ID: 1002643578

View in Genome Browser
Species Human (GRCh38)
Location 5:180641906-180641928
Sequence CATGGTTAAGAATAAACTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002643574_1002643578 12 Left 1002643574 5:180641871-180641893 CCCTAGGATGACTGGGAACTACA 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1002643578 5:180641906-180641928 CATGGTTAAGAATAAACTGTCGG No data
1002643575_1002643578 11 Left 1002643575 5:180641872-180641894 CCTAGGATGACTGGGAACTACAG 0: 1
1: 0
2: 2
3: 18
4: 169
Right 1002643578 5:180641906-180641928 CATGGTTAAGAATAAACTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002643578 Original CRISPR CATGGTTAAGAATAAACTGT CGG Intronic