCGGGAGGGAGGGAGG - Intronic
1100304575 12:93338589-93338611 GGCGCATCCAGGAGGGATGGGGG - Intergenic
1100570634 12:95841276-95841298 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1102089376 12:110173145-110173167 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1102174675 12:110867134-110867156 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
1102240136 12:111320179-111320201 GGCCGCTCCGGGGGCGAGGGGGG - Exonic
1102294014 12:111723427-111723449 GCCCCGTCCAGGAGGGAGGCGGG - Intronic
1102490947 12:113289146-113289168 AGCCACTCCAGGAGAGAAGTGGG - Intronic
1102559727 12:113753707-113753729 GGCACCAACAGGAGAGAGGGTGG - Intergenic
1103624130 12:122205738-122205760 GGGGCTTCCAGGAGGGAGGGAGG - Intronic
1103793170 12:123485858-123485880 GGCTCCTTCAGGATAGAGAGTGG - Intronic
1103982361 12:124744886-124744908 TGCTCCTCCAGGAGCCAGGGAGG + Intergenic
1104154416 12:126117386-126117408 GGCCCCTCCGGGACAGAAGATGG + Intergenic
1104766570 12:131333781-131333803 AGCCCATCCAGGGTAGAGGGAGG + Intergenic
1104852399 12:131883529-131883551 GGCACCCCCAGGAGTGAGGGTGG - Intergenic
1104937705 12:132375347-132375369 GGGCCCTCCACCAGGGAGGGAGG - Intergenic
1104957256 12:132472931-132472953 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1104957301 12:132473095-132473117 GTCCCCTCCTGGAGAGCGCGTGG + Intergenic
1104957338 12:132473215-132473237 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1104957532 12:132473864-132473886 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1104957590 12:132474068-132474090 GTCCCCTCCTGGAGAGGGCGTGG + Intergenic
1105280346 13:18959484-18959506 GGCCCACCCATGAGAGAGGCAGG + Intergenic
1105822226 13:24089895-24089917 GGCCCCTCCAGAGGACAGAGCGG - Intronic
1107493258 13:40900903-40900925 GCCCCATCCGGGAGGGAGGGGGG + Intergenic
1107493409 13:40901253-40901275 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1107588810 13:41881737-41881759 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1107968186 13:45615856-45615878 TTCCCCGCCAGGAGAGAGGCTGG - Intergenic
1108351497 13:49593355-49593377 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1108502099 13:51078268-51078290 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1108518316 13:51222699-51222721 GGCCCGCCCAGGAGAGAGCGGGG - Intronic
1108608762 13:52064333-52064355 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1112356577 13:98678790-98678812 TGCCCCTCCAGGTGAGATGCTGG + Intergenic
1112574027 13:100619177-100619199 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1113194019 13:107782902-107782924 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1113442943 13:110343491-110343513 CGTACCTCCAGGAGAAAGGGCGG + Intronic
1113786323 13:113003793-113003815 GGCCTCTGCAGGAGTGAGGAGGG - Intronic
1113804088 13:113103591-113103613 GGCTGCCACAGGAGAGAGGGAGG + Intergenic
1113916016 13:113874649-113874671 GGGCCCTCCAGGTGAGTGGTGGG + Intergenic
1113917414 13:113882865-113882887 CGCCCTTGCAGGAGAGACGGGGG - Intergenic
1113960599 13:114123709-114123731 GGCCCATCCTGGGGCGAGGGAGG + Intronic
1114055249 14:18962948-18962970 GCCCCCTCCAGGAGACCGGTTGG + Intergenic
1114107294 14:19438828-19438850 GCCCCCTCCAGGAGACCGGTTGG - Intergenic
1114165184 14:20212745-20212767 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1114165259 14:20212897-20212919 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1114165282 14:20212947-20212969 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1114165307 14:20212998-20213020 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1114427736 14:22637389-22637411 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1115493908 14:33984424-33984446 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1116191495 14:41673454-41673476 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1116191949 14:41674562-41674584 GCCCCGTCCTGGAGAGAGGTGGG - Intronic
1116191970 14:41674611-41674633 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1117277136 14:54203603-54203625 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1117336935 14:54763978-54764000 GGCACCTCCTGGAGACGGGGAGG - Intronic
1117648147 14:57874216-57874238 GGCTCCTCCAGGAAGGAGGATGG - Intronic
1117981971 14:61350620-61350642 GACCCCTCCATGGGGGAGGGGGG - Intronic
1118184202 14:63522839-63522861 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1118292650 14:64540545-64540567 GCCCCCGCCAGGAGACAGAGGGG - Intronic
1118341130 14:64895582-64895604 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1118517694 14:66545871-66545893 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1118796754 14:69151920-69151942 GGCCCGTCTGGGCGAGAGGGAGG + Intronic
1119594840 14:75924921-75924943 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1119643477 14:76331118-76331140 GGCAGCTTCAGGGGAGAGGGAGG - Intronic
1119710903 14:76821853-76821875 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1122209663 14:100166223-100166245 AGCCCATCCAGGAGAGTGGGGGG + Intergenic
1122546163 14:102524019-102524041 GTCCCCTCCAGGCCAGAGAGAGG - Intergenic
1122568303 14:102676864-102676886 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1122651883 14:103230844-103230866 GGCCCCTCCAGCAGGGATCGCGG - Intergenic
1122796776 14:104210059-104210081 GGACTCTCCTGGAGAGAGGCAGG + Intergenic
1202917633 14_GL000194v1_random:190834-190856 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1123469907 15:20541944-20541966 GCCCACTCCAGGAGAGGGGCGGG + Intergenic
1123648148 15:22458737-22458759 GCCCACTCCAGGAGAGGGGCGGG - Intergenic
1123730201 15:23136966-23136988 GCCCACTCCAGGAGAGGGGCGGG + Intergenic
1123748339 15:23334376-23334398 GCCCACTCCAGGAGAGGGGCGGG + Intergenic
1123763108 15:23447423-23447445 GCCCACTCCAGGAGAGGGGCGGG + Intergenic
1123880811 15:24676291-24676313 GTCTCCTCCAGGAGAGTGGCTGG - Exonic
1124280717 15:28358263-28358285 GCCCACTCCAGGAGAGGGGCGGG + Intergenic
1124301987 15:28553366-28553388 GCCCACTCCAGGAGAGGGGCGGG - Intergenic
1125016853 15:34946461-34946483 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1125016976 15:34946735-34946757 GCCCCGTCCGGGAGGGAGGGAGG + Intronic
1125479360 15:40069697-40069719 CACCACTCCAGGACAGAGGGAGG + Intergenic
1125651506 15:41321181-41321203 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1125768984 15:42152855-42152877 GCCCCATCCAGGATGGAGGGAGG + Intronic
1126066135 15:44827675-44827697 GGCCCCAGCAGGGGAGAGGGTGG + Intergenic
1126093701 15:45072889-45072911 GGCCCCAGCAGGGGAGAGGGTGG - Intronic
