ID: 1002642621

View in Genome Browser
Species Human (GRCh38)
Location 5:180637499-180637521
Sequence GATGATTGCATAGCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002642621_1002642624 14 Left 1002642621 5:180637499-180637521 CCAGTCTTTGCTATGCAATCATC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1002642624 5:180637536-180637558 TTTGTTTGTTTGTTTTGAGATGG 0: 1837
1: 1336
2: 2541
3: 99899
4: 82611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002642621 Original CRISPR GATGATTGCATAGCAAAGAC TGG (reversed) Intronic
906655021 1:47541838-47541860 GATGAAGACATACCAAAGACTGG - Intergenic
910454666 1:87384750-87384772 CATGTATGCGTAGCAAAGACTGG - Intergenic
911433568 1:97825244-97825266 CAAGACTGCACAGCAAAGACTGG + Intronic
911740938 1:101386230-101386252 GATAAAGGCATACCAAAGACCGG + Intergenic
912181227 1:107221382-107221404 GATCATGGCCTAACAAAGACAGG + Intronic
912185089 1:107265809-107265831 TATGAATGCATAGCAAAGATGGG + Intronic
913698259 1:121348635-121348657 AATAATTACAGAGCAAAGACAGG - Intronic
914452379 1:147803838-147803860 GGTGATTGGATGGCAAAGTCAGG + Intergenic
915706161 1:157845800-157845822 GATGATGGCAGCCCAAAGACGGG + Intronic
917206299 1:172574561-172574583 AATAAGTGCATAGTAAAGACTGG - Intronic
923043417 1:230336608-230336630 GGTGCATGCATGGCAAAGACTGG - Intronic
923410463 1:233703313-233703335 TATGATTGTATAGGAAAAACAGG - Intergenic
1063069783 10:2649536-2649558 GATGATTGCATAGAGGAGATGGG - Intergenic
1063260384 10:4382229-4382251 GATGATTGCAGAGTAGAGAATGG + Intergenic
1065057273 10:21859487-21859509 GATGATTTCATATCAAATAGGGG - Intronic
1065562357 10:26976535-26976557 GATGTTTGCACAGCAAACATAGG + Intergenic
1065947578 10:30620371-30620393 GAAGATTGGACAACAAAGACTGG - Intronic
1066653918 10:37682156-37682178 AATGAATGCTTATCAAAGACTGG - Intergenic
1067778893 10:49184074-49184096 AATCATTGCAAAGCAAAGAAAGG + Intronic
1068676983 10:59778745-59778767 GAGGATAGCATGGGAAAGACTGG + Intergenic
1069175610 10:65285596-65285618 GAGAATTGCACAGGAAAGACCGG + Intergenic
1069449931 10:68508836-68508858 AATGATTACCTAGCAGAGACAGG + Intronic
1070422056 10:76246839-76246861 GATAACTGCATAACAAAGATGGG + Intronic
1080398446 11:31911722-31911744 GCTGATTCCAGGGCAAAGACAGG - Intronic
1081093124 11:38897820-38897842 GGTGATAGAAAAGCAAAGACTGG + Intergenic
1087734744 11:101819390-101819412 AATGGATGCAGAGCAAAGACTGG - Intronic
1088398073 11:109390728-109390750 GATGCTTGCTGAGTAAAGACTGG - Intergenic
1092230564 12:6773481-6773503 GCTGATTGCAGAGCAAGGGCAGG - Intronic
1095131694 12:38549934-38549956 GATGAAGGCATATCCAAGACTGG + Intergenic
1097027562 12:56068707-56068729 GATGAATGCATAGCTCAAACGGG + Intergenic
1097945411 12:65362624-65362646 GATGAGTGCAAAGGAATGACTGG + Intronic
1098202162 12:68068043-68068065 GATGAATGCATACTAAAGAAGGG - Intergenic
1099682836 12:85849461-85849483 GAGGATTGCAGAGCAAAGTGAGG - Intergenic
1099941772 12:89197532-89197554 CATGAGGGCAGAGCAAAGACAGG + Intergenic
1100944050 12:99759140-99759162 AATGATTTGATAGCACAGACTGG + Intronic
1101225392 12:102683027-102683049 TATGATTGCCTAACAAACACAGG - Intergenic
1102564179 12:113783875-113783897 GATGTTTGCATGGGAAAGTCTGG - Intergenic
1102936521 12:116901964-116901986 GATGATTGCCCAGGAAGGACTGG + Intergenic
