ID: 1002639736

View in Genome Browser
Species Human (GRCh38)
Location 5:180625081-180625103
Sequence GAGGGTAGCCCCACTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002639736_1002639738 -9 Left 1002639736 5:180625081-180625103 CCACAGCCAGTGGGGCTACCCTC 0: 1
1: 0
2: 2
3: 18
4: 155
Right 1002639738 5:180625095-180625117 GCTACCCTCATCTCCCATGTAGG No data
1002639736_1002639747 27 Left 1002639736 5:180625081-180625103 CCACAGCCAGTGGGGCTACCCTC 0: 1
1: 0
2: 2
3: 18
4: 155
Right 1002639747 5:180625131-180625153 TCCCGCCCCAGTTTGATACTAGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002639736 Original CRISPR GAGGGTAGCCCCACTGGCTG TGG (reversed) Intronic
900284429 1:1892171-1892193 GAGGGGAGGCCCAGTGGATGAGG - Intergenic
900780727 1:4615692-4615714 AACGCTGGCCCCACTGGCTGGGG + Intergenic
901255904 1:7826474-7826496 GAGGGTAGCATCCCTGGCTGAGG - Exonic
901311226 1:8270940-8270962 GGGGGAAGCCCCAGTGTCTGAGG + Intergenic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901331211 1:8410203-8410225 GAGGGGGGCCGCCCTGGCTGGGG + Intronic
901682271 1:10920145-10920167 GTGAATAGCCCCACTTGCTGTGG - Intergenic
904385435 1:30138915-30138937 GAGGGTTGCCACAGTGGCTGGGG + Intergenic
905017257 1:34786214-34786236 GATGGGAGCACCACTGCCTGAGG - Exonic
906793425 1:48678199-48678221 GAGGGCAGGTCCCCTGGCTGTGG - Intronic
908634874 1:66152410-66152432 CAGGGTGGCAGCACTGGCTGTGG + Intronic
913326973 1:117635885-117635907 GAGGATAGCCCTACTGCCTAGGG + Intergenic
914938877 1:152004415-152004437 GAAGGTAGACATACTGGCTGGGG + Intergenic
915194133 1:154176687-154176709 GAGGGTATCCTGACTGGGTGTGG + Intronic
918156238 1:181849520-181849542 CAGGGAAGCCCCACTCACTGAGG - Intergenic
918268796 1:182874606-182874628 GAGGATACCCCAACTGGCTCTGG + Intronic
919356019 1:196522955-196522977 GTGGGTTGCCACACTGGCTTGGG - Intronic
919858851 1:201725039-201725061 GAGGGTAGCTGCAGAGGCTGGGG - Intronic
920704968 1:208244129-208244151 GAGGTTTGCTCCGCTGGCTGCGG + Exonic
923766109 1:236893730-236893752 GAGGGTAGGCCCCAGGGCTGTGG + Intronic
924470545 1:244339272-244339294 GAGGGGAGGCCCACTTGCTGGGG + Intergenic
1063357030 10:5410843-5410865 GTGGGTTGCCCTGCTGGCTGGGG + Intergenic
1065895739 10:30161928-30161950 GAGAATAGCCCCATTGGCTGAGG + Intergenic
1065970683 10:30803847-30803869 GAGGGCAGCCCCTGAGGCTGTGG + Intergenic
1066332721 10:34442462-34442484 GAGGGGAGCCCCGGTGGCTCAGG + Intronic
1067728168 10:48789355-48789377 GAGGGTACCCCCAGAGGATGGGG + Intronic
1068866703 10:61902540-61902562 AGGGGTAGCGCCACTAGCTGGGG + Intronic
1069186369 10:65428793-65428815 GAGGGTTGCCACACTGGCTCAGG + Intergenic
1070598823 10:77851575-77851597 GAGGTCAGGCCCAGTGGCTGGGG - Intronic
1072037560 10:91577497-91577519 GAAGAAAGCCCCTCTGGCTGGGG + Intergenic
1072313917 10:94183491-94183513 GAGGGCAGCAGCACTGGGTGAGG - Intronic
1074306609 10:112284950-112284972 GAAGGTAGCTTCACTGGCTTTGG - Intronic
1076861630 10:133140630-133140652 GAGTGCAGCCCCACAGGCTGGGG - Intergenic
