ID: 1002644559

View in Genome Browser
Species Human (GRCh38)
Location 5:180646762-180646784
Sequence CAGGCTCCTTCCCTGGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 311}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002644551_1002644559 15 Left 1002644551 5:180646724-180646746 CCCGAACAGGCACTATGCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 125
Right 1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG 0: 1
1: 0
2: 0
3: 30
4: 311
1002644547_1002644559 19 Left 1002644547 5:180646720-180646742 CCACCCCGAACAGGCACTATGCT 0: 1
1: 0
2: 0
3: 9
4: 52
Right 1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG 0: 1
1: 0
2: 0
3: 30
4: 311
1002644543_1002644559 29 Left 1002644543 5:180646710-180646732 CCTCCCTGGGCCACCCCGAACAG 0: 1
1: 0
2: 2
3: 18
4: 199
Right 1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG 0: 1
1: 0
2: 0
3: 30
4: 311
1002644545_1002644559 26 Left 1002644545 5:180646713-180646735 CCCTGGGCCACCCCGAACAGGCA 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG 0: 1
1: 0
2: 0
3: 30
4: 311
1002644549_1002644559 16 Left 1002644549 5:180646723-180646745 CCCCGAACAGGCACTATGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG 0: 1
1: 0
2: 0
3: 30
4: 311
1002644553_1002644559 14 Left 1002644553 5:180646725-180646747 CCGAACAGGCACTATGCTGGGGT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG 0: 1
1: 0
2: 0
3: 30
4: 311
1002644546_1002644559 25 Left 1002644546 5:180646714-180646736 CCTGGGCCACCCCGAACAGGCAC 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG 0: 1
1: 0
2: 0
3: 30
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002644559 Original CRISPR CAGGCTCCTTCCCTGGGTCG GGG Intronic
900314699 1:2050890-2050912 CGGGCTCCTTCCCCGGGACCGGG + Intronic
900458160 1:2787288-2787310 CAGTCTCCTTATCTGGGTCCTGG - Intronic
900830533 1:4962130-4962152 CAGGCTGCTTCCCAGGTTCAAGG - Intergenic
901680107 1:10908112-10908134 CAGCCTTCTTCCCTGGCACGTGG - Intergenic
901762292 1:11479079-11479101 CGGGCTCCTACCACGGGTCGCGG - Intergenic
902183139 1:14704828-14704850 CTGGCTCCTTCCCTGTGTTGTGG + Intronic
902454289 1:16521000-16521022 CAGGCTCCTTCAATGGGTGAAGG - Intergenic
902660456 1:17897205-17897227 CCTGCTTCTTCCCTGGGTCAAGG + Intergenic
903190926 1:21655639-21655661 CAGGCTGCTTTCCAGGGTCCAGG + Intronic
903461018 1:23521147-23521169 GAGGGTGCTTCCCTGGGTTGTGG + Intronic
903849470 1:26297367-26297389 CAGGCACCTCCCCTGGGCCCAGG - Intronic
903997707 1:27318069-27318091 CAGGCTCTTTCCCTGGATTGAGG + Intergenic
905009342 1:34736667-34736689 GAGGCTCCTTCCCAGGGGTGGGG + Intronic
905361647 1:37424905-37424927 CTGTCTCCTGCCCTGGGTCTTGG - Intergenic
905694279 1:39963302-39963324 CAGTCTCCTTCCAGAGGTCGGGG - Intronic
906325717 1:44844025-44844047 CAGTCTCCTTCCAGAGGTCGGGG + Intergenic
906366139 1:45211427-45211449 CAACCTCCTTTTCTGGGTCGAGG - Intronic
906455667 1:45994734-45994756 CAGGCTCCTTCCCAGGAACTGGG + Intronic
906606976 1:47179615-47179637 CCTGCTCCTGCCCTGGGTCTGGG - Intergenic