1126571616 15:50158417-50158439 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1127394976 15:58537343-58537365 GGCTCCCCCAGAAGAGAGGCTGG + Intronic
1127532173 15:59854057-59854079 GGCTCCTGCAGCAGAGAGGGAGG + Intergenic
1128597324 15:68964362-68964384 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1128597376 15:68964489-68964511 GCCCCGTCCGGGAGGGAGGGGGG - Intronic
1128738357 15:70066273-70066295 GGCCACCTCAGGAGGGAGGGAGG + Intronic
1128970506 15:72101621-72101643 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1129838140 15:78726883-78726905 GCCCACTCCAGGAGAGGGGAGGG - Intronic
1130133951 15:81166028-81166050 GGCCATTCCAGTAGAGAGAGGGG + Intronic
1131023390 15:89119061-89119083 GGCTTCACCAGGAGAGAGGGTGG - Intronic
1131067382 15:89442942-89442964 GGCCCTACCAGAAGAGAGGATGG + Intergenic
1131132324 15:89908242-89908264 GGGCCCTGAGGGAGAGAGGGAGG + Intronic
1131258740 15:90877633-90877655 GGGCCCTCCTGAAGACAGGGTGG - Intronic
1132668262 16:1091554-1091576 GGTCCCTCCAGGCAAGAGGCTGG - Intronic
1132776990 16:1599808-1599830 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1132870121 16:2112185-2112207 GGCCCCTACTGGGGTGAGGGAGG - Intronic
1133074753 16:3271483-3271505 GCCCCGTCCGGGAGAGAGGTGGG - Intronic
1133219171 16:4311570-4311592 GGCCCCTCTTGGAGGGAGGATGG - Intergenic
1133299730 16:4775041-4775063 GGCCCGTCCGGGAGGGAGGTGGG - Intergenic
1133306316 16:4811884-4811906 GGCCTCCCCTGGAGAGAGGTGGG - Intronic
1134471825 16:14532767-14532789 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1134522424 16:14924771-14924793 GGCCCCTACTGGGGTGAGGGAGG + Intronic
1134552372 16:15144084-15144106 GGCTCCTCCAGGAGAGGACGGGG - Intergenic
1134710094 16:16323422-16323444 GGCCCCTACTGGGGTGAGGGAGG + Intergenic
1134949509 16:18345223-18345245 GGCCCCTACTGGGGTGAGGGAGG - Intergenic
1135842823 16:25892272-25892294 GGCCCCTGCAGGAGTGAGGAGGG + Intronic
1136572200 16:31104609-31104631 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1137240778 16:46653341-46653363 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1137244031 16:46688654-46688676 GACCCCTCCAGGAGGGCGTGGGG + Intronic
1138043521 16:53698473-53698495 GCCCCGTCCAGGAGGGAGGTTGG + Intronic
1138203007 16:55104104-55104126 GGCCTCTCAAGGAGAGAGAAAGG - Intergenic
1138445696 16:57061712-57061734 GGCCCCTCCCGGAGGCAGCGGGG - Intronic
1139394826 16:66631241-66631263 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1139467026 16:67159593-67159615 GGGCCCTGCAGGAGAGAGGGTGG - Intronic
1139563615 16:67759135-67759157 GGGCCGTCCAGAACAGAGGGTGG - Intronic
1139639248 16:68278989-68279011 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1139864249 16:70051261-70051283 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1139864556 16:70051963-70051985 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1139885682 16:70205307-70205329 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1139995651 16:70978006-70978028 GGCACCTCGGGGAGAGAGAGAGG - Intronic
1140219975 16:73036629-73036651 GGGGCCGGCAGGAGAGAGGGAGG + Intronic
1141500508 16:84441068-84441090 GGCCCATCCAGGGGTGAGGCTGG + Intronic
1142260378 16:89040000-89040022 GGCCCCTCGGGGAGACAGGGTGG - Intergenic
1142620107 17:1160052-1160074 GGCCCTGCCTGGAGACAGGGAGG + Intronic
1142705153 17:1689647-1689669 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1142818630 17:2447557-2447579 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1142913118 17:3112523-3112545 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1143112216 17:4559053-4559075 GGCACCTGCAGGAGACAGAGGGG + Exonic
1143450158 17:7031604-7031626 GGCACCTCCTGGACACAGGGTGG + Intergenic
1144559752 17:16312093-16312115 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
1144695466 17:17301274-17301296 GGCCCTTCCAGGATTGAAGGTGG - Intergenic
1145263590 17:21368893-21368915 GGCTCCTCAAGGGCAGAGGGAGG - Intergenic
1145264663 17:21374032-21374054 AGCCCCTCCTGGAGGGAGGCTGG + Intergenic
1145684515 17:26639028-26639050 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1145920127 17:28604140-28604162 GCCCCTTCCAGGAGGGAGGTGGG - Intronic
1146216236 17:30980091-30980113 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1146444370 17:32922712-32922734 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1146566971 17:33921885-33921907 GGCTGCTTCAAGAGAGAGGGAGG - Intronic
1146617356 17:34367583-34367605 GGCCCCAGTAGGGGAGAGGGTGG - Intergenic
1146731262 17:35195157-35195179 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1147278448 17:39337801-39337823 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1147278469 17:39337848-39337870 GCCCCGTCCAGGAGGGAGGAGGG + Intronic
1147559679 17:41501176-41501198 GTTCCCTGCAGGAGAGAGGAGGG - Exonic
1147852245 17:43452098-43452120 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1148198702 17:45733456-45733478 GGCCCCTCCTGAACAGTGGGAGG - Intergenic
1149595134 17:57860869-57860891 GGCCCCTGCAGGAGTGCAGGAGG + Intergenic
1149625070 17:58074348-58074370 GCCCCCTCCAGGAGGGAGGTGGG - Intergenic
1149779055 17:59381942-59381964 GGCACGGCCTGGAGAGAGGGTGG - Intronic
1149865317 17:60148321-60148343 AGGCCCCCCAGGAGAGAGGGGGG - Intergenic
1150005013 17:61463910-61463932 TGGCCCACCAGGAGAGAGGCAGG + Intronic
1150291883 17:63987134-63987156 GGCTGCTGGAGGAGAGAGGGGGG - Intergenic
1151963765 17:77420678-77420700 GGCTGCTGCAGGGGAGAGGGTGG - Intronic
1152020170 17:77776599-77776621 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1152095720 17:78270488-78270510 GGCCTCTCCAGGAGTGGGGGTGG + Intergenic
1152129176 17:78465788-78465810 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1152226820 17:79096622-79096644 AGCCCCGCCGGGAGGGAGGGTGG - Intronic
1152276872 17:79363124-79363146 GGCTCCTGCAGGGGAGATGGAGG + Intronic
1152317729 17:79590619-79590641 GGCTCCTCCAGGAAAGGAGGCGG + Intergenic
1152610605 17:81313477-81313499 GGCCTCTGCAGGAGGGAGGTCGG - Exonic
1152696144 17:81797881-81797903 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1153605481 18:6827649-6827671 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1154265179 18:12874137-12874159 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1154278257 18:12980041-12980063 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1154289909 18:13098280-13098302 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1154348582 18:13564701-13564723 GGCCCCGCCAGGAGGAAGGGGGG - Intronic
1155507748 18:26548912-26548934 GGCCCGGGCGGGAGAGAGGGAGG + Exonic
1157188525 18:45560810-45560832 GACCCTTCCTGGAGAGAGGTGGG - Intronic
1157617208 18:48994117-48994139 GGCAGCTCCAGAAGAGATGGGGG - Intergenic
