ID: 1002642682

View in Genome Browser
Species Human (GRCh38)
Location 5:180637901-180637923
Sequence CTGTGGCCATGAAGGGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002642682_1002642691 21 Left 1002642682 5:180637901-180637923 CCTATCCCCCTTCATGGCCACAG 0: 1
1: 1
2: 1
3: 16
4: 239
Right 1002642691 5:180637945-180637967 AGTCTCCCCTCATCCACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002642682 Original CRISPR CTGTGGCCATGAAGGGGGAT AGG (reversed) Intronic
902156841 1:14494527-14494549 CTATTGACCTGAAGGGGGATTGG - Intergenic
902542948 1:17167214-17167236 CTGTGGCCAGGAAGGGAGGGAGG - Intergenic
902964292 1:19987220-19987242 CTGAGGCCATGGAGGAGCATGGG - Intergenic
903666610 1:25011861-25011883 CAGAGGCCATGAAGGGGATTAGG - Intergenic
904296428 1:29522287-29522309 CTGTGCCTGTGAAGGGGGCTGGG + Intergenic
904409900 1:30319147-30319169 CTGTGCCCGTGAAGGGGGCCGGG - Intergenic
904853798 1:33479653-33479675 CTGTGGCCTTGGTGGAGGATTGG + Exonic
905654442 1:39677050-39677072 CTGAGGCCACGCTGGGGGATGGG - Intergenic
905863392 1:41364551-41364573 CTGAGGCCCTGGAAGGGGATAGG + Intronic
905909925 1:41646698-41646720 CTGAGGCCATGATGGGGAAGAGG - Intronic
905924313 1:41739157-41739179 CTGGGGCCATGCAGGGGCAGAGG - Intronic
906282340 1:44562971-44562993 CTGTGGACCTGAATGGGGCTGGG + Intronic
912737808 1:112165591-112165613 CAGTGGCCAGTAGGGGGGATGGG + Intergenic
915030014 1:152871089-152871111 CTGAGGCCATGGAGGGGCTTTGG + Intergenic
915170221 1:153972531-153972553 CTGAGGCCAAGAAGGGAGAGAGG - Intronic
915963931 1:160290284-160290306 CTGTGCCCATTGAGGGGTATAGG - Intronic
916926255 1:169524109-169524131 CTGTGTGCAAGAAAGGGGATAGG - Intronic
918382999 1:183975784-183975806 ATGTGGCCATGAAGGAGTCTTGG - Intronic
919895838 1:202009372-202009394 CTCTGGCCATGGAGCTGGATGGG + Exonic
921032115 1:211343216-211343238 ACGTGGCTATGAAGGGGTATGGG + Intronic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
921599199 1:217089195-217089217 CTCTATCCAGGAAGGGGGATGGG + Intronic
923892301 1:238229288-238229310 TTGTGGCCAGGATTGGGGATGGG - Intergenic
923975574 1:239258063-239258085 CTGTGGCCCTAAATGGGGAAAGG - Intergenic
924615091 1:245605978-245606000 CTTTGGACATAAAGTGGGATGGG - Intronic
1067541336 10:47156807-47156829 CTGTGCCCATGGAGTGGTATTGG + Intergenic
1068674127 10:59752636-59752658 CTGTGGTCTTGAAGAAGGATTGG + Intergenic
1069663864 10:70142259-70142281 CTGTGGCCATGAAGGAGGATGGG - Intronic
1073442232 10:103559021-103559043 CTGTGGCCAGGAAAGGGAAATGG + Intronic
1075787742 10:125061441-125061463 CTGTGGACAGGAAGGGGTACAGG + Intronic
1076020813 10:127071185-127071207 CTGTGGCCCTGCAGAGGGTTGGG + Intronic
1076309169 10:129491629-129491651 CTGTGGTCAAGAAAGGGGAAAGG - Intronic
1076638256 10:131897394-131897416 CTGAGGCTATAATGGGGGATGGG + Intergenic
1077024433 11:432932-432954 CGGTGTCCAGGAAGGGGCATCGG + Intronic
1077300505 11:1844389-1844411 CTGTGGCCAGGAAGGGGTTGGGG + Intergenic
1078060274 11:8038863-8038885 CTGTGGCCACGATGGGGGCCAGG + Exonic