906950015 1:50326887-50326909 CAGTCTCCTTCCAGAGGTCGGGG - Intergenic
907039967 1:51250702-51250724 CAGTCTCCTTCCAGAGGTCGGGG + Intronic
907686772 1:56619513-56619535 CAGTCTCCTTCCAGAGGTCGGGG + Intronic
908356864 1:63330427-63330449 CATGCTCCTTCCCGGGGTCCAGG + Intergenic
913655080 1:120952664-120952686 CAGGCTCCTTCACTGGGTGAAGG - Intergenic
914004117 1:143717687-143717709 CAGGCTCCCTCACTGGGTGAAGG - Intergenic
914006433 1:143736337-143736359 CAGGCTCCTTCACTGGGTGAAGG - Intergenic
914082104 1:144418902-144418924 CAGGCTCCCTCACTGGGTGAAGG + Intergenic
914095339 1:144540035-144540057 CAGGCTGCCTCACTGGGTCAAGG - Intergenic
914099001 1:144567929-144567951 CAGGCTCCCTCACTGGGTGAAGG - Intergenic
914177007 1:145287402-145287424 CAGGCTCCCTCACTGGGTGAAGG + Intergenic
914199948 1:145475798-145475820 CAGGCTCCCTCACTGGGTGAAGG - Intergenic
914299984 1:146369737-146369759 CAGGCTCCCTCACTGGGTGAAGG + Intergenic
914303187 1:146393861-146393883 CAGGCTGCCTCACTGGGTCAAGG + Intergenic
914313382 1:146486988-146487010 CAGGCTCCCTCACTGGGTGAAGG - Intergenic
914479068 1:148048933-148048955 CAGGCTCCCTCACTGGGTGAAGG - Intergenic
914500968 1:148246393-148246415 CAGGCTCCCTCACTGGGTGAAGG + Intergenic
914516541 1:148379312-148379334 CAGGCTCCCTCACTGGGTGAAGG - Intergenic
914531735 1:148528894-148528916 CAGGCTCCCTCACTGGGTGAAGG + Intergenic
914636655 1:149558835-149558857 CAGGCTCCCTCACTGGGTGAAGG - Intergenic
914645265 1:149646824-149646846 CAGGCTCCTTCACTGGGTGAAGG - Intergenic
915089660 1:153415695-153415717 CAGGCTCATTCCATGGGGCGGGG + Intergenic
915304742 1:154970781-154970803 CTGGCTCCTCCCCAGGGGCGGGG + Intronic
916943845 1:169704168-169704190 CAGTTTCCTTCCCAGGGTAGTGG - Intronic
917234553 1:172876856-172876878 TATGCTCATTCCCTGGGTGGTGG - Intergenic
917647272 1:177041483-177041505 CAGGCTCCCTCCATGGGCTGTGG + Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
917980646 1:180266891-180266913 TGGCCTCCTTCCCTGGGTGGAGG + Intronic
918214063 1:182377688-182377710 CAGGTTCCTTCCCAGAGTCCAGG + Intergenic
918532321 1:185537383-185537405 CAAGCTCCATCCCTGGATCTTGG - Intergenic
919935500 1:202248120-202248142 CAGGCTCCTTCCCTGGCCACCGG + Intronic
920115954 1:203621896-203621918 CAGGCTTCTTCCATGGGGCAGGG + Intergenic
920762119 1:208794492-208794514 CAGCTTCCTTCACTGGGTGGAGG - Intergenic
921623228 1:217349510-217349532 AACCATCCTTCCCTGGGTCGGGG - Intergenic
923139245 1:231147352-231147374 CAGCCTCCATCCCTGGGTCAGGG + Intergenic
923162448 1:231327495-231327517 CAGCCTCCTCCCCTGGGTTCGGG + Intergenic
923688074 1:236167808-236167830 CAGCCTCCTTGTCTGGGGCGTGG + Intronic
1066059012 10:31706081-31706103 CAGGATCTTTCCCTGTCTCGGGG + Intergenic
1066534306 10:36373703-36373725 CAGGCTCCTTGCCTGCCCCGGGG - Intergenic
1067415376 10:46098121-46098143 CTGCCTCCTTCCCTGGGAGGTGG - Intergenic
1067435417 10:46273198-46273220 CTGCCTCCTTCCCTGGGAGGTGG - Intergenic
1067582215 10:47452888-47452910 CTGCCTCCTTCCCTGGGAGGTGG - Intergenic