1157629433 18:49080598-49080620 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1157705305 18:49800249-49800271 GCCCCGTCCGGGAGGGAGGGAGG + Intronic
1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG + Intergenic
1158459245 18:57632842-57632864 GCCCCGTCCGGGAGAGAGGTGGG - Intergenic
1158696666 18:59709816-59709838 AGGCAGTCCAGGAGAGAGGGAGG + Intergenic
1159614869 18:70569650-70569672 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1160064760 18:75564364-75564386 GGAGCCCCCAGGAGAGAAGGGGG - Intergenic
1160583742 18:79901536-79901558 GGCCCCTCCGTGGGAGAGAGCGG - Intergenic
1160677610 19:399676-399698 GACCCCTGCAAGAGTGAGGGTGG - Intergenic
1160866440 19:1258286-1258308 GGCCCCTCCTGCAGCGAGGATGG + Exonic
1160943698 19:1631598-1631620 GGCCCCCCAGGGAAAGAGGGCGG + Intronic
1161012978 19:1969065-1969087 GGCCGCTCTGGGAAAGAGGGAGG - Intronic
1161170735 19:2811385-2811407 TGTCCTTCCAGGAGAGGGGGCGG + Intronic
1161704846 19:5814857-5814879 AGCCCCTCCAGGAAGGAAGGAGG + Intergenic
1161790286 19:6355729-6355751 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1162163956 19:8739723-8739745 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1162464661 19:10832546-10832568 GGCCCCTGCAGGAGAGGGGCCGG + Exonic
1162796278 19:13089223-13089245 GGCCACTTCTGGAGAGAGGTGGG + Intronic
1163143503 19:15365453-15365475 GGAGCCTCCAGGAGAGAGCCAGG - Intronic
1163542327 19:17918624-17918646 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG + Intronic
1163683424 19:18696775-18696797 GCCCCCTCCAGTAGGGAGGAGGG + Intronic
1164034739 19:21443580-21443602 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1164066561 19:21721444-21721466 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1164081527 19:21865386-21865408 GCCCCCTCCGGGAGGGAGGTGGG - Intergenic
1164168071 19:22700427-22700449 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1164301235 19:23964351-23964373 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1164595961 19:29530694-29530716 GGCACCTGCTGGAGAGCGGGAGG + Intronic
1164707570 19:30331825-30331847 GTCCCCTGCAGGGGACAGGGAGG - Intronic
1165102217 19:33445712-33445734 GGCACCTTCAGGCCAGAGGGTGG + Intronic
1165353846 19:35291963-35291985 GACCCCTCCAGGAAAGAGCTAGG + Intergenic
1165481818 19:36069035-36069057 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1165719250 19:38067383-38067405 AGTCCCCACAGGAGAGAGGGAGG - Intronic
1165749407 19:38251152-38251174 GGCCACAGGAGGAGAGAGGGAGG + Intronic
1165749967 19:38253517-38253539 GGCCCCTCAAGGTGGGTGGGTGG + Intronic
1166028161 19:40107820-40107842 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1166030123 19:40118797-40118819 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1166064339 19:40348357-40348379 GGCGCCGCCGGGAGGGAGGGCGG - Intronic
1166159050 19:40938072-40938094 GGCCCCAGCTGGAGGGAGGGTGG - Intergenic
1166163021 19:40966400-40966422 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1166377434 19:42335394-42335416 GGCTCCTCCAGGGCAGAGGAGGG - Intronic
1166417981 19:42610402-42610424 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1166531972 19:43548136-43548158 CGCCCCTCCAGGAGGGAGGTGGG + Intronic
1166702583 19:44890924-44890946 GCCTCCTCCAGGAGAGAGGCGGG + Intronic
1166809561 19:45507381-45507403 TGCGCCTCCAGGCGAGGGGGTGG - Intronic
1167715564 19:51140968-51140990 GGCTCCTTCAGGAGGGAGCGGGG + Intergenic
1167970907 19:53187433-53187455 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1168228765 19:55015278-55015300 GGACCCTCCAGGAAAGTGAGCGG - Intronic
1168290239 19:55354067-55354089 GAGGCCTCCAGGGGAGAGGGAGG - Exonic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
1168658424 19:58147624-58147646 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1168695964 19:58404875-58404897 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1202713620 1_KI270714v1_random:30494-30516 GGCCCCATCAGGAGACAGGCCGG - Intergenic
924970988 2:126986-127008 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
925159910 2:1676643-1676665 GGCCCTTCCCGGTGGGAGGGAGG - Intronic
925403559 2:3591265-3591287 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
925532870 2:4883891-4883913 GGGCACTCCAGGGGAAAGGGAGG + Intergenic
925650105 2:6080764-6080786 GGGTCCTCCTGGAGAGAGTGAGG + Intergenic
926639552 2:15220089-15220111 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
926675025 2:15612147-15612169 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
926683308 2:15680175-15680197 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
926932026 2:18050277-18050299 GCCCCTTCCTGGAGTGAGGGTGG - Intronic
926939481 2:18119625-18119647 AGCCCGTGCAGGACAGAGGGAGG - Intronic
927114254 2:19885920-19885942 GGCACCCCCAGGAGAGTGAGGGG - Intergenic
927757802 2:25723262-25723284 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
927776906 2:25910452-25910474 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
928003155 2:27540405-27540427 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
928272005 2:29864918-29864940 GTGCCCTTCAGGGGAGAGGGTGG - Intronic
929121922 2:38490472-38490494 GGCCCCTCCATGAGAGAATGAGG - Intergenic
929151883 2:38755892-38755914 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
929516038 2:42605722-42605744 GCCCCATCCAGGAGGGAGGTGGG - Intronic
929516087 2:42605849-42605871 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
929575240 2:43047511-43047533 TGCCCCTCCAGGAGGAAGTGAGG - Intergenic
929739666 2:44588581-44588603 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
929787928 2:45005367-45005389 GGCCTCGCCAAGAGAGAAGGAGG + Exonic
930000539 2:46858685-46858707 GGTCCCTCAAGGCTAGAGGGTGG - Intronic
930079326 2:47433615-47433637 CGCCCAGCCAGGAGAGAGGTGGG - Intronic
930201873 2:48556177-48556199 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
930617280 2:53606592-53606614 GGTACCTCCAGGGAAGAGGGTGG - Intronic
930665404 2:54095669-54095691 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
930821509 2:55651052-55651074 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
931173036 2:59824967-59824989 GTCTCCTCCAGGAGAGAGAGGGG - Intergenic
931668632 2:64627445-64627467 GCACCCTCCTGGAGAGAGGCTGG - Intergenic
932188148 2:69716041-69716063 GATCACTCCAGGAGAGAGTGAGG - Intronic
932593635 2:73081203-73081225 GGCCCCTGCAGGAGTGGGGCTGG - Intronic
932626399 2:73299701-73299723 TTCTCCTACAGGAGAGAGGGAGG + Intergenic
932807346 2:74795774-74795796 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
933734988 2:85487882-85487904 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