1078430160 11:11282135-11282157 CTGAGGTCAAGAAGGGGGACAGG - Intronic
1079344975 11:19644115-19644137 TTGTTGCCCTGGAGGGGGATGGG + Intronic
1079372980 11:19867922-19867944 CTGTGGCTGTGAAGGAGCATTGG + Intronic
1080579533 11:33631010-33631032 CTGTGGCAATGAACTTGGATGGG + Intronic
1080948723 11:37004241-37004263 CTGCCGCCATGAAAGTGGATGGG - Intergenic
1081371898 11:42314308-42314330 CTGTGGCCATGTAGGATAATGGG - Intergenic
1081704153 11:45170947-45170969 ATGTACCCATGGAGGGGGATGGG - Intronic
1081908340 11:46683416-46683438 CTGTGCCCATGAGAGGGGATGGG + Intronic
1083939017 11:65885189-65885211 GTGAGGCCATGAAGGGGGTGGGG + Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084198882 11:67542261-67542283 CTGTGGCCAGGAAAAGGGACTGG + Intergenic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084601772 11:70149970-70149992 CTTTGGCCATGGAGGGTGTTCGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086869359 11:92018310-92018332 CTGTAGCCACTATGGGGGATGGG + Intergenic
1088546530 11:110965105-110965127 AAGTGGCCATGAAGGGAGAGAGG + Intergenic
1089746396 11:120620411-120620433 CTGTGGCCATACATGGGGACTGG - Intronic
1091126832 11:133107612-133107634 CTGTGACTATGAAGAGGGAAAGG - Intronic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1095922255 12:47543130-47543152 CCGTGGCCATGAGGAGGGCTTGG - Intergenic
1096032403 12:48431799-48431821 CTAGGGCCAAGAATGGGGATGGG + Intergenic
1097070484 12:56350889-56350911 CTGGGGGAAGGAAGGGGGATAGG + Intronic
1097087894 12:56482276-56482298 GTGTGGGCATGATGGGGAATAGG - Intronic
1097302546 12:58034272-58034294 CTGTGGCCATTGTTGGGGATGGG + Intergenic
1101970203 12:109307486-109307508 CTGAGGCCAAGAAAGGGGAAAGG - Intronic
1102491335 12:113291207-113291229 CTGGGGACATGCAGGGAGATGGG - Intronic
1102498805 12:113337263-113337285 CTGTGGCCATGTGGAGGGGTTGG - Intronic
1103086680 12:118066893-118066915 CTGAGGACATGAAGGGTGACTGG - Intronic
1103948851 12:124541032-124541054 GGGTGGAGATGAAGGGGGATGGG + Intronic
1104351422 12:128047388-128047410 CTGTGGCCATGTAATGGGCTTGG - Intergenic
1104763842 12:131313882-131313904 GTGTGGCCATGAAGAGAGAAAGG - Intergenic
1107327708 13:39262993-39263015 CTCTGCCCATGAAGGGTGAAAGG - Intergenic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1107788826 13:43980437-43980459 CTATGGCCATGAATGGGGGCAGG - Intergenic
1113275288 13:108721888-108721910 CTGTGGCCATGAAGGAATCTAGG + Intronic
1115000954 14:28419244-28419266 CTTTGTCCATGGAGGGGGATAGG - Intergenic
1117389325 14:55247999-55248021 CTGTGGCCATAGAGGGTGGTAGG + Intergenic
1117735997 14:58769261-58769283 CTGTGGCCTGGAAGGGGGTAAGG - Intergenic
1121050011 14:90814235-90814257 CGGGGGCCATGAAGGTGAATAGG + Intronic
1121122483 14:91384802-91384824 CTGTGGCCAGGAAGGGAGTGGGG - Intronic
1124057877 15:26259381-26259403 CTGTGACTGGGAAGGGGGATGGG - Intergenic
1125238970 15:37550737-37550759 CTGTGGTCTTGAAGGAGGATGGG - Intergenic
1126161581 15:45618971-45618993 CTGTGGGCATGATGGGGGCCAGG + Intronic
1127860282 15:62988272-62988294 CTTTGCCCATGAAGGGAGATTGG - Intergenic
