ID: 1002640789

View in Genome Browser
Species Human (GRCh38)
Location 5:180629695-180629717
Sequence CTGGGACTACCCAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002640789_1002640796 14 Left 1002640789 5:180629695-180629717 CCTGCTTCCCTGGGTAGTCCCAG 0: 1
1: 0
2: 0
3: 28
4: 380
Right 1002640796 5:180629732-180629754 TGAGTTAAACTCAGCCCACACGG 0: 1
1: 0
2: 0
3: 6
4: 129
1002640789_1002640797 25 Left 1002640789 5:180629695-180629717 CCTGCTTCCCTGGGTAGTCCCAG 0: 1
1: 0
2: 0
3: 28
4: 380
Right 1002640797 5:180629743-180629765 CAGCCCACACGGTGCAGTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002640789 Original CRISPR CTGGGACTACCCAGGGAAGC AGG (reversed) Exonic
900115982 1:1028107-1028129 ACGGGGCTTCCCAGGGAAGCCGG + Intronic
900543991 1:3218388-3218410 CTGGGGATACCTGGGGAAGCTGG - Intronic
900642916 1:3695834-3695856 CTGGGACGATCCAGGGAATGGGG + Intronic
900840000 1:5041124-5041146 CTGAGACTAAACAGGAAAGCCGG + Intergenic
901301068 1:8200473-8200495 CGGTGACGACCCAGGGAAGGAGG + Intergenic
901334045 1:8433465-8433487 CTGGGACTAGCCTGGGAAACAGG - Intronic
902279825 1:15366336-15366358 CTGCGACAGCACAGGGAAGCAGG - Intronic
902565482 1:17308463-17308485 CTGGCACTTCCCAGGGCTGCTGG - Intronic
902689093 1:18098566-18098588 CTGGGTATACCCAGGTAACCTGG + Intergenic
903033717 1:20481169-20481191 CTGGGAGTCCCCGGGTAAGCAGG + Intergenic
903670387 1:25031806-25031828 CTGGGAGTCCCCCGGGGAGCAGG - Intergenic
903942556 1:26941797-26941819 CCTTGACTCCCCAGGGAAGCAGG + Exonic
904050229 1:27634346-27634368 CGGGGACTTCCCCAGGAAGCGGG + Intronic
904484376 1:30815064-30815086 CTGGGACGAGCCAGAGAGGCAGG - Intergenic
905016208 1:34780641-34780663 CAGGGACTCCCAAGGGAGGCTGG + Intronic
905309601 1:37040150-37040172 TTGGAACAACCCAGGGATGCAGG + Intergenic
907528725 1:55071382-55071404 CTTGGACTCCCCTGGCAAGCAGG + Intronic
908598179 1:65710847-65710869 CTGGTAATACCCAGGCAAACAGG - Intergenic
908808909 1:67959173-67959195 CTGGGATTACCCAGGTGAGCTGG + Intergenic
909261196 1:73491454-73491476 CTGGTGATACCCAGGCAAGCAGG - Intergenic
909282115 1:73770028-73770050 CTGGTACTGCCCAGGGAAAGTGG + Intergenic
911982843 1:104587214-104587236 CTGGTAATACCCAGGCAAACAGG + Intergenic
912270933 1:108208746-108208768 CTGGGGATACCCAGGCAAACAGG - Intergenic
912515452 1:110213891-110213913 AGGGGACAAACCAGGGAAGCAGG + Intronic
912636262 1:111296410-111296432 CTGGTAATACCCAGGCAAACAGG + Intronic
915061272 1:153188006-153188028 CTGGTAATACCCAGGCAAACAGG - Intergenic
915651633 1:157316097-157316119 CTGGTAATACCCAGGCAAACAGG + Intergenic
915876612 1:159617211-159617233 CTGGTAATACCCAGGGAAACAGG + Intergenic
916982502 1:170154002-170154024 CTGAGGCTACACAGGGTAGCAGG - Intronic
917274728 1:173319695-173319717 CTGGTAATACCCAGGGAAACAGG + Intergenic
917563552 1:176186405-176186427 CTGGGACTAGCTAGAGTAGCTGG - Intronic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
918631980 1:186729897-186729919 CTGGTAATACCCAGGCAAACAGG - Intergenic
919532829 1:198746214-198746236 CTGACACTTCCCAGTGAAGCCGG + Intronic
920060453 1:203223539-203223561 CTGGGAGTACCCAGGAAGCCAGG - Exonic
920597734 1:207290078-207290100 CTGGGACCACCCAGGTAAATTGG + Intergenic
921215938 1:212936817-212936839 CTGGGCCAGCCCAGGGAACCAGG + Intergenic
921379066 1:214505290-214505312 AAGGGAACACCCAGGGAAGCAGG + Intronic
921738197 1:218653073-218653095 CTGGTAATACCCAGGCAAACAGG - Intergenic
922703711 1:227777788-227777810 CTGGGACATCCAAGGGAGGCTGG - Intronic
922902179 1:229145830-229145852 CTGAGACAAGCCAGGGAAGAAGG + Intergenic
923544674 1:234915352-234915374 TTGGGACCACCCAGGGGAGCAGG - Intergenic
924593782 1:245427836-245427858 CCAGGACTTCCCATGGAAGCAGG + Intronic