1067824959 10:49564333-49564355 CAGGCTCCTTCCATGGGTAAAGG + Intergenic
1068953762 10:62804339-62804361 CAGCCTCCTTCCCAGGGGCAAGG + Intergenic
1069582519 10:69575318-69575340 CAGGCTCCTTCCCTTGCTGTGGG + Intergenic
1070481805 10:76890197-76890219 CAGCCACCTTCCCGGGGTCTGGG + Intronic
1071499849 10:86195600-86195622 CAGCCTCCTACCCTGGCTGGGGG + Intronic
1071566433 10:86673690-86673712 CAGGCTGCCTGCCTGGGTTGGGG - Intronic
1073581761 10:104674291-104674313 CAGACTCCTCCCCTGGGGTGTGG + Intronic
1073630935 10:105148508-105148530 CAAGTTCCTTCACTGGGTCCAGG - Intronic
1074917255 10:117969351-117969373 CAGGCACATTCCCTGAGTTGCGG - Intergenic
1075393998 10:122113578-122113600 CAGGCTCCCTGCCAGGGTTGGGG + Intronic
1075939023 10:126372364-126372386 CAGCCTACCTCCCTGGGTTGTGG - Intronic
1076352241 10:129825253-129825275 AAGGCTGCCTCCCTGGGCCGGGG + Intergenic
1076535330 10:131173552-131173574 CAGGCACCTTCCCAGGGGCAGGG - Intronic
1076653446 10:132005598-132005620 GAGCCTCCTTCCCTGGGAGGGGG + Intergenic
1076654874 10:132017679-132017701 GGGGCTCCTTCCCTGGGAGGGGG + Intergenic
1076654896 10:132017747-132017769 GGGGCTCCTTCCCTGGGAGGGGG + Intergenic
1076654961 10:132017951-132017973 GGGGCTCCTTCCCTGGGTGGGGG + Intergenic
1077308630 11:1878762-1878784 TGGGCTCCCTCCCTGGGTCTGGG + Intronic
1077418383 11:2436542-2436564 CAGGCTGCTGCCCTGGGCAGGGG + Intergenic
1077425179 11:2472735-2472757 CAGGCTCCTTCCCTGTCTAGGGG + Intronic
1083603916 11:63965670-63965692 CAGGCCCCTTGCCTGTGTTGGGG + Intergenic
1083803031 11:65057787-65057809 GAGGCACGTTCCCTGGGTCAGGG + Intronic
1084174775 11:67417507-67417529 CAGGCTGCTTCCCTGGCTCCTGG + Exonic
1084332606 11:68438672-68438694 CAGGCTCCTTACCTGTGAAGGGG - Exonic
1084482500 11:69430074-69430096 CAGGCTCCTTCCCAGGCTTTCGG + Intergenic
1084760525 11:71267900-71267922 CAGGGGCCTGCCCTGGGTGGTGG - Intergenic
1085475097 11:76784185-76784207 CAGGCTCCGGCCCTGGGCTGGGG + Intronic
1085503356 11:77041478-77041500 CAGGCTCCTTGCCGGGGTCTGGG + Exonic
1085566564 11:77519980-77520002 CAGGCTCCTCCCCTGGCCTGTGG + Intronic
1087252868 11:95923709-95923731 CTGCCTCCCTCCCTGGGGCGTGG - Intronic
1088988475 11:114929772-114929794 CAGTCTCCTCCCCAGGGTCAGGG - Intergenic
1089144144 11:116312126-116312148 CCGGCTCCTTCACTGGGCCGTGG + Intergenic
1089456702 11:118629953-118629975 CAGGCTGCTTATCTGGGTCCTGG + Intronic
1089587900 11:119521665-119521687 TGGGCTCCTTCCCTAGGTCCAGG + Intergenic
1089967805 11:122667946-122667968 CAGGCTACTTCTCTGAGTCCAGG + Intronic
1090963911 11:131581725-131581747 CAGTCTCCTGCCCTGGGCCCAGG - Intronic
1091241133 11:134053190-134053212 CAGGCTCCTTCCCAGCTGCGAGG + Intergenic
1096604582 12:52755381-52755403 CAGGCTCCTGTCCTGGGTTTGGG - Intergenic
1096648506 12:53050597-53050619 CAGGCCCCTTCCCTGGCCCAGGG + Intronic
1101742493 12:107511554-107511576 CAGGCTTCTTCTCTTGGTGGCGG + Intronic
1102002434 12:109565863-109565885 CAGGGTCCTGACCTGTGTCGGGG - Intronic