1077117709 11:892831-892853 CAGGGTAGCACCCCTGGCTAAGG - Intronic
1077429120 11:2507276-2507298 GAAGTTCACCCCACTGGCTGGGG + Intronic
1078762350 11:14261358-14261380 AAGGGCAGGCACACTGGCTGTGG + Intronic
1078983109 11:16561262-16561284 GAGGGTAGATCCACTGCCTCTGG + Intronic
1083167171 11:60897774-60897796 GAGGGAAGCCTCACTGGGTTAGG - Intronic
1084944767 11:72632677-72632699 GCAGGTAGCCCATCTGGCTGTGG - Intronic
1089292928 11:117449376-117449398 GAGGGGAAGCCCACTGACTGCGG - Intronic
1089787481 11:120918351-120918373 GAGGCAGGCACCACTGGCTGAGG - Intronic
1091327199 11:134700282-134700304 CAGGGGAGCTCCACTGTCTGTGG + Intergenic
1101587102 12:106094704-106094726 GTGGGTGGCCTCATTGGCTGTGG - Intronic
1101609131 12:106274488-106274510 GAGGGTAGGTGCACTGCCTGAGG - Intronic
1106050577 13:26186460-26186482 GTCGGTAGCGCGACTGGCTGCGG - Intronic
1118607042 14:67512183-67512205 GAGAGTTGTCACACTGGCTGTGG - Intronic
1119617848 14:76110635-76110657 GAAAGCAGACCCACTGGCTGCGG - Intergenic
1121283414 14:92715648-92715670 GTGCTTACCCCCACTGGCTGTGG - Intronic
1122540616 14:102495908-102495930 GAGGGAGGTCCCACTGCCTGAGG + Intronic
1125298001 15:38223350-38223372 GAAAGTGGCTCCACTGGCTGAGG - Intergenic
1125757119 15:42071583-42071605 GAGGGTGGGGCCGCTGGCTGGGG - Intronic
1126686786 15:51255328-51255350 GAGGGTAGCCCCAGTGCAGGTGG + Intronic
1128312584 15:66640583-66640605 GAGGGTACCCTCAAGGGCTGGGG - Intronic
1128363956 15:66983581-66983603 GATGGTAGGGCCACTGGATGAGG - Intergenic
1128635470 15:69299532-69299554 GAGGGGCGGCCCACTGCCTGCGG + Intronic
1128768581 15:70265753-70265775 GAGGGTTGCTCCACCTGCTGGGG + Intergenic
1132077698 15:98836143-98836165 GAGGATGACCCCACTGGCCGGGG + Intronic
1133403660 16:5506619-5506641 CAGGCCAGCCCCACTGCCTGGGG - Intergenic
1133689778 16:8202172-8202194 CAGGGTAAGCCCACTGGGTGTGG - Intergenic
1134044806 16:11093316-11093338 CACGGTAACCGCACTGGCTGAGG - Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1136367043 16:29813680-29813702 GGGGGGGGCCCCATTGGCTGGGG - Exonic
1138219765 16:55240644-55240666 GATGTTAGACCCTCTGGCTGAGG - Intergenic
1144813666 17:18018459-18018481 GAAGCCAGCCCCACAGGCTGGGG + Exonic
1145123848 17:20284261-20284283 CACAGCAGCCCCACTGGCTGAGG + Intronic
1146739118 17:35265795-35265817 AGGAGTAGCCCCACCGGCTGGGG + Exonic
1151469584 17:74309737-74309759 GAGCTGAGCCCCACTGGCTGGGG + Intronic
1151555240 17:74843255-74843277 GAGCCGAGCCCCACGGGCTGGGG - Exonic
1152743630 17:82029443-82029465 GAGAGGAGCCCCCCTGGCTGGGG + Intronic
1153986381 18:10354490-10354512 AGGGGTCGCCCCACTAGCTGTGG - Intergenic
1158157397 18:54441648-54441670 GAGGCTCTCCCCACTTGCTGAGG + Intergenic
1159997843 18:74983784-74983806 GAGAGAGGCCACACTGGCTGTGG + Intronic
1163813220 19:19447614-19447636 GTGGGTAGACCCACGGGCTGGGG + Intronic
1164641433 19:29828837-29828859 GAGGCTAGGCACAATGGCTGAGG + Intergenic
1164831387 19:31323950-31323972 GAGGGTAGCCCCACATGCAAAGG - Intronic