1108572491 13:51765163-51765185 AATGATGTGATAGCAAAGACAGG - Exonic
1108604151 13:52020465-52020487 GAAGATGGCAGAGCAAATACAGG - Intronic
1108959090 13:56200693-56200715 GATGATAGCATAGGAAACTCTGG - Intergenic
1109154127 13:58883570-58883592 GATGATTGCATTTCAAAGGATGG + Intergenic
1110509917 13:76337377-76337399 GATGATTACATTTCAAAGACAGG + Intergenic
1110525618 13:76533178-76533200 GAGGATTTCATATCAAAGATAGG + Intergenic
1112034808 13:95487180-95487202 GATGCTAGGATAGCAGAGACTGG - Intronic
1112234937 13:97627038-97627060 GAAGATGCCATAGCAAAGAGAGG + Intergenic
1112354504 13:98662540-98662562 GATGATTCCATTGCAAAGAGGGG + Intergenic
1112734666 13:102402455-102402477 GAAGTTTGCATTGAAAAGACTGG + Intergenic
1116148078 14:41100481-41100503 GAGAATTGCATGGGAAAGACGGG - Intergenic
1116623904 14:47241868-47241890 AATGATTTCATAGTAAAGAAGGG - Intronic
1116627320 14:47282105-47282127 GATGTTTGTATAGAAAAGTCAGG + Intronic
1116831326 14:49722626-49722648 GATAATGACATACCAAAGACTGG + Intronic
1117198363 14:53363423-53363445 GAGAATAGCATAGGAAAGACTGG + Intergenic
1117347667 14:54849784-54849806 GCTGAATGCAGCGCAAAGACAGG - Intronic
1119150678 14:72356748-72356770 GAGAAGTGCAGAGCAAAGACAGG - Intronic
1119165258 14:72487116-72487138 CATCATTGCATGGAAAAGACAGG - Intronic
1121373602 14:93384042-93384064 GATAAATGCATACCCAAGACTGG - Intronic
1135243448 16:20831947-20831969 TATGGTTGCTTAGCCAAGACCGG - Intronic
1135619465 16:23943104-23943126 GTGGATGGCAGAGCAAAGACTGG - Intronic
1139138703 16:64234757-64234779 GTTGAGTGTATAACAAAGACAGG - Intergenic
1143272844 17:5688612-5688634 GATGGTCGCATAGCAAGGAAGGG - Intergenic
1149497221 17:57126780-57126802 GATGATAGCATAACATAAACAGG + Intergenic
1150707059 17:67496530-67496552 GATAATTCCATAGTAAACACGGG - Intronic
1153832794 18:8938018-8938040 GATGATTACATAGCTCAGGCAGG - Intergenic
1153965548 18:10178294-10178316 GATAATAGCATACCCAAGACTGG + Intergenic
1155560748 18:27073563-27073585 GAAGATGGCATAGCCTAGACAGG + Intronic
1158499718 18:57989525-57989547 TATAATTGAATACCAAAGACTGG - Intergenic
1160257737 18:77261633-77261655 GATGTTTCCATGGGAAAGACAGG + Intronic
1165526748 19:36362310-36362332 GAGGATTGCATTGCAGAGAGGGG + Intronic
927460100 2:23291533-23291555 GATAATTGCCTTCCAAAGACTGG - Intergenic
927587547 2:24321138-24321160 GATGTCTGCATTGCAAATACAGG + Intronic
928373201 2:30756119-30756141 GATGTTTGCAGAGCAGGGACTGG - Intronic
929878724 2:45818467-45818489 GATGTTTGCTTAGGAAGGACGGG + Intronic
931086226 2:58833505-58833527 GATGAATGCATAGCAAATACTGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
933479366 2:82835689-82835711 CATAATTGCATAGCAAAGAATGG - Intergenic
933995614 2:87667135-87667157 TATGACTGCATTGCAAATACTGG - Intergenic
935183114 2:100707514-100707536 AATGATTGCAAAGCAGAGAAAGG + Intergenic
936298243 2:111283777-111283799 TATGACTGCATTGCAAATACTGG + Intergenic
939492144 2:142889163-142889185 GATGTTTCTATAACAAAGACAGG + Intronic
939647001 2:144712436-144712458 GATGTTTACAAAGCAAAGAGTGG - Intergenic
941515840 2:166476586-166476608 GATGATTGCATGGAAGAGACAGG - Intronic
941536125 2:166723950-166723972 GAGAATAGCATAGCAAAGGCCGG + Intergenic
945152147 2:206802867-206802889 GCTGATGGCAGAGCAAAAACAGG + Intergenic
1169817819 20:9676737-9676759 GATGATTTCATATCAAAGCCAGG - Intronic