1102375685 12:112419219-112419241 CGGGCTCCCGCCCCGGGTCGGGG + Intronic
1102551670 12:113696047-113696069 CAGGTTACCTCCCGGGGTCGAGG + Intergenic
1102977646 12:117218018-117218040 CTGGCTCCATCCCTGGGTGAGGG - Intronic
1103107977 12:118246839-118246861 CAGTCTCCTTCCAGAGGTCGGGG - Intronic
1107964957 13:45589714-45589736 CAGGCCCCTTCACTGTGTCTGGG + Intronic
1110351096 13:74508533-74508555 CACGCTCCTTCCATTGGACGAGG + Intergenic
1111932418 13:94525475-94525497 CAGGCTCCATCCCTTGGTGTAGG + Intergenic
1112890367 13:104222143-104222165 CAGGCTCCTTCACAGGGTGAAGG + Intergenic
1114031607 14:18584518-18584540 CTGGCTCCTCCTGTGGGTCGTGG + Intergenic
1117315879 14:54569580-54569602 CAGCCTCCTTCACTGGGGTGTGG + Intronic
1118288730 14:64502040-64502062 CAGGCTCATTACCTGGGCTGTGG - Intronic
1118852103 14:69591988-69592010 CTGGCTCTTTCACTGGGTCCAGG - Intergenic
1119403096 14:74377827-74377849 CAGTCTCCTTCCAGAGGTCGGGG + Intergenic
1119479193 14:74949260-74949282 CAGGCTCCAGCCCTGGGACCTGG + Intronic
1121312089 14:92940810-92940832 CAGCCTCCTTCCCGGGCTCCAGG + Exonic
1122347150 14:101067621-101067643 CAGGCCCCTTCCCTTGGGCTTGG + Intergenic
1122771596 14:104100175-104100197 CAGGGTCCTTGCCTGTGTCTGGG - Intronic
1122871787 14:104642110-104642132 TGGACTCCTCCCCTGGGTCGAGG - Intergenic
1123069656 14:105636251-105636273 TAGGCTCCTTCCCTGTGGAGGGG + Intergenic
1123088749 14:105732034-105732056 TAGGCTCCTTCCCTGTGGAGGGG + Intergenic
1123119503 14:105910187-105910209 CTGGCTCCTTCTCTGGGTAGAGG + Intergenic
1123739442 15:23222254-23222276 CAGACTCTTTCCCTTGGTCCGGG + Intergenic
1123758366 15:23414473-23414495 CAGGCTCCTTCTCAGGCTTGGGG + Intergenic
1124034956 15:26046405-26046427 CAGGCTCCTTCCCTGGAGGATGG + Intergenic
1124249624 15:28098355-28098377 CAGGCCCCGTCCCAGGGTCCTGG + Intronic
1124290662 15:28451214-28451236 CAGACTCTTTCCCTTGGTCCGGG + Intergenic
1124292574 15:28466344-28466366 CAGACTCTTTCCCTTGGTCCGGG - Intergenic
1124997734 15:34740101-34740123 CAGGCTCCTTCTCTGTGCCTGGG - Intergenic
1127271250 15:57403835-57403857 CTGGCTTCTTCCCTGGATCTAGG + Intronic
1127286469 15:57538016-57538038 CTGGCACCTGCCCTGGGGCGGGG - Intronic
1127486656 15:59424292-59424314 CAGTCTCCTTCCTTGGTTCTTGG + Intronic
1128654771 15:69452720-69452742 CAGGCGCCTTCAGTGGGTCCTGG + Intergenic
1129171787 15:73812381-73812403 CAGGCTCTTTCCCAGGGCTGGGG - Intergenic
1132632903 16:928525-928547 CAGAACCCTTCCCTGGGTCCTGG + Intronic
1132837599 16:1962202-1962224 CAGTCTCCTTCCAGAGGTCGGGG + Exonic
1134414211 16:14029882-14029904 CAGGCTCATTCCCTGGAACTGGG + Intergenic
1135401459 16:22169186-22169208 CAACCTCCTCCCCTGGGTGGTGG - Intronic
1136045448 16:27611557-27611579 CTGTCTCCTTCCCTGTGTCATGG + Intronic
1136708085 16:32206441-32206463 CAGACTCTTTCCCTTGGTCGGGG - Intergenic
1136759823 16:32722973-32722995 CAGACTCTTTCCCTTGGTCGGGG + Intergenic
1136776017 16:32872313-32872335 CAGGCTCATTCCATGGTTTGGGG + Intergenic
1136808281 16:33147413-33147435 CAGACTCTTTCCCTTGGTCGGGG - Intergenic