924834447 1:247635012-247635034 CTGGTAATACCCAGGCAAACAGG - Intergenic
1063159694 10:3410178-3410200 CAGGGACCCACCAGGGAAGCTGG - Intergenic
1063368136 10:5503900-5503922 CTAGGAGTACCCAGGAAAGGGGG - Intergenic
1063864231 10:10346574-10346596 CTGGAAATACCCAGAGAGGCTGG - Intergenic
1063968982 10:11368144-11368166 GTGGGACTCCCCAGGGAGGAAGG + Intergenic
1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG + Intronic
1065284066 10:24170301-24170323 GTGGGACTCCCAGGGGAAGCTGG + Intronic
1066083463 10:31955032-31955054 CTGAGACTGCACAGAGAAGCAGG - Intergenic
1066654131 10:37683362-37683384 CTGGGACAACATAGGGAAGCAGG + Intergenic
1068567695 10:58593579-58593601 CTGGTAATACCCAGGCAAACAGG + Intronic
1068623104 10:59208261-59208283 CTGGTAATACCCAGGCAAACAGG + Intronic
1068646271 10:59471191-59471213 CTGGTGATACCCAGGGAAACAGG + Intergenic
1068951666 10:62783145-62783167 CTGGTAATACCCAGGCAAACAGG + Intergenic
1069569123 10:69483902-69483924 CCGGGACTCCCCAGGAGAGCTGG + Intronic
1069606906 10:69744459-69744481 CTTGGATTCCCCAGGGAAGGAGG - Intergenic
1069942620 10:71965454-71965476 CAGGGACTTCCAAGGGAACCGGG + Intronic
1071564450 10:86664607-86664629 CTTGGACTAGCTAGGGAAGCTGG - Intronic
1071849019 10:89549866-89549888 CTAGGAAGACCCAGGGTAGCTGG + Intronic
1072314407 10:94188009-94188031 CTGTGAGTACCTAGGGAAGGGGG - Intronic
1072640413 10:97207218-97207240 CTGGGCCCACCCTGGGGAGCTGG - Intronic
1073203293 10:101753575-101753597 CTGGGATTACCCAGACAGGCTGG - Intergenic
1074016664 10:109541872-109541894 CTGGGGATACCCAGGAAAACAGG - Intergenic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1075344660 10:121673371-121673393 CTGGGCTTACCCAGGGAGGAGGG - Intergenic
1075446333 10:122516050-122516072 CGGGGACCACACAGGAAAGCAGG - Intergenic
1076498302 10:130914007-130914029 CTGGGCCTCCCCAGGGAGCCTGG - Intergenic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077713750 11:4560247-4560269 CTGGTAATACCCAGGCAAACAGG + Intergenic
1078681499 11:13480805-13480827 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1079036648 11:17025968-17025990 CTGGGTCTTCCCAGGGACCCAGG - Intergenic
1079117678 11:17650953-17650975 GTGGGACAACCCAGAAAAGCAGG - Intergenic
1079518022 11:21290682-21290704 CTGGTGATACCCAGGGAAACAGG + Intronic
1080057541 11:27922703-27922725 CTGGAACTACCAACAGAAGCTGG - Intergenic
1080118031 11:28642118-28642140 CTGGTGATACCCAGGCAAGCAGG + Intergenic
1080262513 11:30364840-30364862 CTGGGAATAGACAGGGAGGCTGG - Intergenic
1080860865 11:36149166-36149188 TTGGGAGTAGCCAGGGAAGATGG + Intronic
1081377581 11:42377672-42377694 CTGGGGATACCCAGGCAAACAGG + Intergenic
1083003608 11:59320784-59320806 CTGGTAATACCCAGGAAAACAGG - Intergenic
1083170176 11:60919512-60919534 CTGGGACTTCCAACTGAAGCTGG - Intronic
1083510313 11:63202995-63203017 CTGGTGATACCCAGGGAAACAGG + Intronic
1083619103 11:64040272-64040294 GGGGGACTTCCCAGGGAAGGGGG + Intronic
1083655035 11:64225498-64225520 CTGGGGCTTCCCATGGGAGCTGG - Exonic
1084150738 11:67286824-67286846 CTGCCACTTCCCAGGTAAGCAGG + Intergenic
1084316874 11:68350633-68350655 CTGGGCCTGCCCAGGGTAGTGGG + Intronic
1084536345 11:69759552-69759574 CTGGGACGGCCCAGGGCTGCAGG + Intergenic
1085319820 11:75567077-75567099 CTGTGACAACCCAGGGAGGCAGG + Intronic
1085395136 11:76203377-76203399 GTGGGACTGCCCAGGGAAGGGGG + Intronic
1087044095 11:93830038-93830060 CTAGGACGACCCAGGAAGGCAGG + Intronic
1088034528 11:105296037-105296059 CTGGGGATACCCAGGGAAAGGGG - Intergenic
1089200261 11:116720513-116720535 CTGGGACTGCGAAGGTAAGCAGG - Intergenic
1090402578 11:126458521-126458543 CTGGCACTAGGCAGGGAGGCAGG - Intronic
1090798971 11:130159297-130159319 CTGGGCCTCCCCAGGGTAGCCGG + Intergenic