1170257325 20:14359574-14359596 GATAAATGGATAGCAAAGGCTGG + Intronic
1170365081 20:15589204-15589226 GAGAATAGCATAGGAAAGACTGG + Intronic
1171319835 20:24232929-24232951 GATGGTTGCACCGCAATGACCGG - Intergenic
1172231924 20:33342462-33342484 GAACATTGCATATCACAGACAGG - Intergenic
1174541722 20:51294985-51295007 GATGAATGGATTGCAAAGTCCGG + Intergenic
1177740434 21:25147328-25147350 GAGAATAGCATGGCAAAGACTGG + Intergenic
1178469162 21:32876282-32876304 GAAAATAGCATAGGAAAGACTGG + Intergenic
1179076481 21:38127028-38127050 GCTTATTACCTAGCAAAGACAGG - Intronic
1182991761 22:34774741-34774763 AATGATTGCATGGGAAAGGCAGG + Intergenic
1184470997 22:44696293-44696315 GAGGATGGCATTGCAGAGACAGG - Intronic
950255072 3:11497926-11497948 TATCATTGCATGGAAAAGACTGG + Intronic
952195584 3:31072477-31072499 GATAATAGCACAGGAAAGACTGG - Intergenic
956412266 3:68991969-68991991 GAGAATAGCATAGGAAAGACTGG + Intronic
956779705 3:72594259-72594281 GCTGATTGGATAGGAGAGACAGG - Intergenic
956910173 3:73808499-73808521 GAGAATAGCATAGGAAAGACTGG - Intergenic
957031194 3:75243800-75243822 GATGATTGCAGTGAAAAGAAAGG - Intergenic
958592739 3:96179817-96179839 GATGATTGCATTTCAAAGAGAGG + Intergenic
959695204 3:109241736-109241758 GATGAGTACATTGCAAAGAAAGG + Intergenic
960688989 3:120323729-120323751 GATGACTGCTTGGCAAAGACAGG - Intergenic
961933701 3:130561041-130561063 GATGTTTGCAGGGCAAAGTCTGG - Intronic
962033661 3:131628243-131628265 GATGAAGGCATACCCAAGACTGG + Intronic
962068372 3:132007875-132007897 GCTGATTGCTTAGGGAAGACGGG - Intronic
962711206 3:138087776-138087798 GATAATTCCATGGCAAAGAAGGG - Intronic
962769812 3:138601825-138601847 GAGAATAGCACAGCAAAGACTGG - Intergenic
963739612 3:149063730-149063752 GATGAGTACAAAGAAAAGACTGG - Intronic
964919310 3:161876603-161876625 GGTGTTGACATAGCAAAGACTGG - Intergenic
965464674 3:169013275-169013297 GAGGATTGCTTAGGAAATACTGG - Intergenic
970357958 4:15276752-15276774 GATGAATACATACCCAAGACTGG + Intergenic
972155789 4:36159954-36159976 GATGAGTGCAAAGCAAATTCAGG + Intronic
973204892 4:47549451-47549473 GAGGAGTGCATAGAACAGACAGG - Intronic
974388559 4:61234360-61234382 GAGAATAGCATAGGAAAGACCGG + Intronic
974562629 4:63541473-63541495 GATGTCTGCATAGGAAAGGCAGG - Intergenic
974955078 4:68629253-68629275 CATGATTTCATATCAAAGAAAGG - Intronic
975550294 4:75606107-75606129 TATGATGGCATAGCATAGATTGG - Intronic
976649586 4:87420682-87420704 GATGAATGCATAACAAAGTGGGG - Intergenic
977339305 4:95738122-95738144 GATGATAGTACAGAAAAGACAGG - Intergenic
977650973 4:99469170-99469192 GATAAATACATACCAAAGACTGG + Intergenic
978295565 4:107200699-107200721 GAACATAGCATAGGAAAGACTGG - Intronic
978546228 4:109875158-109875180 CTTGATTGCAGAGCAATGACAGG - Intergenic
980231757 4:130054323-130054345 AATAATTTCATAGCAAAGATTGG - Intergenic
981256558 4:142667778-142667800 GATGATTGAATAGAAAGGATTGG + Intronic
984258082 4:177410804-177410826 GATGTTTACATTGCAAAGAGAGG - Intergenic
984593077 4:181637920-181637942 GATGGGTGCATAGGAATGACAGG + Intergenic
985542838 5:494771-494793 GACGAGTGCCTAGCAAAGCCGGG + Intronic
987357404 5:17076606-17076628 GCTGATAGAATAGCAAACACAGG + Intronic
990042866 5:51393838-51393860 GATCATTGAATAGCATATACTGG - Exonic
991195268 5:63924751-63924773 GAGAATAGCATGGCAAAGACTGG - Intergenic