1128850132 15:70946239-70946261 CTATGGTCATGTAGGGTGATTGG - Intronic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129605644 15:77023751-77023773 CTGTGGTCATGAAGGAGGCGGGG + Intronic
1129771441 15:78205863-78205885 CTCTGTACAAGAAGGGGGATTGG - Intronic
1130148433 15:81293028-81293050 CTGTGGCCAGGTAAGAGGATGGG + Exonic
1130171237 15:81516729-81516751 CTGTGTCCATAAAGTAGGATTGG + Intergenic
1134232145 16:12437650-12437672 CTGGGGCTATGAAGGAGGAGAGG - Intronic
1136026393 16:27471650-27471672 CTGTGGCCATGAAAGCGTGTAGG - Intronic
1136066124 16:27760082-27760104 TTGTGGCCATGAAGAGGGGCTGG - Intronic
1139949045 16:70660401-70660423 CTGGGGACCTGAAGGTGGATGGG + Exonic
1139952093 16:70677460-70677482 TTCTGGCCATGAAGGGAGGTGGG + Intronic
1140586604 16:76300271-76300293 ATGTGGACATGATGTGGGATAGG - Intronic
1141502707 16:84454840-84454862 TCGTGGCCATGACTGGGGATGGG + Exonic
1141570198 16:84929529-84929551 CTGTGGCCATGAGCGAGGGTGGG + Intergenic
1141996372 16:87638818-87638840 CTGGGGTCAGGAAGGGGGACTGG - Intronic
1142170334 16:88618692-88618714 CTGTGGCCTTCAACGGGGAATGG + Intronic
1143130241 17:4673001-4673023 GTGGGGCCCTGAAGGGCGATGGG + Exonic
1143543049 17:7580848-7580870 CTGGGGCCAGGGAGGTGGATAGG + Intronic
1143586597 17:7853605-7853627 CTGTGGCCGAGAAGGGGGTCGGG + Exonic
1147779944 17:42934087-42934109 CTGTGGCCGTGTTGGGGGAATGG - Intergenic
1148664347 17:49362923-49362945 CTGTGGCCAGGAATAGGGAAGGG + Intergenic
1150137050 17:62701865-62701887 CTGTGGCCATGTGGGTGGCTGGG - Intronic
1152199987 17:78939665-78939687 CTCTGGCCTTGATGGGGGAGGGG + Intergenic
1152271821 17:79329359-79329381 GTGTGGCCAGGATGGGGGACAGG - Intronic
1152621251 17:81366022-81366044 CTGTGGCCATGAAGGCGGGAGGG - Intergenic
1153571045 18:6473894-6473916 CTGTGGTCAGGAAGTGGCATTGG - Intergenic
1155886721 18:31217382-31217404 CTGCAGCCACGATGGGGGATGGG - Intergenic
1156354788 18:36331786-36331808 GTGTGGCCATGCAGGGGAGTGGG + Intronic
1156549766 18:38003568-38003590 CTGTGGCCCTAAATGGGGACAGG + Intergenic
1157549368 18:48570685-48570707 CTGTGGCCAAGAGGTGGGAGAGG + Intronic
1158305055 18:56096065-56096087 CTGTGGCCATCACCTGGGATTGG - Intergenic
1160343054 18:78106199-78106221 CTCTGGCCATGAAAGGGATTAGG - Intergenic
1160467167 18:79089092-79089114 CTTTGGCGATGCAGGGGGAAAGG + Intronic
1160926522 19:1549385-1549407 GGGTGGACAGGAAGGGGGATGGG - Intergenic
1161010907 19:1958907-1958929 CTGTGGCCCTGGACGGGGGTGGG - Intronic
1161686264 19:5704162-5704184 CTGTGGCTGTGAAGGAGGAAGGG + Intronic
1162622518 19:11855297-11855319 CTGGGTCCATGGAGGGGGGTAGG + Intronic
1162733691 19:12734235-12734257 CGGGGCCCGTGAAGGGGGATCGG - Intronic
1162965414 19:14153362-14153384 CTATGGCCAGAAAGGGGGTTAGG + Intronic
1163131601 19:15276879-15276901 CTCTGGCCATGGACGGGGAGAGG + Intronic
925142480 2:1559502-1559524 CTGTGGCCATGAGTGCGGCTAGG + Intergenic
925178519 2:1801163-1801185 TTGTGGGCATGGAGGGGGTTAGG + Intronic
926956988 2:18312446-18312468 ATGTGGACATGAAAGGGTATGGG - Intronic