1091822801 12:3489307-3489329 CTGTGACTAACCAGGGAGGAGGG - Intronic
1092197251 12:6556716-6556738 CTGGGAAAACCCAAGGATGCAGG + Intergenic
1092350804 12:7754197-7754219 CTGAGACCAACCAGGAAAGCTGG + Intergenic
1093017690 12:14171160-14171182 CAGTGACTGCCCAGGGAAGGGGG + Intergenic
1093191657 12:16081838-16081860 CTGGGCCCAGCTAGGGAAGCTGG + Intergenic
1095547269 12:43387291-43387313 CTGGTGATACCCAGGCAAGCAGG - Intronic
1097635106 12:62113286-62113308 CTGGTGATACCCAGGGAAACGGG - Intronic
1098120462 12:67231370-67231392 CTGGTAATACCCAGGCAAGCAGG - Intergenic
1098638430 12:72812845-72812867 CTGGGGATACCCAGGCAAACAGG - Intergenic
1099025542 12:77460122-77460144 CTGGGGATACCCAGGCAAACAGG + Intergenic
1099550945 12:84043058-84043080 CTGGGAATACCCAGGCAAATAGG - Intergenic
1099720616 12:86357189-86357211 CTGGTGCTACCCAGGCAAACAGG + Intronic
1100677524 12:96884256-96884278 CTGAGATTGCCCAGGGAAGAGGG - Intergenic
1101405576 12:104425864-104425886 ACAGAACTACCCAGGGAAGCTGG + Intergenic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1105578211 13:21672148-21672170 ATGGTACTATCCAGGGAACCAGG + Exonic
1107714429 13:43185695-43185717 CTGAGAATAACCAGAGAAGCAGG - Intergenic
1108302876 13:49097544-49097566 CTGGCACTTCCCAGGGGAACTGG - Intronic
1108593575 13:51932053-51932075 CCGGGACTATCCAGGCAAACTGG - Intergenic
1110357426 13:74584139-74584161 CTGGGAATACAGAGTGAAGCGGG + Intergenic
1111838518 13:93420360-93420382 ATGGGACTACCGTGGGAAGGAGG + Intronic
1113899591 13:113788821-113788843 CTGGGAAACCCCAGGGAAGCTGG + Intronic
1114433889 14:22686848-22686870 CTGGTGATACCCAGGGAAACAGG + Intergenic
1116490736 14:45499902-45499924 CTGGGACCTACCAGGGAAGATGG - Intergenic
1117170111 14:53085485-53085507 CTGGTAATACCCAGGCAAACAGG + Intronic
1117320880 14:54622349-54622371 CAGGGCCTATCTAGGGAAGCAGG + Intronic
1117448690 14:55829678-55829700 CTGGGACTAGCCAGGAAGGATGG - Intergenic
1117930449 14:60836540-60836562 CTGGGGATACCCAGGCAAACAGG - Intronic
1122008745 14:98728316-98728338 CTAAGACTCCCCAGGTAAGCTGG + Intergenic
1122124300 14:99570867-99570889 CTGGGACCACCCAGGCCAGTTGG - Intronic
1122623319 14:103071853-103071875 CTCGGGCGGCCCAGGGAAGCTGG - Intergenic
1122875537 14:104662655-104662677 CCGCGAAGACCCAGGGAAGCTGG - Intergenic
1123438540 15:20273130-20273152 ATGGGAAAACTCAGGGAAGCCGG - Intergenic
1124170745 15:27370512-27370534 CTGGGACCACCCTGGGATCCTGG + Intronic
1124666811 15:31599345-31599367 CTGGTAATACCCAGGCAAACAGG + Intronic
1124878875 15:33623048-33623070 CTGGGACTTCCCAACGAAGTGGG - Intronic
1127193795 15:56562250-56562272 CTGGGGATACCCAGGCAAACAGG + Intergenic
1129016021 15:72469648-72469670 CTGGGAAGTCCCAGGCAAGCTGG - Intergenic
1129668657 15:77594247-77594269 CTTGTAATTCCCAGGGAAGCAGG - Intergenic
1130069817 15:80636927-80636949 CTGGGAGTGCCAAGAGAAGCTGG - Intergenic
1131435759 15:92420225-92420247 CAGGGACTACCAACTGAAGCAGG - Intronic
1132287869 15:100678868-100678890 CTGGTGATACCCAGGGAAACAGG - Intergenic
1132618141 16:852413-852435 CTGTGACTTCCCAGGGGACCTGG - Intergenic
1134015206 16:10883323-10883345 CTGGGACAGACCAGGCAAGCGGG + Intronic
1134445868 16:14331122-14331144 CTGGGACAAGCCTGGGTAGCAGG + Intergenic
1137335642 16:47546389-47546411 CTGGTGATACCCAGGGAAACAGG - Intronic
1137575619 16:49598074-49598096 CAGATACTACCCAGGGAAGGAGG - Intronic
1137728553 16:50673377-50673399 CTGGGACCCCGCAGGGACGCTGG - Exonic
1138443252 16:57047481-57047503 CTGGGGCTAGCCAGGGACCCTGG + Intronic
1139948890 16:70659801-70659823 CTGGGCCCACCCAGGCCAGCTGG + Intronic
1140415456 16:74770999-74771021 GTGGGACCATCCAGGGCAGCTGG + Intronic