925761208 2:7186585-7186607 GAGGGCACCTCCACTGTCTGTGG + Intergenic
926599237 2:14824042-14824064 CAGGGTTGCCCCTCTGGCTCTGG - Intergenic
927101621 2:19791917-19791939 GCGTGTAGCCTCATTGGCTGTGG - Intergenic
929808531 2:45169432-45169454 GAGGGAAGCGCCACGGACTGGGG + Intergenic
935893255 2:107703911-107703933 GAGGGTCTCCACACTGGCTCAGG + Intergenic
936043005 2:109164061-109164083 AAGGTGAACCCCACTGGCTGTGG + Intronic
937316552 2:120935402-120935424 GAGGGTAGACCGACTAGATGTGG + Intronic
938220270 2:129560327-129560349 GAGGACCCCCCCACTGGCTGGGG - Intergenic
942016895 2:171826836-171826858 GAGAATAGCCCCATTGGCTGAGG - Exonic
946341306 2:219071132-219071154 TAGGGAAGCCCCACAGGGTGTGG - Intergenic
946654779 2:221934928-221934950 CAGGATAGCCCCACAGGATGAGG - Intergenic
948516839 2:238509502-238509524 GAGGGTGGCTCCACTGCCTCTGG - Intergenic
948597565 2:239090056-239090078 GGGGGCAGCCCGCCTGGCTGTGG - Exonic
1168998675 20:2150943-2150965 GAGGGAAGCTCCAGGGGCTGTGG + Intronic
1170995774 20:21356580-21356602 GGGGGTACCTCCACTGGCTGTGG - Exonic
1171171001 20:23015322-23015344 GAAGGTAGCCCCACTCCATGAGG - Intergenic
1172043543 20:32063022-32063044 GAGGTCAGCCCCAGAGGCTGTGG - Intronic
1173875241 20:46366383-46366405 CAGGGAAGCCCCACTGGCACAGG + Exonic
1173906502 20:46633563-46633585 GAGAGTTGCCCCAGAGGCTGGGG - Intronic
1174406197 20:50304871-50304893 GAGGAAAGCCCCACAGGCTTGGG - Intergenic
1174606239 20:51763778-51763800 GTGGGTGGCCACACTGGATGAGG - Intronic
1175739662 20:61411857-61411879 CAGGGCAGCCCCACTGCCTGTGG - Intronic
1175787824 20:61723266-61723288 AAGGGCAGCCTCACTGGGTGAGG + Intronic
1175865314 20:62172878-62172900 CAGGGTAGCTCTGCTGGCTGGGG - Intronic
1176119906 20:63449737-63449759 GAGGGAAGCCCCAGTGTCTGCGG + Intronic
1179224666 21:39443148-39443170 GAGGGAAGCCATACTGGCTGAGG + Intronic
1179717523 21:43297534-43297556 GTGGGTGCCCCCACTAGCTGGGG - Intergenic
1181313577 22:21958302-21958324 GAGGGTGGCACCACTGGCTGAGG + Intronic
1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG + Intergenic
1182618325 22:31603688-31603710 GAGGGTGCCCTCACTGGGTGGGG + Intronic
952581303 3:34836877-34836899 GAGGGTGGAGCCACTGCCTGGGG - Intergenic
954431352 3:50472486-50472508 GAGGGAAGCTCCTCTGCCTGGGG - Intronic
954631411 3:52049661-52049683 GAGTGGAGGCCCAGTGGCTGGGG - Exonic
956822613 3:72967563-72967585 GACGGTAGTTCCACTGGCAGGGG - Exonic
957236144 3:77594425-77594447 GAGAGTGGCTTCACTGGCTGTGG + Intronic
961358044 3:126351306-126351328 GAAGCTAGTCCCACTGGTTGGGG + Intronic
967203868 3:187101566-187101588 GAGGGTAACAGGACTGGCTGTGG + Intergenic
968234491 3:197023657-197023679 GAGCGTGGCCCGACTGGCTCAGG - Intronic
969866660 4:10080755-10080777 GCAGGTGGCCCCACTGTCTGGGG + Intronic
973850195 4:54954455-54954477 GAGGCTAGCATCACAGGCTGTGG + Intergenic
976260206 4:83138170-83138192 GAGGGTGGCCCCATAGGCAGGGG + Intergenic
978383191 4:108152421-108152443 GTGCCTTGCCCCACTGGCTGTGG - Intronic
991585403 5:68196645-68196667 GAGGGTAGCCCAGCTGGTTGAGG - Intronic