934309855 2:91852341-91852363 GCCCCGTCCGGGAGAGAGGTGGG + Intergenic
934569023 2:95357023-95357045 GGCCTCTGCAGGAGACAGTGTGG + Intronic
934699463 2:96428191-96428213 TGCCAGTCCAGGAGAGGGGGTGG - Intergenic
934704953 2:96470827-96470849 GGCCCCTGCAGGCGGGAGGCAGG + Intergenic
934753012 2:96806088-96806110 GCCCCCTCCGGGAGGGAGGTTGG - Intronic
935328987 2:101962498-101962520 GGCCCCTGCAGAAGACCGGGAGG - Intergenic
935629773 2:105203843-105203865 GGACTTTCTAGGAGAGAGGGAGG + Intergenic
935635072 2:105243749-105243771 GGGCTCTCCAGCAGACAGGGAGG - Intergenic
937871478 2:126789275-126789297 GTGGCCTACAGGAGAGAGGGTGG - Intergenic
937912512 2:127082332-127082354 GGCCCCTGCAGGGGAGACAGAGG + Intronic
938089115 2:128419310-128419332 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
938094749 2:128454174-128454196 GGCCCCTGCAAGAGAGGGGAGGG + Intergenic
938099626 2:128489827-128489849 GGTCCTGCCAGGAGAAAGGGAGG - Intergenic
938379814 2:130830215-130830237 GGAGGCCCCAGGAGAGAGGGCGG - Intergenic
938533858 2:132221300-132221322 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
938757211 2:134391853-134391875 GGCCTCTCCAGGAGGGAGGGTGG + Intronic
938891198 2:135707015-135707037 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
940013144 2:149075997-149076019 GGCCAATCTAGGAGAGAGGGAGG + Intronic
940309370 2:152261314-152261336 GGCTACTTCAGGGGAGAGGGTGG + Intergenic
941023855 2:160438898-160438920 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
941268563 2:163395842-163395864 GGCTCTTCCTGGAGGGAGGGAGG + Intergenic
941602889 2:167563369-167563391 GCCCCGTCCGGGAGGGAGGGAGG - Intergenic
941768801 2:169327163-169327185 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
941769129 2:169327913-169327935 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
941786771 2:169506109-169506131 GCCCCGTCCAGGAGGGAGGTGGG + Exonic
942012211 2:171774839-171774861 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
942096316 2:172538291-172538313 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
943323642 2:186473502-186473524 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
944255374 2:197618984-197619006 GCCCCATCCGGGAGGGAGGGAGG + Intronic
944532941 2:200683691-200683713 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
944598630 2:201283276-201283298 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
944598704 2:201283451-201283473 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
946318289 2:218931956-218931978 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
946751403 2:222896982-222897004 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
947543766 2:230996162-230996184 GGCCCCTCCAGGAGGGAGCCGGG + Exonic
947659076 2:231853304-231853326 GACAGCTCCAAGAGAGAGGGTGG - Intergenic
948706381 2:239795879-239795901 GCCCCATCCAGGAGGGAGGTGGG + Intronic
948979211 2:241484387-241484409 CGCCTCTGCAGGAGAGAGGTAGG - Intronic
1168818161 20:755032-755054 TGCCAGCCCAGGAGAGAGGGAGG + Intergenic
1168830975 20:845172-845194 GGCCCGTCCAGGAGTGCGGCTGG - Exonic
1168861122 20:1046661-1046683 GGCCCATACAGGAGACAGGAGGG + Intergenic
1169085785 20:2824170-2824192 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1169370980 20:5028008-5028030 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1170475239 20:16707844-16707866 GGCACCTGGAGGAGAGAGGCAGG - Intergenic
1170552329 20:17488726-17488748 GGACCCTTCAAGAGAGCGGGTGG - Intergenic
1170578531 20:17681701-17681723 GGCCCTGCCGGGAGGGAGGGAGG + Intronic
1171097745 20:22348019-22348041 GGCCTCTCCAGCAGAGAGGTAGG - Intergenic
1171861326 20:30405240-30405262 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1171861390 20:30405387-30405409 GCCCCCTCCAGGAGGGAGGTGGG + Intergenic
1171861584 20:30405862-30405884 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1172039117 20:32031395-32031417 GGCCCCGCCAGGTGTGATGGGGG - Exonic
1172279497 20:33699715-33699737 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1172279571 20:33699890-33699912 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1172337934 20:34132677-34132699 GGGCCCTCCGGGAGGGAGGTGGG + Intergenic
1172337953 20:34132723-34132745 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1172402111 20:34659183-34659205 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1172721024 20:37000397-37000419 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1172721170 20:37000750-37000772 GCCCCGTCCAGGAGGGAGGCGGG + Intronic
1172721222 20:37000877-37000899 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1172736034 20:37126509-37126531 GCCCCCTCCAGGAGGGAGGAGGG + Intronic
1172806973 20:37619048-37619070 GGCACCTCCAAGAGAGGGGAAGG - Intergenic
1172811396 20:37650616-37650638 AGCACCCCCAGGACAGAGGGAGG + Intergenic
1173060525 20:39655821-39655843 GGGGCCTCCAGGAGTCAGGGTGG + Intergenic
1173272994 20:41555067-41555089 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1173273071 20:41555243-41555265 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1173822565 20:46028909-46028931 GGCCCCGCCCGGAGAGTGGGTGG + Intronic
1174020465 20:47525572-47525594 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1174073987 20:47919140-47919162 AGCCTCTCAGGGAGAGAGGGAGG + Intergenic
1174249411 20:49207327-49207349 GGCTCCTCCAGGACAGAAGGGGG - Intergenic
1175131203 20:56790942-56790964 GGTCCCTGCAGGAGAGAGCAGGG + Intergenic
1175256668 20:57652141-57652163 GTCCCCTCCAGCAAGGAGGGCGG + Exonic
1175361352 20:58414232-58414254 GCCCCGTCCAGGAGGGAGGTTGG - Intronic
1175489803 20:59372173-59372195 GGCCCCTCCAGGGCAGAGCAGGG - Intergenic
1175529453 20:59664425-59664447 GGAGCCTCCAGGAGGGCGGGAGG - Intronic
1175720330 20:61281745-61281767 GTCCCCTCCAGGGGAGGAGGTGG - Intronic
1176091575 20:63320726-63320748 GGCCCAGACGGGAGAGAGGGAGG + Intronic
1176186400 20:63782313-63782335 GGCCCCGTCAGCAGAGAAGGAGG + Intronic
1178034437 21:28564145-28564167 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1178958534 21:37044032-37044054 GGAGCCTCCAGGACACAGGGAGG - Intergenic
1179615988 21:42583758-42583780 GGCCCCTCCTGGGGAGGTGGTGG + Intergenic
1179664230 21:42899071-42899093 GGCCCGTCAAGGACAGAGGCAGG - Intronic
1179893222 21:44348169-44348191 GGACACTCCAGGAAGGAGGGAGG - Intergenic
1180473731 22:15685500-15685522 GCCCCCTCCAGGAGACCGGTTGG + Intergenic
1181301440 22:21883751-21883773 GCCCCGTCCGGGAGGGAGGGAGG - Intergenic
1181444533 22:22958783-22958805 TGTCCTTCCAGCAGAGAGGGCGG - Intergenic