927013538 2:18931496-18931518 CTGGGGCCATGGAAGGGGATGGG + Intergenic
928624069 2:33121532-33121554 CTGTAGCCATTAAGGGGTGTTGG - Intronic
929805193 2:45138760-45138782 CTGTGTCCAAGAACGGGGAGGGG + Intergenic
934029029 2:88024975-88024997 CTGTGGCCTAGAAGGGGAAAAGG - Intergenic
936966583 2:118133180-118133202 CTGTGGCTATGCAGGTTGATTGG + Intergenic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
939839034 2:147164958-147164980 CAGTGTCCATGGAGGGGGTTGGG + Intergenic
940031368 2:149265414-149265436 CAGGGGCCAAGAAGGGGGCTAGG + Intergenic
940983973 2:160034589-160034611 CTGAGACCATGATGGGGGAGCGG + Intronic
944183744 2:196926124-196926146 CTCTGGGCATGAGGGGGGCTGGG + Intronic
944656446 2:201880804-201880826 CTGTGGCCAGGAAGGGCTACAGG + Intronic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
948612778 2:239180290-239180312 CTGTGACCATGAAAGGGCTTGGG - Intronic
1168804946 20:666830-666852 CTGGGGCCATGGAAGGGGAAGGG + Intronic
1172050128 20:32110638-32110660 GTGTGGCCATGTTGGGGAATGGG - Intronic
1172271476 20:33657897-33657919 CTGTGGCCCTGGAGGGGCAGTGG - Intronic
1173306988 20:41860194-41860216 CTGTGGCCATGCAGGGTAAGGGG + Intergenic
1174268746 20:49351404-49351426 CTGTGGCCATCAGGGAGGATGGG - Intergenic
1175817788 20:61892626-61892648 CTGTGGCCATGTTGAGGGTTTGG + Intronic
1175948843 20:62571782-62571804 CTGTAGACAGGAAGTGGGATGGG + Intergenic
1176249805 20:64115095-64115117 GTTTGACCATGCAGGGGGATAGG + Intergenic
1176255441 20:64149632-64149654 CTGTCCCCATGAAGGGGACTAGG - Intergenic
1181853338 22:25765588-25765610 CTGAGGCCAAGAAAGGGGAAGGG - Intronic
1183058673 22:35322231-35322253 CTGTTCCCATGCTGGGGGATTGG - Intronic
1183698317 22:39435757-39435779 CTTTGGCCATGAAGAGGGGGTGG + Intronic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1184332048 22:43833479-43833501 CTGTGGGCTGGAAGGGGGCTTGG - Intronic
1184856139 22:47147797-47147819 CAGTGGCCAGGAGGGAGGATGGG + Intronic
1185198878 22:49490253-49490275 CTGTGGAAAGGAAAGGGGATTGG + Intronic
950032399 3:9861681-9861703 CTGTGGCCAGGCAGGGGGCAGGG - Intergenic
950414503 3:12861108-12861130 CTGTGACCATGTAGGGGTACGGG - Intronic
950722956 3:14897916-14897938 CTGCAGCCAGGAATGGGGATGGG - Intronic
952204065 3:31162140-31162162 CTGTGGGCATGAATGTGGAATGG + Intergenic
954392329 3:50274264-50274286 CTGGGAACATGGAGGGGGATGGG - Intronic
959734280 3:109640094-109640116 CTGTGGCCATGTAGGCCAATTGG + Intergenic
963171123 3:142252210-142252232 CCATGGCCATTATGGGGGATGGG - Intergenic
970331191 4:14986118-14986140 CTGAGGCCATGAAAGTGTATGGG - Intergenic
970735121 4:19157023-19157045 CAGTGGCCATGAAGCTGGAGAGG + Intergenic
970988966 4:22191175-22191197 CTGTGGCCCTAAAGGAGGACAGG + Intergenic
971472305 4:27040309-27040331 CTGTGGCCACTATGGGAGATGGG + Intergenic
975265794 4:72365210-72365232 ATGTGGCCATGAAGGAGAACAGG + Intronic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
982325851 4:154127557-154127579 CTGTGGCCCTAAATGGGAATAGG - Intergenic
984591887 4:181626311-181626333 CTGAGGACAGGAAGGTGGATAGG + Intergenic