1140647903 16:77052904-77052926 CTGGGACTACACATGTCAGCTGG - Intergenic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1141784767 16:86191741-86191763 CTGGAACCACACAGGGTAGCCGG - Intergenic
1142155075 16:88529248-88529270 CTGGGGCTTCCCAGGGGAACAGG + Intronic
1142293231 16:89202025-89202047 CGGGGACCACCCCGGGACGCCGG - Intergenic
1144453050 17:15397171-15397193 CTTTGACTTACCAGGGAAGCTGG - Intergenic
1146057075 17:29586842-29586864 CTTGGACTCCCCAGGCAGGCAGG + Intronic
1146746233 17:35333221-35333243 CTGGTGATACCCAGGGAAACAGG - Intergenic
1147949557 17:44099413-44099435 CTGGGACTTCCCATGGAGGCAGG - Intronic
1148366121 17:47057309-47057331 ATGGGACTGCCCCGTGAAGCAGG + Intergenic
1148456613 17:47814646-47814668 CTGGGCCTCCCCCGGGCAGCTGG + Intronic
1148563198 17:48618061-48618083 CAGGGGCTCCCCAGGGCAGCAGG - Intronic
1149365548 17:55939816-55939838 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1149589273 17:57816534-57816556 CTGGTTCTACCCATGGAAGCTGG + Intergenic
1151313899 17:73310689-73310711 CTGGGAAAACACAGGGAACCTGG + Intronic
1152250928 17:79212235-79212257 CTGGAAGAACCCAGGGCAGCGGG - Intronic
1152256445 17:79242761-79242783 CTGGGCCTCCACAGGGCAGCAGG + Intronic
1152276957 17:79363569-79363591 CGGAGACCCCCCAGGGAAGCTGG - Intronic
1152283061 17:79396676-79396698 GTGGGCCTACCCAGGCCAGCTGG - Intronic
1152643127 17:81457454-81457476 GAGGCACCACCCAGGGAAGCAGG + Exonic
1152790882 17:82278918-82278940 CAGGGACTTCCCAGGGAGCCAGG + Intergenic
1152898759 17:82928276-82928298 CCGGCCCTACCCCGGGAAGCTGG - Intronic
1156495085 18:37520247-37520269 CTGGGCCTGGCCAGGGGAGCAGG + Intronic
1160807995 19:1000955-1000977 CCGGGACTACGCAGGGAAGGGGG + Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1163497867 19:17657084-17657106 CTGTGGCTTCCAAGGGAAGCAGG - Intronic
1163790220 19:19302060-19302082 CAGAGACTACCCAGGGGTGCTGG + Intronic
1165141443 19:33702623-33702645 CTGGGGCTACCTGGGGACGCAGG - Intronic
1165243992 19:34487480-34487502 CAGGGGGTACCCAGGAAAGCAGG + Intronic
1166033846 19:40153089-40153111 CAGTGGCTACCCAGGGGAGCAGG + Intergenic
1166709934 19:44930354-44930376 CTGGGCATACGCAGGGAGGCTGG + Intergenic
1167300270 19:48673858-48673880 CTGGGGCCACCCAGGGCAGCAGG - Intergenic
1167328074 19:48837204-48837226 CTGGGACCACTCAGGGCATCAGG - Exonic
1167613254 19:50517445-50517467 CTGGGACCACGCAGGGAATTGGG - Exonic
925274670 2:2640324-2640346 CTGTGGCTCCCCTGGGAAGCAGG + Intergenic
925673093 2:6332804-6332826 CTGGTGATACCCAGGGAAACAGG - Intergenic
926128400 2:10285772-10285794 CTGGGCGGACCCAGGGAGGCTGG - Intergenic
926508680 2:13745996-13746018 CTGGTAATACCCAGGCAAACAGG + Intergenic
926970556 2:18463517-18463539 CTGGTAATACCCAGGCAAACAGG - Intergenic
927221290 2:20712223-20712245 CTGGTGATACCCAGGCAAGCAGG + Intronic
928467853 2:31539646-31539668 CTGATACTACCCAGGCCAGCAGG - Intronic
928864898 2:35906165-35906187 CTGGTGATACCCAGGCAAGCAGG - Intergenic
929436006 2:41928925-41928947 CTGGCACTACCCTGGGATGCCGG - Intergenic
930952193 2:57156301-57156323 CTGGGCTTGCCCAGGGCAGCGGG + Intergenic
931558548 2:63531553-63531575 CTGGTGCTACCCAGGTAAACAGG + Intronic
933555596 2:83826688-83826710 CTGGGAGTGCCCAGGGCATCAGG - Intergenic
933760099 2:85666977-85666999 CTGGGACTTCCCAGGCACCCAGG + Intronic
935229591 2:101084184-101084206 AGGGGAGGACCCAGGGAAGCTGG + Intronic
935382286 2:102465001-102465023 CTGGAACTACTCAGGTAAGAGGG - Intergenic
936857924 2:116982373-116982395 CTGGTGATACCCAGGGAAACAGG + Intergenic
937362500 2:121238814-121238836 CAAGGAGTCCCCAGGGAAGCGGG - Intronic
937473082 2:122190323-122190345 TTGGGAATAGCCAGGGAACCAGG + Intergenic
937694054 2:124788128-124788150 CTGGGAGAACCCAGGGGAGGTGG - Intronic