1136894598 16:33989199-33989221 CAGGCTCATTCCATGGTTTGGGG - Intergenic
1137700412 16:50493920-50493942 CAGGCTCCATCCCTGGCTTCTGG - Intergenic
1138418002 16:56882311-56882333 CACCCTCCTTCCCAGGGTGGGGG - Intronic
1138483335 16:57318584-57318606 CAGCCTCCTGCCCTGGTTTGGGG + Intergenic
1138510794 16:57507549-57507571 CAGGCCCCCTCCCTGGGATGGGG + Intergenic
1139673167 16:68505463-68505485 CAGGGTCCTTGCCTGTCTCGTGG - Intergenic
1139692673 16:68651065-68651087 CAGGGGCCTTCCCTGGGCCTGGG + Intronic
1139966158 16:70746566-70746588 CCGGCTCCTGGCCTGGGTGGAGG - Intronic
1140759624 16:78099436-78099458 CACGCCCCTTCCCTGCGGCGGGG + Exonic
1141431584 16:83973021-83973043 CTGCCTCCTTCCCTGGGTTTTGG + Intronic
1141644454 16:85359790-85359812 CAGGCTGCTTCCCTGAGTGCTGG + Intergenic
1141808461 16:86357939-86357961 CAGGCTCATTCCCTGGCTTCTGG - Intergenic
1142028528 16:87827097-87827119 CAGGAACCTTCCCGGGGTGGGGG + Intergenic
1142436149 16:90058895-90058917 CATGCTCCCTCCCTGGGCCCTGG + Intronic
1203061978 16_KI270728v1_random:983290-983312 CAGACTCTTTCCCTTGGTCGGGG + Intergenic
1203078433 16_KI270728v1_random:1134422-1134444 CAGGCTCATTCCATGGTTTGGGG + Intergenic
1143514827 17:7414348-7414370 CAGGCTTCTTCCCAGGGTCACGG - Exonic
1144186026 17:12795782-12795804 CAGGCCTCTTCCCTCGGGCGTGG + Intronic
1144431723 17:15198653-15198675 CAGCCTCCTTCCCAGGGGTGTGG - Intergenic
1145022883 17:19446074-19446096 CAGTCTCCTTCCAGAGGTCGGGG + Intergenic
1145999823 17:29124503-29124525 CAGGCTCCCACCCTGTGTCTGGG - Intronic
1146668384 17:34720044-34720066 CAGACTCCTACCCTGGCTCTGGG - Intergenic
1146899582 17:36574563-36574585 CAGTCTCCTTCCAGAGGTCGGGG + Intronic
1146937429 17:36820977-36820999 CAGGCTCCCTTCCTGGGACAGGG + Intergenic
1146978818 17:37140712-37140734 CAGTCTCCTTCCAGAGGTCGGGG + Intronic
1147668927 17:42165643-42165665 CAGGCTCCTGCCCCGGCTCAGGG + Exonic
1148156907 17:45429875-45429897 CAGGCTGCTGCGCTGGGTCGCGG + Intronic
1148391959 17:47279221-47279243 CAGGCCCTTCCCCTGGGTCTTGG + Intronic
1148717066 17:49723413-49723435 CAGCTTCCTCCCTTGGGTCGGGG - Intronic
1148864466 17:50621316-50621338 CCCGCTCCCTCCCTGGGTGGTGG + Intronic
1149166252 17:53757093-53757115 CAGTCTCCTTCCAGAGGTCGGGG + Intergenic
1150388611 17:64778649-64778671 CAGGCTGCTGCGCTGGCTCGCGG + Intergenic
1150790854 17:68199341-68199363 CAGGCTGCTGCGCTGGGTCGCGG - Intergenic
1151987452 17:77553205-77553227 CTGACTCCATCCCTGGGTCCAGG - Intergenic
1152235642 17:79136931-79136953 GAGGCTCCATCCCAGGGGCGTGG + Intronic
1152321222 17:79609789-79609811 CAGCCTCCCTCCCCGGGACGCGG - Intergenic
1153926965 18:9842870-9842892 CAGACTCCTTCCATGGCTAGAGG - Intronic
1156162338 18:34374396-34374418 CAGGTTCCTTCCATGGGCAGAGG + Intergenic
1156540517 18:37905281-37905303 CAGTCTCCTTCCCTGAGCTGAGG + Intergenic
1157539280 18:48488144-48488166 CAGGTTGCTCCCCTGGGTCAGGG + Intergenic
1159601325 18:70430998-70431020 CAGGCTCCTTCCAAAGGTCGGGG - Intergenic
1159955166 18:74513786-74513808 CTGTCACCTTCCCTGGGTCCAGG + Intronic