987846703 5:23296124-23296146 CTGTGGCTATTGTGGGGGATGGG + Intergenic
988889451 5:35599016-35599038 CTGTGGCCACTGAGGGGGAAGGG - Intergenic
989193351 5:38692408-38692430 CTTTGGCCTAGAAGAGGGATTGG - Intergenic
992865725 5:80955314-80955336 CTGTAGCCATCCAGGGGGAGGGG + Intergenic
993531835 5:89034963-89034985 CTGGGGGCATGAATGGGGAGAGG - Intergenic
995986898 5:118187641-118187663 CTGTGGCCATGAGAGGGCACTGG - Intergenic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
999304642 5:150511727-150511749 CTGTGGGGGTGATGGGGGATGGG + Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000152073 5:158513045-158513067 CTGTGGCCATGAAGGGGGCCAGG - Intergenic
1001935082 5:175697902-175697924 CTGTTGCCATGAGGGGTGTTTGG - Intergenic
1002322143 5:178382549-178382571 CTCTGGCCATGGTGGGGTATCGG - Intronic
1002642682 5:180637901-180637923 CTGTGGCCATGAAGGGGGATAGG - Intronic
1003036340 6:2643624-2643646 CTGGGGCCAGGAGAGGGGATCGG + Intergenic
1003538473 6:6997146-6997168 CTGTCGCCATGGAGGGGCATGGG + Intergenic
1004014281 6:11718235-11718257 ATGTGTCCATCAAGGGGCATAGG + Intronic
1005893082 6:30155832-30155854 CTGAGGCCAAGAAGAGGGAAGGG + Intronic
1006558773 6:34890672-34890694 GTGTGGCTTCGAAGGGGGATTGG + Intronic
1006883498 6:37359976-37359998 CTGTGCCATTGAAAGGGGATTGG + Intronic
1007407865 6:41645176-41645198 CTGTGGCAATGAAAGGGTGTAGG - Intronic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1008231221 6:48986787-48986809 CTGTGGCTGTGGTGGGGGATAGG - Intergenic
1008528896 6:52435973-52435995 CTGAGGCCATGTAAGGGGTTAGG - Intronic
1010027811 6:71239976-71239998 CTGTGGCTGTGGTGGGGGATGGG - Intergenic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1012945414 6:105460894-105460916 CTGTGGCCCTAAATGGGAATGGG + Intergenic
1013495568 6:110693718-110693740 CTGTGGCCAGTATGGGGGATGGG - Intronic
1020255843 7:6502873-6502895 CTGTGGACAAGAAGGTGGGTAGG + Intronic
1022691702 7:32662447-32662469 CTGTGTGCATGGAGTGGGATTGG - Intergenic
1022919318 7:34996671-34996693 CTGTGTGCATGGAGTGGGATTGG - Intronic
1023240525 7:38141506-38141528 CCCTGGCCATGAAAGGGAATGGG + Intergenic
1023832549 7:44048303-44048325 TTGTGGCCATCAAGAGGAATGGG + Intronic
1024087993 7:45912624-45912646 CTGTGGCCATGACTGAGGAAAGG - Intronic
1024873940 7:53999520-53999542 CTCTGGCCATGCAGGAGGTTAGG - Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1026897822 7:74020424-74020446 CTGTGACCACCAAGGGGGCTAGG + Intergenic
1027366861 7:77467731-77467753 CTGTGGCCTTGTAAGGGGGTGGG - Intergenic
1031033465 7:116760854-116760876 TTGTGGCCATGTGTGGGGATTGG - Intronic
1031390473 7:121207801-121207823 CTTTGGTCAGGAAGGGGAATGGG + Intronic
1031506632 7:122592824-122592846 CTGGGGCCTTCCAGGGGGATGGG + Intronic
1033335869 7:140451932-140451954 CTGGGGACATGCAGAGGGATGGG - Intergenic
1036153412 8:6319932-6319954 CTGGGCCCATGGAGGGGGATGGG - Intergenic
1036405972 8:8455631-8455653 TTGGAGCCATGAAGGGAGATGGG + Intergenic
1036702584 8:11022961-11022983 CTGTGGCCAGGAAGGGAGGGAGG - Intronic