937970719 2:127546745-127546767 ATGGACCTACCCAGGAAAGCAGG - Intronic
938144829 2:128824528-128824550 CTGGTAATACCCAGGCAAACAGG + Intergenic
944311066 2:198234719-198234741 CTGGTATTACCCAGTAAAGCAGG - Intronic
944374835 2:199029300-199029322 CTGGTAATACCCAGGCAAACAGG + Intergenic
944992438 2:205253492-205253514 CTGGAAGTACCTGGGGAAGCAGG + Intronic
947502486 2:230681594-230681616 CTAGGATTACCCAGTGAAGATGG + Intergenic
947600745 2:231448294-231448316 CTGGAGCAACCCAGGGAAGATGG - Intergenic
947847920 2:233260516-233260538 CTGGGCCTTGCCAGGAAAGCAGG + Intronic
948419596 2:237848729-237848751 CTGGTAATACCCAGGCAAACAGG - Intergenic
948714705 2:239853417-239853439 CAGGGACTACCCAGGGACTTTGG + Intergenic
1168815936 20:737062-737084 CTTGGAGGAGCCAGGGAAGCAGG + Intergenic
1169065959 20:2694131-2694153 CTGGGACTGCCCAGGAAGGAGGG - Intronic
1169646301 20:7813808-7813830 CTGGTAATACCCAGGCAAACAGG - Intergenic
1171021049 20:21584426-21584448 GTGGGGCTCCCCAGGGAAGATGG - Intergenic
1171147488 20:22798132-22798154 CTGGGTTAACCCTGGGAAGCAGG - Intergenic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1173575938 20:44113046-44113068 CTGAGGCCTCCCAGGGAAGCTGG - Exonic
1174438310 20:50527817-50527839 CTAGGACTAGCTAGAGAAGCAGG - Intronic
1174492787 20:50913763-50913785 CTTGGCCTACAGAGGGAAGCTGG + Intronic
1174565723 20:51463206-51463228 CTGGGTCTTCCCTGGGAAGTGGG + Intronic
1175449346 20:59049565-59049587 CTAGGACTACACAGGGAGGTCGG + Intergenic
1175599779 20:60263796-60263818 CTGGTACTACCCAGAGAAGGAGG - Intergenic
1176022125 20:62967253-62967275 CTGGCACTACCTTGGGAACCAGG + Intronic
1176329553 21:5536211-5536233 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1176398204 21:6284740-6284762 CTGGAAGAACCCAGGGAACCTGG + Intergenic
1176438953 21:6704364-6704386 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1176463215 21:7031433-7031455 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1176486776 21:7413212-7413234 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1176515034 21:7777575-7777597 CTGGGAATGCCGTGGGAAGCAGG - Intergenic
1178348420 21:31851876-31851898 ATGGGACTACCTAGGGATGGGGG - Intergenic
1178649062 21:34407587-34407609 CTGGGAATGCCGTGGGAAGCAGG - Intronic
1179372267 21:40817435-40817457 GGGGGACTTCCAAGGGAAGCAGG + Intronic
1180069846 21:45430806-45430828 GTGGGGCTGCCCTGGGAAGCCGG + Intronic
1181532899 22:23527121-23527143 CCTGGGCTACCCAAGGAAGCTGG + Intergenic
1181807568 22:25384320-25384342 CTGGGCCTGCCCAGGGTAGTGGG - Intronic
1182504825 22:30774131-30774153 CTTGGACTCCCCAGGGGGGCTGG + Intronic
1183092168 22:35529926-35529948 CTGGGAGTCCCCAAGGAACCTGG - Intergenic
1183432146 22:37772410-37772432 CTGGTACCACCCAGGGACACAGG - Intronic
1183947707 22:41336067-41336089 CAGGGCCTCACCAGGGAAGCAGG + Intronic
1184369714 22:44074720-44074742 CTGGGACTGCCGTGGGCAGCTGG - Intronic
1184713537 22:46267711-46267733 GCGGGACGACCCAGTGAAGCCGG + Intergenic
1185076865 22:48687809-48687831 CTGGGGCAGCCCAGGGAAGGTGG - Intronic
1185241347 22:49749280-49749302 GTGGGACTACCTAGGGTTGCCGG - Intergenic
1185314880 22:50174697-50174719 CTGGGACTTCCCAGGGACAGTGG - Intronic
1185379956 22:50503741-50503763 CTGGGTTTACCCCGGGAGGCTGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950254747 3:11495196-11495218 CTTAGACTCCCCAGGGAAGGAGG + Intronic
950424040 3:12915047-12915069 CTGGGCCTCCCCAGGGCGGCGGG + Intronic
951465721 3:22998598-22998620 CTGGGAGTAGCCTGGGAAGAGGG - Intergenic
952931744 3:38365890-38365912 CTGGGAACACACAGGGCAGCAGG - Intronic
954435556 3:50493997-50494019 CAGGGGCTAGCCAGGGAAGTGGG + Intronic
954618450 3:51982578-51982600 CTGGGAGTACAAAGGGCAGCTGG + Intronic