1181586183 22:23854790-23854812 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1181657752 22:24317094-24317116 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1181859672 22:25808563-25808585 GGCGCTCTCAGGAGAGAGGGTGG - Intronic
1182436568 22:30334606-30334628 TGGCCCTCAAGGAGAGAGGCGGG - Exonic
1183073147 22:35410314-35410336 GGCCCCTCAAGGAGGCTGGGGGG + Intronic
1183462624 22:37961392-37961414 GGCCAGTCCAGCAGAGTGGGGGG + Intronic
1183617807 22:38955694-38955716 GTCCCCACTAGCAGAGAGGGAGG - Intronic
1183871656 22:40745416-40745438 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1183995637 22:41631100-41631122 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1184202817 22:42981755-42981777 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1184240109 22:43207429-43207451 GGCCCCTGGAGGAGCAAGGGAGG - Intronic
1184408967 22:44315765-44315787 GGCCCCTCCAGGTCAAGGGGAGG + Intergenic
1184443637 22:44534510-44534532 GGAAACTCCAGGAGAGACGGTGG - Intergenic
1184597688 22:45524236-45524258 CGTGCCTCCAGGAGAGAGGGTGG - Intronic
1185150318 22:49160514-49160536 GGTCACACCTGGAGAGAGGGGGG - Intergenic
1185180547 22:49358307-49358329 GGACCCGCCAGGAAAGGGGGCGG + Intergenic
949569963 3:5283864-5283886 GCCCCGTCCAGGAGGGAGGCGGG - Intergenic
950496369 3:13336663-13336685 GGCCTCTCTAGGTGTGAGGGTGG + Intronic
950754712 3:15162848-15162870 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
950754765 3:15162975-15162997 GCCCCGTCCTGGAGAGAGGTGGG - Intergenic
950754810 3:15163073-15163095 GCCCCGTCCTGGAGAGAGGTTGG - Intergenic
950808333 3:15627573-15627595 GGCCTCTGCATGAGAGAAGGTGG + Intronic
950949022 3:16979976-16979998 GCCCCATCCAGGAGGGAGGTTGG - Intronic
953652732 3:44821264-44821286 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
954081126 3:48212435-48212457 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
954355994 3:50084416-50084438 GCCCCGTCCGGGAGGGAGGGAGG - Intronic
954396406 3:50295615-50295637 GAAACCTGCAGGAGAGAGGGGGG + Exonic
954481281 3:50803798-50803820 GCCCCTTCCAGGAGGGAGGTGGG - Intronic
954752538 3:52821716-52821738 GGCCCCTCCCTGAGGGAGGAGGG - Intronic
954878270 3:53817505-53817527 TGTCCCTCCAGGAGGCAGGGAGG + Exonic
958087692 3:88833050-88833072 GGGCCTTTGAGGAGAGAGGGTGG + Intergenic
958808317 3:98836880-98836902 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
959415681 3:106074807-106074829 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
959553183 3:107687475-107687497 GGCCCCTGCTGGAGATAAGGAGG + Intronic
959683879 3:109124438-109124460 GCCCCATCCAGGAGGGAGGTAGG + Intergenic
960780488 3:121313448-121313470 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
960862234 3:122165037-122165059 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
960924145 3:122780145-122780167 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
960924267 3:122780389-122780411 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
961036058 3:123642411-123642433 GACCCCTGCAGGAGAGAGACAGG + Intronic
961133095 3:124487101-124487123 GCCCCCTCGAGGAGAGAGTATGG + Intronic
961163656 3:124750028-124750050 GCCCCGTCCCGGAGGGAGGGGGG - Intergenic
961962524 3:130868354-130868376 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
962247288 3:133806142-133806164 CGCTGCTTCAGGAGAGAGGGTGG - Intronic
962572215 3:136723587-136723609 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
962788023 3:138785262-138785284 GCCCCCTCCAGGAGGTGGGGGGG + Intronic
963244420 3:143047006-143047028 GCCCCATCCAGGAGGGAGGTGGG - Intronic
963244620 3:143047456-143047478 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
963400477 3:144791150-144791172 TTCCCCTCCTGGAGCGAGGGAGG - Intergenic
965730112 3:171762647-171762669 GCCCGTTCCAGGAGAGAGGAAGG + Intronic
966769618 3:183492221-183492243 GGCCCCACCTGAGGAGAGGGAGG + Exonic
966783913 3:183608275-183608297 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
967176217 3:186864641-186864663 GCCCCGTCCGGGAGAGAGGCGGG + Intergenic
967177665 3:186874419-186874441 GCCCCATCCAGGAGGGAGGCGGG + Intergenic
968667284 4:1828565-1828587 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
968667496 4:1829048-1829070 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
968742331 4:2337543-2337565 GGCCCCTCCAAAACAGAGTGGGG + Intronic
969517378 4:7655092-7655114 GGCCCCAGCAGGAGAGAGGCAGG - Intronic
970472599 4:16393219-16393241 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
971371102 4:26019686-26019708 GGCTCCTCCAAGAGAGAGTTCGG - Intergenic
972288281 4:37668986-37669008 GCCCCATCCAGGAGAGAGGTGGG + Intronic
972304773 4:37820646-37820668 GCCCCGTCCGGGAGGGAGGGAGG + Intergenic
972412502 4:38807860-38807882 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
972412574 4:38808036-38808058 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
972551746 4:40141227-40141249 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
973109270 4:46377965-46377987 GCCCCATCCAGGAGGGAGGTGGG + Intronic
973593865 4:52465941-52465963 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
973673057 4:53238314-53238336 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
973785007 4:54325579-54325601 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
975042521 4:69762295-69762317 GCCCCATCCAGGAGGGAGGTGGG + Intronic
975042548 4:69762345-69762367 GCCCCATCCGGGAGGGAGGGGGG + Intronic
975063854 4:70037804-70037826 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
975685653 4:76917028-76917050 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
976149465 4:82077969-82077991 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
976265770 4:83185683-83185705 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
978519005 4:109597692-109597714 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
979622472 4:122812248-122812270 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
979622571 4:122812502-122812524 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
980313986 4:131172714-131172736 GGCCCATCCTGCAGAGAGGGAGG + Intergenic
980878929 4:138689787-138689809 GACCCCTGCAGGAGAGAGGCGGG + Intergenic
981523979 4:145693672-145693694 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
982040483 4:151391149-151391171 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
982192002 4:152866551-152866573 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
982192023 4:152866597-152866619 GCCCCGTCCAGGAGAGAGGTGGG - Intronic
982820657 4:159939224-159939246 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
983628799 4:169828584-169828606 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
