ID: 1002640473

View in Genome Browser
Species Human (GRCh38)
Location 5:180628341-180628363
Sequence CGATCTGCAAGCGTGTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002640473_1002640482 16 Left 1002640473 5:180628341-180628363 CCGCAGCACACGCTTGCAGATCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1002640482 5:180628380-180628402 CCAGCAGCTTGTCGGCCTCCTGG 0: 1
1: 0
2: 2
3: 15
4: 173
1002640473_1002640480 8 Left 1002640473 5:180628341-180628363 CCGCAGCACACGCTTGCAGATCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1002640480 5:180628372-180628394 CGGGGACTCCAGCAGCTTGTCGG 0: 1
1: 0
2: 1
3: 13
4: 96
1002640473_1002640479 -10 Left 1002640473 5:180628341-180628363 CCGCAGCACACGCTTGCAGATCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1002640479 5:180628354-180628376 TTGCAGATCGGGGATCTGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002640473 Original CRISPR CGATCTGCAAGCGTGTGCTG CGG (reversed) Intronic
903072077 1:20731622-20731644 CGAGGTGCGTGCGTGTGCTGGGG + Intronic
909600483 1:77456481-77456503 CCATCTCCAAGCTTGGGCTGGGG + Intronic
912950700 1:114118462-114118484 GGATCTGCAAACTTCTGCTGTGG - Intronic
913474875 1:119227580-119227602 TGATCTGCAGGCATGTGCTTTGG + Intergenic
918066920 1:181107714-181107736 TGCTCTGCAAGTGTGTGCTCTGG + Intergenic
1065681543 10:28238935-28238957 TGTTCTGCATGCGTGTGTTGAGG + Intronic
1069123729 10:64603464-64603486 TGATCTGCAAGCTGGTCCTGTGG + Intergenic
1069881606 10:71597005-71597027 AAATCTGCCAGAGTGTGCTGGGG - Intronic
1070577815 10:77693054-77693076 GGATCTGCCAGCGTGGGCTGGGG - Intergenic
1074433092 10:113409942-113409964 CAATATGCAAGGGTTTGCTGGGG - Intergenic
1078857634 11:15219607-15219629 CTATCTCCAAGCATGTGTTGGGG + Intronic
1079582165 11:22079274-22079296 TGATCTGCAAGCATCTGTTGTGG + Intergenic
1084376645 11:68782688-68782710 CGATCTGGAAGGGTGGGCAGTGG - Intronic
1084540072 11:69780914-69780936 AGATCTGCACGCGTGTGCACAGG - Intergenic
1086700181 11:89892791-89892813 CGCTCTACAAGTCTGTGCTGGGG - Intergenic
1086705989 11:89951725-89951747 CGCTCTACAAGTCTGTGCTGGGG + Intergenic
1094493710 12:30976761-30976783 GCATCTGCAAGCATGTCCTGAGG + Intronic
1095404113 12:41849000-41849022 GGATCTGCAGGAGTGTGCAGTGG - Intergenic
1104430190 12:128709987-128710009 GAACCTGCAACCGTGTGCTGAGG - Intergenic
1108031733 13:46238571-46238593 CGATAAGCAAGCATGTGCAGGGG + Intronic
1109941561 13:69373956-69373978 CTAACTGCAAGCGTTTGCTTTGG - Intergenic
1118593475 14:67418913-67418935 CGCTCTGCAAGGCTTTGCTGGGG + Intergenic
1123903869 15:24903179-24903201 CAATCTGAAAGCATATGCTGGGG + Intronic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1135568369 16:23529501-23529523 TGATTGCCAAGCGTGTGCTGGGG - Exonic
1140476907 16:75243682-75243704 GGCTCTGCAAGGGTTTGCTGAGG - Intronic
1143202082 17:5120239-5120261 CTCTCTGCATGCCTGTGCTGTGG + Intronic
1147581477 17:41629595-41629617 CTTTCTGCATGCCTGTGCTGTGG - Intergenic
1157678683 18:49586898-49586920 TGATCTCCTAGCATGTGCTGGGG + Intronic
1160389063 18:78516742-78516764 CCATCTGCCATCGTGTGGTGAGG - Intergenic
1160401225 18:78612797-78612819 AGGTCTGAAAGCGTGTGCTTTGG + Intergenic
933714018 2:85347198-85347220 CCATCTGGAGGCGTGTGCTAAGG - Intronic
935411674 2:102770994-102771016 CGATCTGCAAGCCAGAGGTGGGG - Intronic
1168814830 20:729097-729119 CCACCTGCAAGCGTGGGCTGAGG + Intergenic
1170631518 20:18070556-18070578 CGAGCTGCCAGTGTCTGCTGGGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175793318 20:61756277-61756299 CGATCTGCATTTGTATGCTGGGG + Intronic
954646619 3:52135609-52135631 AGGTCTGCCAGCGTTTGCTGTGG - Intronic
955376193 3:58399247-58399269 GGATTTGCCAGCGTGTTCTGTGG + Intronic
968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG + Intergenic
970788972 4:19833864-19833886 CAATCAGCAAGAGTCTGCTGGGG - Intergenic
972112944 4:35588241-35588263 CTATCTGCAAACTTGTGCTATGG + Intergenic
981616987 4:146652678-146652700 TGTCCTGCAAGAGTGTGCTGGGG - Intergenic
982560440 4:156923121-156923143 TGATCTGCAAAGCTGTGCTGCGG + Intronic
988800686 5:34693722-34693744 CTGTTAGCAAGCGTGTGCTGCGG - Intronic
993058365 5:83009091-83009113 TGCTCTGAAAGCTTGTGCTGGGG - Intergenic
1002313782 5:178330346-178330368 CGATCTGCACCCGTGTGCAGAGG - Intronic
1002640473 5:180628341-180628363 CGATCTGCAAGCGTGTGCTGCGG - Intronic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1006438306 6:34038426-34038448 CTATGTGCCAGCCTGTGCTGAGG - Intronic
1022132609 7:27418100-27418122 CCATCAGTAAGTGTGTGCTGAGG + Intergenic
1033465587 7:141586497-141586519 CTATCTACGAGTGTGTGCTGTGG + Intronic
1049414593 8:142489396-142489418 CGATCTCCAAGGGTGTGCGCAGG - Exonic
1061622914 9:131823520-131823542 CCATCTGGAAGGGTGTGCTCGGG + Intergenic
1192142189 X:68655184-68655206 GGATCTGCAATAGTGTCCTGAGG - Intronic
1197922478 X:131609872-131609894 TGCTCTGCTAGCGTGTGCTTTGG + Intergenic