993746460 5:91603592-91603614 GATGGTACCCCCACAGACTGAGG + Intergenic
997213488 5:132092067-132092089 GAGGGTAGCCAGAATGGCTATGG - Intergenic
997425710 5:133801347-133801369 GATGGTGGTGCCACTGGCTGAGG - Intergenic
999736697 5:154518349-154518371 GATTGTGGCCCCATTGGCTGGGG + Intergenic
1002639736 5:180625081-180625103 GAGGGTAGCCCCACTGGCTGTGG - Intronic
1004763494 6:18697736-18697758 CAGGTTAAGCCCACTGGCTGAGG + Intergenic
1006154535 6:32007133-32007155 GCCGGTAGCATCACTGGCTGTGG - Intergenic
1006160846 6:32039869-32039891 GCCGGTAGCATCACTGGCTGTGG - Intronic
1006809300 6:36809779-36809801 GCTGGGAGCCCCACTGGCTGGGG - Intronic
1006929705 6:37680351-37680373 AAGGGTAGCCCTAGTGGCTGAGG - Intronic
1010945634 6:81970330-81970352 CAGGGAAGCCCCACCCGCTGAGG - Intergenic
1019292582 7:257835-257857 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292680 7:258161-258183 CAGGGTGGACCCACTGCCTGAGG + Intronic
1019292691 7:258197-258219 CAGGGTGGACCCACTGACTGGGG + Intronic
1019292712 7:258269-258291 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292735 7:258341-258363 CAGGGTGGACCCACTGCCTGAGG + Intronic
1020151504 7:5685207-5685229 GGAGGTAGCTCCCCTGGCTGTGG + Intronic
1023540895 7:41264778-41264800 GAGAGTTCCCACACTGGCTGTGG - Intergenic
1024333181 7:48177378-48177400 CAGGGCATCCTCACTGGCTGCGG + Intronic
1024558451 7:50623505-50623527 CAGAGTAGCCCCTCTCGCTGAGG - Intronic
1031506893 7:122596126-122596148 GAAGGGAGCCCCACCTGCTGTGG + Intronic
1032383619 7:131506774-131506796 GAGGGCAGCCCCACAGGCCTAGG - Intronic
1032819313 7:135510057-135510079 GATGGTGGCCCGTCTGGCTGTGG - Exonic
1034424772 7:151008811-151008833 GTTGGCAGCCCCAGTGGCTGAGG - Intronic
1035587715 8:788461-788483 CAGGGAAGCCCCAAAGGCTGAGG - Intergenic
1037976811 8:23219703-23219725 GAGGGGAGCAGCACCGGCTGGGG - Intronic
1040843052 8:51804880-51804902 AAGGCCAGCACCACTGGCTGGGG - Intronic
1043475655 8:80603076-80603098 GGGGGGAGCCCCATTTGCTGAGG - Intergenic
1047225809 8:122954695-122954717 GGGGGCAGCACCGCTGGCTGTGG + Intronic
1049213412 8:141396964-141396986 GAGGGTAGCCGGGCTGGCTGGGG + Intronic
1049233185 8:141494772-141494794 GGGGGTTGGCCCACTTGCTGTGG + Intergenic
1049694182 8:143975640-143975662 GAGGGTAAGGCCAGTGGCTGGGG - Intronic
1053486418 9:38460146-38460168 TGGGGTAGCCTCACTGGCAGTGG + Intergenic
1057302048 9:93892228-93892250 GAGGGGAGCCACACTAGCTAAGG - Intergenic
1058943432 9:109835131-109835153 GAGGGGACCCACACTGGCAGAGG + Intronic
1059255248 9:112924429-112924451 GTGAGTAGCCCCATTGTCTGGGG + Intergenic
1062064452 9:134518604-134518626 GAGGTGAGCCGCAGTGGCTGGGG - Intergenic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1188799897 X:34516226-34516248 GAGGGCAGCAACACTTGCTGGGG + Intergenic
1191628907 X:63299855-63299877 GAGGGGAGGGCCATTGGCTGGGG - Intergenic
1191717559 X:64204168-64204190 GAGGGGAGCCACACTGGGGGAGG + Intronic
1197819630 X:130530722-130530744 GAGGGTGGTCCCACTGGCCAGGG - Intergenic