957747589 3:84365566-84365588 CTGGTGATACCCAGGGAAACAGG - Intergenic
957783487 3:84849462-84849484 CTGGGGCTGCACAGAGAAGCAGG + Intergenic
957850361 3:85799686-85799708 CTGGTAATACCCAGGCAAACAGG - Intronic
959840740 3:110971255-110971277 CTGGTACAACACAGGGGAGCAGG + Intergenic
961059189 3:123813967-123813989 CTGGGACTATTCAGGGGAGCCGG + Intronic
961645843 3:128392414-128392436 CGGGGCCTGCCCAGGGAGGCAGG + Intronic
961992990 3:131212269-131212291 CTGGTGATACCCAGGGAAACAGG - Intronic
962042880 3:131725484-131725506 CTGGGTCTTCCTGGGGAAGCTGG - Intronic
962806575 3:138931671-138931693 TTGAGACTACCCTGGCAAGCTGG + Intergenic
962928159 3:140013923-140013945 CTGCAACTCCCCAGGGAATCTGG + Intronic
963281581 3:143389783-143389805 CTGGGAATATTCATGGAAGCTGG + Intronic
963984364 3:151575022-151575044 CTGGCAATACCCAGGCAAACAGG - Intergenic
964715337 3:159715111-159715133 CTGGTAATACCCAGGCAAACAGG + Intronic
967981794 3:195070166-195070188 CTGTGAAGACCCAGGGCAGCAGG - Intronic
968047133 3:195630823-195630845 GTCGGATTTCCCAGGGAAGCTGG + Intergenic
968307514 3:197659221-197659243 GTCGGATTTCCCAGGGAAGCTGG - Intergenic
968703682 4:2068705-2068727 CTGGCAGTGCCCGGGGAAGCAGG + Exonic
968757567 4:2424749-2424771 CTGGGGGTGCCCTGGGAAGCAGG - Intronic
968890690 4:3367005-3367027 CTGGGTCCAGCCAGGGCAGCAGG - Intronic
969572138 4:8015374-8015396 CTGAGGCTCCCCAGGGGAGCCGG - Intronic
969636788 4:8374032-8374054 CTGGGACCACCCAGGGGAGTTGG + Intronic
969793625 4:9509146-9509168 CTGGGACATCCCACGGAAGTCGG + Intergenic
972685684 4:41350280-41350302 CTGGTGATACCCAGGGAAACAGG + Intergenic
972699703 4:41482302-41482324 ATGCGACTACCCGGGGAAGGAGG + Intronic
972834033 4:42847022-42847044 CTGTCACAACCCTGGGAAGCAGG - Intergenic
972962843 4:44474550-44474572 CTGGTAATACCCAGGCAAACAGG + Intergenic
973562732 4:52152337-52152359 CTGGTAATACCCAGGCAAACAGG + Intergenic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
973883618 4:55297971-55297993 CTGGTGATACCCAGGGAAACAGG + Intergenic
974196691 4:58584870-58584892 CTGGTAATACCCAGGCAAACGGG - Intergenic
974280117 4:59780972-59780994 CTGGTGATACCCAGGGAAACAGG + Intergenic
977671488 4:99699909-99699931 CTGGTAATACCCAGGCAAACAGG + Intergenic
977910844 4:102534302-102534324 CTGGGGCTACCAAAGGAAGGAGG - Intronic
979934137 4:126670575-126670597 CTGGGGATACCCAGGCAAACAGG + Intergenic
980491266 4:133532123-133532145 CTAGGAATAGTCAGGGAAGCAGG + Intergenic
981133893 4:141189201-141189223 CTGGTAATACCCAGGCAAACAGG - Intronic
982625383 4:157760115-157760137 CTGGTGATACCCAGGTAAGCAGG - Intergenic
983668374 4:170207939-170207961 CTGGTGATACCCAGGCAAGCAGG + Intergenic
984372490 4:178884751-178884773 CTGGTGATACCCAGGCAAGCAGG + Intergenic
985038777 4:185867818-185867840 CTGGGAGTCCCCAGAGAGGCTGG + Intronic
985511187 5:315068-315090 CTGGGACCTCCCAGGGTACCGGG + Intronic
985689648 5:1300053-1300075 CTTGACCCACCCAGGGAAGCAGG + Intergenic
986709445 5:10478070-10478092 CTGGCTCTACCCATGGAAGGAGG - Intergenic
986879680 5:12154338-12154360 CTGGTGATACCCAGGCAAGCAGG + Intergenic
987445063 5:18006852-18006874 CTGGTGATACCCAGGCAAGCAGG + Intergenic
989337606 5:40336730-40336752 CTGGTGATACCCAGGGAAACAGG + Intergenic
992080801 5:73233363-73233385 CTGGGACCACCCTGGGACTCGGG + Intergenic
992908804 5:81374176-81374198 CTGGGAATACCTAGGCAAACAGG + Intronic
994233443 5:97335698-97335720 CTGGTAATACCCAGGCAAACAGG - Intergenic
994378178 5:99038444-99038466 CTGGTAATACCCAGGCAAACAGG + Intergenic
994510723 5:100700374-100700396 CTGGGAATACCCAGGCAAATAGG + Intergenic
994528446 5:100935362-100935384 CTGGGAATACCCAGGCAAACAGG - Intergenic
995091846 5:108187438-108187460 CTGGGACTACTCAGATAACCTGG - Intronic