984758214 4:183343000-183343022 CGGCCCTGCAGGAGGGAGGGAGG - Intergenic
985096439 4:186417047-186417069 GGCACCACCAGGACAGGGGGAGG + Intergenic
985600689 5:828370-828392 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
985600709 5:828415-828437 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
985736556 5:1586486-1586508 GCCCCATCCGGGAGGGAGGGGGG + Intergenic
986033761 5:3918324-3918346 GGTCCATCCAGGAGGGAGGCAGG - Intergenic
988544501 5:32142806-32142828 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
988629063 5:32909770-32909792 TGCCCCTCCAAGAGAGGGGGCGG - Intergenic
988863443 5:35308558-35308580 GGCTGCTGCAGGAGGGAGGGAGG - Intergenic
989021371 5:37013051-37013073 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
989075774 5:37563184-37563206 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
989075824 5:37563310-37563332 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
989137269 5:38167701-38167723 GGCTCCTCCTGGAGCCAGGGCGG + Intergenic
989211278 5:38861755-38861777 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
989587943 5:43088180-43088202 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
989828880 5:45890745-45890767 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
990458979 5:56014894-56014916 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
990498641 5:56372832-56372854 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
990501049 5:56397800-56397822 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
990680935 5:58243422-58243444 AGCCCCTCGATGAAAGAGGGAGG - Intergenic
991984436 5:72269345-72269367 GCCCCCTGCTGGAGAAAGGGAGG + Intronic
992373847 5:76171589-76171611 ACCCCGTCCAGGAGAGAGGTGGG + Intronic
992574479 5:78096820-78096842 GCCCCGTCCGGGAGGGAGGGGGG + Intronic
992978418 5:82140576-82140598 CGCCCCTCCGGGAGGGAGGTGGG + Intronic
995123481 5:108559013-108559035 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
995123584 5:108559267-108559289 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
995994508 5:118282847-118282869 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
996069991 5:119122321-119122343 GCCCCCTCCGGGAGGGAGGTGGG - Intronic
997622493 5:135307862-135307884 TGGCCCCCCAGGAGAGAGGAGGG - Intronic
997874692 5:137537633-137537655 GCCCCATCCAGGAGGGAGGTGGG - Intronic
997874795 5:137537891-137537913 GCCCCGTCCGGGAGGGAGGGAGG - Intronic
997930848 5:138070575-138070597 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
997981200 5:138468208-138468230 TTCCACTCCAGTAGAGAGGGAGG - Exonic
998008866 5:138676950-138676972 GGCCCCTCCTGGGCAGTGGGAGG + Intronic
998057342 5:139089453-139089475 GGAAGCTTCAGGAGAGAGGGTGG - Intronic
998128676 5:139640287-139640309 GTCCCCTCCAGGAAGGTGGGAGG + Intergenic
998239313 5:140427430-140427452 GCCCCGTCCGGGAGAGAGGTTGG - Intronic
999181004 5:149670320-149670342 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
999604065 5:153296709-153296731 GGCCCGTCCGGGAGGGAGGTTGG - Intergenic
999726768 5:154445002-154445024 GGCCCCTCCTGGAGGGGAGGTGG + Intergenic
1001286173 5:170425672-170425694 GGCACTTGCAGGAGGGAGGGTGG - Intronic
1001379363 5:171293450-171293472 GGCCCCTCTTGGAGAGAGGGAGG - Intronic
1001570661 5:172728499-172728521 TGACCCTGCAGGTGAGAGGGAGG + Intergenic
1001875402 5:175195758-175195780 GGACACTCCAGGGCAGAGGGCGG + Intergenic
1002501510 5:179650413-179650435 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1002535054 5:179871667-179871689 GGACCCTTCGGGAGAGAGCGAGG + Intronic
1002639051 5:180621995-180622017 GGCCCCTCCAGGAGAGAGGGAGG - Intronic
1002855644 6:1035695-1035717 GGGACCTCCAGGCGAGGGGGTGG + Intergenic
1003591525 6:7441010-7441032 GGCCCGTCCAGGAGTCGGGGAGG + Intergenic
1003942698 6:11044443-11044465 GGCCCCTGTGGGAGAGGGGGCGG - Intergenic
1005063467 6:21797254-21797276 GCCCCGTCCGGGAGAGAGGGAGG - Intergenic
1005069802 6:21852002-21852024 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1005158845 6:22836759-22836781 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1005606656 6:27484741-27484763 GCCCCCTCCGGGAGGGAGGTGGG - Intergenic
1005835340 6:29704580-29704602 GGCACCTCCAGGATTGTGGGAGG - Intergenic
1005837326 6:29718993-29719015 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1005841276 6:29745979-29746001 GGCCCCCTCAGGATATAGGGAGG + Intergenic
1005860352 6:29895849-29895871 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1005929858 6:30475338-30475360 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1005940559 6:30556594-30556616 GCCCCCTCCAGGTGAGTGGTAGG - Exonic
1006064590 6:31454515-31454537 GCCCCCTCCGGGAGGGAGGTGGG - Intergenic
1006149034 6:31976270-31976292 GCCCCCTCCAGGAGGGAGGTGGG - Intronic
1006209766 6:32384998-32385020 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1006293203 6:33156831-33156853 TGCCCATCCAGGAGATTGGGTGG + Intergenic
1006489956 6:34378780-34378802 TGCCCTTCTTGGAGAGAGGGAGG - Intronic
1006521382 6:34573120-34573142 TGCCTCTCCAGAAGAGAAGGAGG + Intergenic
1006579585 6:35069074-35069096 GGGCTCTCCAGGACAGAGTGGGG + Intronic
1006798315 6:36744522-36744544 TGCGCCTGGAGGAGAGAGGGAGG + Intronic
1006912252 6:37571027-37571049 GGCCCCTGGAGGCAAGAGGGCGG + Intergenic
1007342506 6:41200521-41200543 GGTCCCTTCAGGACAGAGGCAGG + Intronic
1008514407 6:52306283-52306305 GACCCCACCAGGAGAGGTGGAGG + Intergenic
1008926326 6:56894540-56894562 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1008926549 6:56895038-56895060 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1010239402 6:73601668-73601690 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1010513291 6:76744805-76744827 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1011000649 6:82584357-82584379 GGGGCCTGCAGCAGAGAGGGCGG + Intergenic
1011148593 6:84244718-84244740 GCCCCGTCCGGGAGGGAGGGGGG - Intergenic
1011291402 6:85781144-85781166 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1013530754 6:111017359-111017381 GCCCCGTCCAGGAGGGAGGCGGG - Intronic
1014764119 6:125389027-125389049 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1014800367 6:125771007-125771029 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1015070583 6:129088531-129088553 GCCCCGTCCAGGAGGGAGGTAGG - Intronic
1015869359 6:137760444-137760466 GGCCCAACCAGAAGAGAGGAGGG + Intergenic
1016588476 6:145716571-145716593 GGCCACTCCAGGATAGGGGTAGG - Intronic
1016688907 6:146912998-146913020 AGCACTTCCAGGAGACAGGGAGG - Intergenic