992472128 5:77068448-77068470 TTTGATTGCATAACAAAGAAGGG + Intergenic
993572285 5:89556324-89556346 GATGATATTAAAGCAAAGACTGG - Intergenic
999581290 5:153041031-153041053 GATGATTTCACAGCAAAACCTGG + Intergenic
1002642621 5:180637499-180637521 GATGATTGCATAGCAAAGACTGG - Intronic
1003497531 6:6677501-6677523 GATGTTTGCATGCTAAAGACAGG - Intergenic
1004755371 6:18604872-18604894 TATGATTGCAGATCAAAGGCAGG + Intergenic
1004899852 6:20183984-20184006 GAGAATAGCATAGGAAAGACTGG + Intronic
1008122096 6:47630655-47630677 GATGATTAGATAGGATAGACAGG - Intergenic
1008783597 6:55138863-55138885 GAAGAGTGCCTAGCAAAGATGGG - Intronic
1009619918 6:66062789-66062811 GAGAATTGCAGAGCAAAGAGGGG - Intergenic
1016335720 6:143002987-143003009 GATAATAGCACAGGAAAGACCGG + Intergenic
1016474105 6:144407336-144407358 GATGGTTGCATTGGAGAGACAGG + Intronic
1020763022 7:12290795-12290817 GATAATGCCATAGAAAAGACTGG - Intergenic
1020967290 7:14887250-14887272 GATGATTGCAGATCAACTACAGG - Intronic
1021968368 7:25944381-25944403 GATGGTTGCACAGCAAACAATGG + Intergenic
1022798846 7:33755784-33755806 GAAGATTGCATGGTAAAGCCGGG + Intergenic
1023784055 7:43687951-43687973 GAGAATAGCACAGCAAAGACTGG - Intronic
1024603468 7:51006993-51007015 GTTGACAGCATAGCCAAGACTGG + Intergenic
1028249543 7:88525259-88525281 GATAAAGACATAGCAAAGACTGG + Intergenic
1029628246 7:101733952-101733974 AATGATTGCATAGGGAAGCCAGG + Intergenic
1030915076 7:115303003-115303025 GATGAAGACATACCAAAGACTGG - Intergenic
1031373324 7:120994791-120994813 GAAGAATGCTAAGCAAAGACTGG + Intronic
1036220248 8:6915237-6915259 GATGAGTGACTAGCAAAGCCTGG + Intergenic
1036498759 8:9294624-9294646 GATAAAGGCATACCAAAGACTGG + Intergenic
1037067798 8:14603817-14603839 GAGGAGTGCAAAACAAAGACAGG - Intronic
1042794406 8:72645009-72645031 GATGATTGTATAGGAAACTCTGG - Intronic
1044100359 8:88128608-88128630 GATGATTACATTCCAAAGAATGG - Intronic
1047445902 8:124919388-124919410 TATGATGCCAAAGCAAAGACAGG - Intergenic
1047458469 8:125038677-125038699 GATGATTGCTTAGAAAGGGCAGG + Intronic
1047630430 8:126700400-126700422 GAAGATAGCATGGGAAAGACTGG - Intergenic
1048928296 8:139290553-139290575 GATGCTTGCACAGCAGAGAGGGG - Intergenic
1050719652 9:8571933-8571955 GATGATTGCATGGCAGAGGAAGG + Intronic
1051119244 9:13733901-13733923 CATGCTTCCATGGCAAAGACTGG + Intergenic
1052198462 9:25747164-25747186 GATAAATACATAGCAGAGACTGG + Intergenic
1052398896 9:27975894-27975916 GATAGTTGCATAGTAAAGAAAGG + Intronic
1057010170 9:91593894-91593916 GATGATAGCATTGCCAATACAGG - Intronic
1059558420 9:115306602-115306624 GATGAAGACATACCAAAGACTGG + Intronic
1059986145 9:119822578-119822600 GAGAATAGCATGGCAAAGACTGG - Intergenic
1060243273 9:121923262-121923284 GAGGATTGCATAGCAATGTGCGG + Intronic
1186323865 X:8458174-8458196 GACGATAGCATGGGAAAGACAGG + Intergenic
1190163550 X:48052326-48052348 GATGCTTGCAGAGCAGAGAGTGG + Intronic
1192072175 X:67952657-67952679 CATGGTTGAAGAGCAAAGACAGG + Intergenic
1194860919 X:98998274-98998296 GATAAAGACATAGCAAAGACTGG - Intergenic
1197681171 X:129386918-129386940 GATGAATGCCATGCAAAGACTGG + Intergenic
1197713375 X:129688159-129688181 AATGATTGCCTAGAGAAGACAGG + Intergenic
1198919943 X:141714302-141714324 GATGATTACCTAACAGAGACAGG + Intergenic