995132726 5:108647523-108647545 CTGAGGCTGCTCAGGGAAGCAGG - Intergenic
995179076 5:109213727-109213749 CTGGTAATACCCAGGCAAACAGG - Intergenic
997097063 5:130924635-130924657 CTGGTAATACCCAGGCAAACAGG + Intergenic
999079046 5:148826388-148826410 CTGGGGCCAGCCAGGGTAGCCGG + Exonic
1001804443 5:174571211-174571233 CTGCAACTATCCAGGGAAGAAGG - Intergenic
1002640789 5:180629695-180629717 CTGGGACTACCCAGGGAAGCAGG - Exonic
1002859167 6:1064802-1064824 CTGGGAGGGCCCAGGGCAGCAGG + Intergenic
1003084766 6:3052709-3052731 CTGGGAAAGCCCAGGGAAGCAGG + Intergenic
1003974275 6:11328073-11328095 CTAGTACTACCCATGGGAGCAGG - Intronic
1004205815 6:13591454-13591476 CTGGGACTGCCCAGGGACCTTGG - Intronic
1004637239 6:17480607-17480629 CTGGGACTTGCAAGAGAAGCAGG + Intronic
1005562366 6:27053921-27053943 CAGGGAATTCCCAGGGAAGCAGG - Intergenic
1006902908 6:37514488-37514510 CTGGGCCTCCCCAGGGAGGCAGG - Intergenic
1007284261 6:40736424-40736446 CTGGGCCTGCCCTGGGAGGCAGG - Intergenic
1007658913 6:43470215-43470237 CTGGAACTACCCAGGGCTGATGG + Intergenic
1009290192 6:61870712-61870734 CTGGTGATACCCAGGGAAACAGG + Intronic
1011504686 6:88028562-88028584 CTGAGACTGCACAGGGCAGCAGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012941078 6:105415845-105415867 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1013372443 6:109482931-109482953 CTGGGACCACCCGGGGCTGCGGG - Intronic
1014858937 6:126439495-126439517 CTGGGACTTCTCAGGGAAAGAGG + Intergenic
1016638453 6:146322201-146322223 CTGGTAATACCCAGGCAAACAGG - Intronic
1018114043 6:160565390-160565412 CTGGTAATACCCAGGCAAACAGG + Intronic
1019359836 7:599026-599048 CAGGCAGGACCCAGGGAAGCTGG + Intronic
1020810059 7:12840348-12840370 CTGGTGATACCCAGGCAAGCAGG + Intergenic
1021379820 7:19953994-19954016 CTGGTAGTACCCAGGCAAACAGG - Intergenic
1021996246 7:26180550-26180572 CTGTGAATACTCAGGGAAGTGGG - Intronic
1022097433 7:27149576-27149598 CGGGGGCTACCCCTGGAAGCCGG + Intronic
1022647496 7:32244947-32244969 CTGGGCCTTCCCAGGGACTCTGG - Intronic
1022732055 7:33036340-33036362 CTGGAGCCACCCACGGAAGCTGG - Intronic
1023006493 7:35875456-35875478 CAGGGACTACCCAGACAAGACGG - Intronic
1023030230 7:36084629-36084651 CTGGAACAGCCCAGGGAAGGAGG + Exonic
1023180128 7:37474183-37474205 CTTGGACTACCGATGGCAGCAGG - Intergenic
1024787525 7:52925547-52925569 CTGGGGCAACCCAGAGGAGCAGG + Intergenic
1025813100 7:64888010-64888032 CTGGGACTTCTCAGGGATGGGGG - Intronic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1027910621 7:84245655-84245677 CTGGTGCTACCCAGGCAAACAGG - Intronic
1028652755 7:93169713-93169735 CTGGTGCTACCCAGGCAAACAGG - Intergenic
1028801310 7:94969447-94969469 CTGGTAATACCCAGGCAAACAGG - Intronic
1029183265 7:98719986-98720008 CTGGGACTAGACATGGAACCAGG + Intergenic
1030534125 7:110744586-110744608 CTGGTGCTACCCAGGCAAACAGG + Intronic
1031157146 7:118123058-118123080 CTGGTAATACCCAGGCAAACAGG + Intergenic
1033291909 7:140092407-140092429 CTGTGACTTGCCAGGGAAGTGGG - Intronic
1033424800 7:141234354-141234376 CTGGGACTTCCCAGACAAGAGGG + Intronic
1034324780 7:150220520-150220542 CTGGGACCCCGGAGGGAAGCCGG + Intergenic
1034768411 7:153748711-153748733 CTGGGACCCCGGAGGGAAGCCGG - Intergenic
1035274472 7:157739316-157739338 CTGGGACAGCCGAGGGAAACTGG + Intronic
1036573888 8:10006586-10006608 CTTGAAGTAGCCAGGGAAGCAGG + Intergenic
1036677947 8:10850710-10850732 CTGCCACTCCCCAGGGAAGGAGG + Intergenic
1037050071 8:14361985-14362007 CTGGTGATACCCAGGCAAGCAGG - Intronic
1039676698 8:39675929-39675951 CTGGTGATACCCAGGGAAACAGG - Intronic
1039746390 8:40431722-40431744 CTGGGACTACAGAGGCACGCCGG - Intergenic
1040355088 8:46609263-46609285 CTGGTAATACCCAGGCAAACAGG + Intergenic