1018528141 6:164736229-164736251 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1018712022 6:166504154-166504176 GCCTCACCCAGGAGAGAGGGCGG + Intronic
1018955998 6:168410924-168410946 GGCCACTCCAGGAAAGGAGGTGG - Intergenic
1019058909 6:169242039-169242061 GGCCGCTCCGGGAGCCAGGGCGG - Intronic
1019278599 7:188775-188797 GGGCCCCCCAGGAATGAGGGGGG - Intergenic
1019295481 7:271924-271946 GGCCCCTGCAGGGGGGAGCGAGG + Intergenic
1019420372 7:947999-948021 GGCCCCTCCGGAAGAGGGAGTGG - Intronic
1019458988 7:1146815-1146837 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1019499964 7:1359927-1359949 GGGCCCACCAGGAGGGAGGTGGG + Intergenic
1019524894 7:1476488-1476510 GGCCCATCCGGGAGAGGCGGTGG - Intronic
1019524902 7:1476509-1476531 GGCCCATCCGGGAGAGGGGGTGG - Intronic
1019524912 7:1476530-1476552 GGCCCATCCGGGAGAGGGGGTGG - Intronic
1019526861 7:1484340-1484362 GGACTCTCCAGGGGGGAGGGAGG + Intronic
1019664769 7:2246328-2246350 GGGGCCTCCAGGAGAAAGGAAGG + Intronic
1019674483 7:2303037-2303059 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1019701636 7:2477129-2477151 GGGCCCTCAAGGAGGAAGGGAGG + Intergenic
1019890268 7:3940890-3940912 GGCCACTCCATGAGAGTGTGAGG - Intronic
1019922152 7:4169798-4169820 GGGCCCTCCCGCAGGGAGGGAGG - Intronic
1020831783 7:13102930-13102952 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1021440303 7:20668702-20668724 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1021672329 7:23046238-23046260 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1021735397 7:23636880-23636902 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1021735753 7:23637685-23637707 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1022083327 7:27044975-27044997 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1023728469 7:43167748-43167770 AGCCATTACAGGAGAGAGGGTGG - Intronic
1024538777 7:50459910-50459932 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1025000628 7:55312110-55312132 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1025795901 7:64738600-64738622 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1025821349 7:64967621-64967643 GCCCCATCCAGGAGGGAGGCGGG - Intergenic
1025828994 7:65033730-65033752 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1026868334 7:73836257-73836279 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1026929390 7:74215466-74215488 GTCACCTCCAGGAGCCAGGGTGG + Intronic
1026973361 7:74480979-74481001 AGCCCCTCCAGGGAAGAGGCAGG + Intronic
1027087518 7:75275084-75275106 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1029013293 7:97285633-97285655 GGACCTTCCAGGAGAGAGCCAGG - Intergenic
1029220189 7:98982661-98982683 GGGCCTTCCAGGTGAGAAGGTGG + Intronic
1029429757 7:100522932-100522954 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1029430045 7:100523583-100523605 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1030602795 7:111610159-111610181 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1032042732 7:128576648-128576670 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1032042756 7:128576698-128576720 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1032194739 7:129782193-129782215 GGCCCCTCCCGGAGTGGGGCTGG - Intergenic
1032291089 7:130591025-130591047 ACCCCCTCCAGGAGGGAGGTGGG + Intronic
1032569821 7:132985483-132985505 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1032569845 7:132985532-132985554 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1034234130 7:149554675-149554697 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1034234249 7:149554950-149554972 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1034638706 7:152586087-152586109 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1034961809 7:155367722-155367744 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1035300937 7:157896815-157896837 GGCCACTCCAGAAAAGAGGCAGG - Intronic
1035507716 8:149486-149508 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1036536663 8:9657610-9657632 GCCCCGTCCAGGAGGGAGGTAGG - Intronic
1037027675 8:14059192-14059214 GGCTTCTCCAGGACAGAGGCAGG + Intergenic
1037758641 8:21727538-21727560 GCCCCCCCCAGGAGACAGGCTGG + Intronic
1038324998 8:26566345-26566367 GGGCCCTGCAGGAGAAAGGAGGG + Intronic
1038595182 8:28881232-28881254 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1038885603 8:31659473-31659495 GGCTCCCCCAGGGGCGAGGGGGG + Intronic
1039469305 8:37803568-37803590 GGCCCCTGGAGGAGGGAGGAAGG - Intronic
1039488265 8:37928056-37928078 GCCCCCTCCGGGAGGGAGGTTGG + Intergenic
1040043364 8:42939355-42939377 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1040069864 8:43179943-43179965 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1040355804 8:46617392-46617414 GGCTCCTGCGGTAGAGAGGGCGG - Intergenic
1040785583 8:51159443-51159465 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1040785606 8:51159492-51159514 GCCCCATCCAGGAGGGAGGCGGG + Intergenic
1040808670 8:51424943-51424965 GGCCCCACCAGGTGAGAGGGCGG + Intronic
1040818767 8:51534556-51534578 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1040818788 8:51534602-51534624 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1041270354 8:56104428-56104450 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1041286898 8:56272016-56272038 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1041676756 8:60547535-60547557 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1041676883 8:60547839-60547861 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1042134044 8:65616982-65617004 GCCCCATCCAGGAGGGAGGCGGG + Intronic
1042290687 8:67167401-67167423 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1043985864 8:86694134-86694156 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1043985914 8:86694233-86694255 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1044190476 8:89310361-89310383 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1045120356 8:99028727-99028749 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1045298496 8:100892236-100892258 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1046636344 8:116678971-116678993 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1047213623 8:122859439-122859461 TTCCCCTCCAGGATTGAGGGAGG - Intronic
1047266717 8:123315107-123315129 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1047294561 8:123559510-123559532 ACCCCCTGCAGGAGACAGGGTGG + Intergenic
1047509011 8:125502014-125502036 GGCCCATTCAGGGGAGATGGTGG + Intergenic