1037894716 8:22644231-22644253 CTGTGGGCTTAAAGGGGGGTGGG + Intronic
1038232109 8:25710927-25710949 ATTTGGCCATGAAGTGAGATAGG + Intergenic
1038275530 8:26117779-26117801 CTGTTGCTGTGAATGGGGATAGG + Intergenic
1038546953 8:28433140-28433162 CTGTCCCTATGAAGAGGGATGGG + Intronic
1039447846 8:37646840-37646862 CCGTGGCAATGAAGGGAGAGTGG + Intergenic
1040012428 8:42673340-42673362 ATGAGGCCATGAAGGGAGTTTGG - Intergenic
1040060043 8:43096028-43096050 CTGAGGCCATGAAGAGGGAGAGG + Intronic
1040481193 8:47828951-47828973 CTGTGGCCATGAAGTGTGCGAGG - Intronic
1042306643 8:67340408-67340430 ATGTGGCCATTAAGCAGGATGGG - Intronic
1043912504 8:85879209-85879231 CTGAGGACAGGAAGGGTGATAGG - Intergenic
1044841357 8:96339600-96339622 CACTGTCCATGGAGGGGGATGGG + Intergenic
1045584893 8:103523059-103523081 CTGTGGCCAGGAATGATGATGGG + Intronic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047816782 8:128473495-128473517 CTGTGGCACTGAAGTGGAATTGG - Intergenic
1048932536 8:139326411-139326433 TAGTGGCCAGGAAGGGAGATAGG - Intergenic
1049252378 8:141596246-141596268 CTGAGGCCAGGGAGAGGGATGGG - Intergenic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1052159639 9:25241166-25241188 CTGTGGCCAAGAGGGAGGAAAGG + Intergenic
1052626908 9:30986922-30986944 CTTTGACCATGAAGTGGGAGTGG - Intergenic
1052801297 9:32970581-32970603 CTCTGGGCATGAAGAGGGAACGG + Intergenic
1053143944 9:35699348-35699370 CTGAAGCCATGAAGGGTGAGGGG - Exonic
1054916585 9:70500176-70500198 CTGTGGCCATGAAGAGGAACTGG + Intergenic
1055205293 9:73722655-73722677 ATGTTGCCACGAATGGGGATGGG - Intergenic
1055266372 9:74499099-74499121 GTGTGGCCAGGAAGAGGGACTGG - Intronic
1056548535 9:87633266-87633288 ATGTAGGGATGAAGGGGGATGGG + Intronic
1059344527 9:113619337-113619359 CTGTGGCCCAGAAGAGGGAGTGG + Intergenic
1059394841 9:114027878-114027900 CTGAGGGCAGGAAGGGGGCTAGG - Intronic
1060217009 9:121744465-121744487 CCGTGGCAATGAAGGCGGTTAGG - Intronic
1060793347 9:126499931-126499953 CTGTGGCCAGGAGTGGGGACAGG - Intronic
1062107016 9:134761188-134761210 CTGTGTGCATGTGGGGGGATGGG - Intronic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062451237 9:136616643-136616665 CCCTGGCCCTGGAGGGGGATGGG - Intergenic
1062610938 9:137373171-137373193 CTGTGGCCATGTGTGGGCATCGG + Intronic
1188013000 X:25077232-25077254 CTGGGGACAGGAAGGAGGATGGG - Intergenic
1189702030 X:43721587-43721609 CTGTGGCAATGAAGATGGAGAGG + Intronic
1192179512 X:68907610-68907632 CTGAGGCCAGGAAGGGAGAAAGG + Intergenic
1195688564 X:107605744-107605766 CTCTGGCCATGTAGTGGGGTGGG + Intergenic
1198146985 X:133867660-133867682 CTGTGGCCCTGAATGGGGACAGG + Intronic
1198523278 X:137474101-137474123 CTGTGGCACTGAAGGTGGATGGG + Intergenic
1198715991 X:139558317-139558339 CTGTGGCAATCAAGGTGGAGAGG - Intronic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1200077248 X:153557259-153557281 CTGTGGAGAGGAAGGGGAATGGG + Intronic
1201189620 Y:11435896-11435918 CTGTGGACACCACGGGGGATGGG + Intergenic