1042550493 8:69990124-69990146 CTGGGACTACCCAGCTACTCAGG + Intergenic
1042833538 8:73056599-73056621 CTGGTAATACCCAGGCAAACAGG + Intergenic
1042969221 8:74390482-74390504 CTGGTGATACCCAGGGAAACAGG - Intronic
1044509368 8:93057800-93057822 CTGGTAATACCCAGGCAAACAGG - Intergenic
1044798891 8:95933195-95933217 CTGGTAATACCCAGGCAAACAGG - Intergenic
1046295958 8:112218956-112218978 CTGGTGATACCCAGGGAAACAGG + Intergenic
1048302875 8:133264584-133264606 GTGGGACTCCCAAGGGAAACCGG - Exonic
1049428132 8:142546515-142546537 CTGGGAGGCCCCTGGGAAGCAGG + Intergenic
1049513881 8:143043495-143043517 CTGAGGCCACCCAGGGAACCAGG + Intronic
1049543409 8:143218610-143218632 CTGGGACACCTCTGGGAAGCTGG - Intergenic
1051230560 9:14950566-14950588 CTGGTGATACCCAGGAAAGCAGG + Intergenic
1055537782 9:77267468-77267490 CTGGTGATACCCAGGGAAACAGG - Intronic
1056695423 9:88846329-88846351 CTGAGACTGCACAGGGCAGCAGG - Intergenic
1057325744 9:94061750-94061772 CTGGGGCTGCACAGGGCAGCAGG + Intronic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057946421 9:99333525-99333547 CTGGGGGTACTCAGGGATGCTGG + Intergenic
1058270767 9:102968488-102968510 CTGGGTCTCCCCATAGAAGCTGG + Intergenic
1058426262 9:104877436-104877458 CTGGGACTACCCAAGGATGTGGG - Intronic
1059376883 9:113888883-113888905 CTTGGAATAGCCAGGTAAGCAGG + Intronic
1060334521 9:122709454-122709476 CTGGTGATACCCAGGGAAACAGG + Intergenic
1061247566 9:129408713-129408735 CCTGGGCTACCCAAGGAAGCTGG - Intergenic
1061520981 9:131117692-131117714 CTGGGGCTTAGCAGGGAAGCTGG - Intronic
1061872484 9:133528264-133528286 CTGAGGCTACACAGGGAACCAGG - Intronic
1061873177 9:133531447-133531469 CTGGGACCAGCCAGGGAAGGCGG + Intergenic
1062120429 9:134831151-134831173 CTGTGTCCACCCAGGGAGGCTGG - Intronic
1062229882 9:135476097-135476119 CTGGGAGGACCCAAGGATGCAGG - Intergenic
1062316057 9:135967435-135967457 CTGCCACCACCCAGGGCAGCTGG - Intergenic
1062730352 9:138105038-138105060 ATGGGACTTCCCAGGGCTGCAGG - Intronic
1203432542 Un_GL000195v1:104115-104137 CTGGAAGAACCCAGGGAACCTGG + Intergenic
1186773218 X:12838658-12838680 CTGGGGATACCCAGGCAAACAGG - Intergenic
1187595873 X:20772002-20772024 CTGGTGATACCCAGGGAAACAGG + Intergenic
1190034484 X:47008761-47008783 CTGGGAGGAGACAGGGAAGCAGG + Intronic
1191039411 X:56063465-56063487 CTGGTAATACCCAGGAAAACAGG - Intergenic
1191050116 X:56182743-56182765 CTGGTAATACCCAGGCAAACAGG - Intergenic
1191155843 X:57271603-57271625 CTGGTGATACCCAGGGAAACAGG + Intergenic
1192081097 X:68048710-68048732 CTTGGAGAACCCAGGGAAGCTGG + Intronic
1192454730 X:71267267-71267289 CTGGGAATAGTCAGGGAAGCAGG - Intergenic
1192825991 X:74696543-74696565 CTGGTGCTACCCAGGCAAACAGG + Intergenic
1192992210 X:76472074-76472096 CTGGTAATACCCAGGCAAACAGG + Intergenic
1193510108 X:82388916-82388938 CTGGTGATACCCAGGGAAACAGG + Intergenic
1195675459 X:107504152-107504174 CTGAGACTGCCAAGGGAGGCTGG + Intergenic
1195856131 X:109335094-109335116 CTGGTGATACCCAGGGAAACAGG - Intergenic
1197191181 X:123649154-123649176 CTGGAGCTACCCAGGCAAACAGG + Intronic
1197529579 X:127606362-127606384 CTGTAACTAGCCAGGGAAGAAGG + Intergenic
1197614199 X:128674314-128674336 CTGGAGCTACCCAGGAAAACAGG - Intergenic
1198062690 X:133062598-133062620 CTGGTAATACCCAGGCAAGTAGG + Intronic
1198519095 X:137434207-137434229 CTGGTGATACCCAGGGAAACAGG + Intergenic
1199134445 X:144234210-144234232 CTGAGGCTGCCCAGGGAAGTGGG - Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200405852 Y:2810921-2810943 CTGGTGATACCCAGGGAAACAGG - Intergenic
1201633809 Y:16099436-16099458 CTGGTGATACCCAGGGAAACAGG + Intergenic
1202040281 Y:20675327-20675349 CTGGTGATACCCAGGGAAACAGG + Intergenic