1047687394 8:127316733-127316755 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1047687544 8:127317058-127317080 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1047847821 8:128825896-128825918 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1048368651 8:133758325-133758347 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1048368675 8:133758374-133758396 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1049325162 8:142017848-142017870 GGCCGCTCCAGGACAGGGGCCGG + Intergenic
1049333117 8:142065581-142065603 GGCCCCACCAGCAGCGGGGGCGG + Intergenic
1049435293 8:142583616-142583638 GGACCCTCTAGAAGAGAGGCTGG + Intergenic
1049573388 8:143379776-143379798 GGCACCACCTGGAGAGTGGGAGG + Intronic
1049747364 8:144268713-144268735 AGCCACGCCGGGAGAGAGGGTGG + Intronic
1049786477 8:144453246-144453268 TGCCTCTCCAGGAGGGAGCGGGG + Exonic
1051258158 9:15234386-15234408 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1051280994 9:15442254-15442276 GCCCCATCCAGGAGGGAGGTTGG - Intronic
1052492797 9:29189153-29189175 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1052860533 9:33435313-33435335 GGCCCCTAGAGGAGTCAGGGTGG + Intergenic
1052941940 9:34137694-34137716 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1053302090 9:36959552-36959574 AGCCCCACGAGGAGAGAGGCAGG + Intronic
1053407614 9:37891217-37891239 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1053457563 9:38242894-38242916 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1055137329 9:72841068-72841090 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1055138567 9:72851065-72851087 GCCCCGTCCGGGAGGGAGGGAGG - Intergenic
1055306521 9:74935045-74935067 CGCCCTTCCAGGAGAGGGGGTGG + Intergenic
1056152742 9:83804602-83804624 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1056166835 9:83948362-83948384 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1057154690 9:92830703-92830725 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1057304439 9:93904146-93904168 GGAGCCTCCAGGAGAGGGGCTGG - Intergenic
1057751615 9:97796902-97796924 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1057827722 9:98383540-98383562 GGTCCCTCCAGGAGAGGAGAGGG + Intronic
1058659494 9:107256658-107256680 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1058661652 9:107272443-107272465 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1059707755 9:116840515-116840537 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1059879844 9:118678021-118678043 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1060065431 9:120496765-120496787 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1060682432 9:125577543-125577565 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1060682481 9:125577642-125577664 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1060682543 9:125577788-125577810 GCCCCGTCCAGGAGGGAGGATGG + Intronic
1060797883 9:126524842-126524864 GCCCCGTCCAGAGGAGAGGGGGG - Intergenic
1061143174 9:128780506-128780528 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1061819806 9:133220814-133220836 GGCCCTTATAGGAGAGAGGCTGG + Intergenic
1061860890 9:133468322-133468344 GGGCTCTGCAGGAGAGAGGGTGG - Exonic
1062035695 9:134381619-134381641 GGCCCCTCTGGTACAGAGGGTGG + Intronic
1062084482 9:134641740-134641762 CTGCCTTCCAGGAGAGAGGGAGG + Intergenic
1062240850 9:135537134-135537156 GGCCCTTATAGGAGAGAGGCTGG - Intergenic
1062471559 9:136708027-136708049 GGCCCCAGCGGGAGAGAGAGTGG - Intergenic
1062547828 9:137071512-137071534 GGCCTGCCCAGGAGGGAGGGTGG - Intergenic
1203405763 Un_KI270539v1:784-806 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1203654587 Un_KI270752v1:10745-10767 GGCCCCTCCAGGAAAAATTGGGG - Intergenic
1185490962 X:516642-516664 GGACCCTCCAGGAGAGGAGGAGG - Intergenic
1186244818 X:7608688-7608710 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1186244866 X:7608815-7608837 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1186244968 X:7609069-7609091 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1186486105 X:9935609-9935631 GAACCCTACTGGAGAGAGGGAGG + Intronic
1186672513 X:11781653-11781675 GGCCAGTGCAGAAGAGAGGGAGG + Intergenic
1186774881 X:12854752-12854774 GCCCCCTCCAGGAGAGTGAAAGG + Intergenic
1186862753 X:13689415-13689437 GGCCGCCCCGGGAGAGAGGACGG + Intronic
1187183417 X:16964668-16964690 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1187568498 X:20476533-20476555 GGAAGCTCCAGGAGAGAGTGGGG + Intergenic
1188367915 X:29334334-29334356 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1188409214 X:29850563-29850585 GGCTCCAGCAGGGGAGAGGGTGG - Intronic
1189210237 X:39277744-39277766 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1189290455 X:39881466-39881488 GGCCCCTCCGGGAGATGGTGTGG + Intergenic
1189837747 X:45040731-45040753 GCCCCATCCAGGAGGGAGGTGGG - Intronic
1189838006 X:45041310-45041332 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1190171523 X:48115451-48115473 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1190500873 X:51077244-51077266 GTCACCTCAAGGAGTGAGGGTGG - Intergenic
1190779033 X:53578463-53578485 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1191637428 X:63393382-63393404 GCCCCCTCCAGGAGGGAGGTTGG + Intergenic
1192210420 X:69124184-69124206 TGCAGCACCAGGAGAGAGGGAGG - Intergenic
1192252197 X:69422293-69422315 GCCCCATCCAGGAGGGAGGTGGG + Intergenic
1192768645 X:74166809-74166831 GCCCCCTCCGGGAGGGAGGTGGG + Intergenic
1193132271 X:77931779-77931801 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1193132371 X:77932005-77932027 GCCCCGTCCAGGAGGGAGGTGGG - Intronic
1193164593 X:78265579-78265601 GCCCCGTCCAGGAGGGAGGTGGG - Intergenic
1193362353 X:80591553-80591575 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1194611501 X:96050974-96050996 GCCCCATCCGGGAGAGAGGTTGG - Intergenic
1195009971 X:100724226-100724248 GCCCCGTCCAGGAGGGAGGTGGG + Intronic
1196664262 X:118299774-118299796 GGCCCATTAAGGAGAGAGAGAGG + Intergenic
1197185946 X:123587855-123587877 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1197455776 X:126674245-126674267 GCCCCGTCCAGGAGGGAGGTGGG + Intergenic
1197897037 X:131327367-131327389 GCCCCGTCCGGGAGGGAGGGGGG + Intronic
1198189116 X:134285973-134285995 GCCCCATCCAGGAGGGAGGTGGG - Intergenic
1198246933 X:134839668-134839690 GCCCCATCCAGGAGGGAGGTGGG + Intronic
1199445040 X:147911804-147911826 GGCCACTTGAAGAGAGAGGGCGG + Intergenic
1199595407 X:149502974-149502996 GTACCCTGCAGGGGAGAGGGTGG + Intronic
1199598472 X:149526239-149526261 GTACCCTGCAGGGGAGAGGGTGG - Intronic
1200234018 X:154459641-154459663 GGCCCCTGCAGGGGACATGGTGG + Intronic