ID: 1002643578 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:180641906-180641928 |
| Sequence | CATGGTTAAGAATAAACTGT CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1002643574_1002643578 | 12 | Left | 1002643574 | 5:180641871-180641893 | CCCTAGGATGACTGGGAACTACA | 0: 1 1: 0 2: 0 3: 5 4: 76 |
||
| Right | 1002643578 | 5:180641906-180641928 | CATGGTTAAGAATAAACTGTCGG | No data | ||||
| 1002643575_1002643578 | 11 | Left | 1002643575 | 5:180641872-180641894 | CCTAGGATGACTGGGAACTACAG | 0: 1 1: 0 2: 2 3: 18 4: 169 |
||
| Right | 1002643578 | 5:180641906-180641928 | CATGGTTAAGAATAAACTGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1002643578 | Original CRISPR | CATGGTTAAGAATAAACTGT CGG | Intronic | ||