1159955581 18:74516283-74516305 AAGGCGCCTTCTCTGGGTCTGGG + Exonic
1159993589 18:74940334-74940356 CACGCCCCTTCCCTGGGCAGGGG - Intronic
1160004945 18:75062842-75062864 CAGCCTCCTTCCCTGGGCATTGG + Intronic
1160696083 19:485124-485146 CAGGGTCCTCCGCTGGGTTGAGG - Intergenic
1161270692 19:3387846-3387868 CAGGCTCCTTCCCCAGCACGTGG - Intronic
1161280514 19:3443069-3443091 CTGGCTCGTTCCCTGGGGAGGGG - Intronic
1162109711 19:8393459-8393481 CAGGCCCCTTCCCTGGGGACAGG - Intronic
1163032253 19:14552446-14552468 CAGGCTACTTACCTTGGGCGAGG + Intronic
1163410571 19:17151411-17151433 CAGGTACCTTCTCTGGGTCTGGG - Intronic
1165326155 19:35115640-35115662 CAGGCTCTTTCCGTGGGTGCTGG - Intergenic
1166054531 19:40280466-40280488 CAGGCTCCTGCCTGGGGGCGTGG - Intronic
1167432997 19:49464067-49464089 TAGGCTCCTTCCCTGGTGGGTGG + Intronic
1167772327 19:51529136-51529158 CATGCTCCTTCCCTGGCTTCTGG - Intronic
1167982161 19:53284291-53284313 CAGGCGCTTGCCCTGGGTCCTGG + Intergenic
1167983983 19:53299682-53299704 CAGGCGCTTGCCCTGGGTCCTGG - Intergenic
926094780 2:10073966-10073988 CCCGCTCCTCCCCCGGGTCGAGG + Intronic
926756481 2:16240467-16240489 CAGGCAGCTTCCCTGAGTCTTGG - Intergenic
927123360 2:19989891-19989913 CAGGCTCCTTCACCCGGTCCTGG - Intronic
927282389 2:21320706-21320728 CAGCCTGCTTCCCTAGGTTGCGG - Intergenic
927490660 2:23518971-23518993 CAGCCTCTTTCCCTGGGTTAAGG - Intronic
927889564 2:26739857-26739879 CAGCCTCCTCCCCTGGGCCAGGG - Intergenic
928305241 2:30164623-30164645 CAACCTCCTCTCCTGGGTCGGGG - Intergenic
930324896 2:49903109-49903131 CAGGCCTCATCCCTGGGTCTTGG - Intergenic
933659618 2:84916539-84916561 CAGTCTCCTTCCAGAGGTCGGGG - Intergenic
933851240 2:86368391-86368413 CAGGGTCCTTCTCTGGGACAGGG - Intergenic
935354613 2:102187246-102187268 CCGACTCCGTCTCTGGGTCGAGG + Intronic
935984693 2:108661414-108661436 CTGACTCCTTCCCTGGGCAGTGG + Intronic
936137128 2:109905065-109905087 CTGACTCCTTCCCTGGGCAGTGG + Intergenic
936207569 2:110466420-110466442 CTGACTCCTTCCCTGGGCAGTGG - Intronic
938496591 2:131801275-131801297 CTGGCTCCTCCTGTGGGTCGTGG - Intronic
941700478 2:168599189-168599211 TAGGCTGCTTCTCTGGGTGGAGG + Intronic
942116898 2:172736332-172736354 CAGGCTCCGCTCCTGGGTGGGGG + Intronic
944660973 2:201921162-201921184 CAGGCTCCCTCCAGGGGTCTGGG - Intergenic
948034368 2:234846459-234846481 CAGGCTCCTGCCCAGGGTGTGGG - Intergenic
948255815 2:236567635-236567657 CAGGCTCCCACCCTGGGAGGAGG - Intergenic
948258295 2:236584316-236584338 CAGGGTCCTTCCCTGGAGCCAGG + Intergenic
1168890995 20:1295325-1295347 TAGGCTTCTTTCCTGGGTAGAGG - Intronic
1168956962 20:1841166-1841188 GATGCTGCTTCCTTGGGTCGGGG - Intergenic
1169080931 20:2797394-2797416 TGAGCTCCTTCCCTGGGTCCTGG - Intronic
1170161982 20:13322627-13322649 CTGGGTCCCTCCCTGGGTCTTGG - Intergenic
1172224662 20:33297385-33297407 CAGGTTCCATCCATGGGTTGAGG - Intronic
1173741535 20:45405923-45405945 CTGGCTCCTTGCCGGCGTCGGGG + Intronic
1173768889 20:45640593-45640615 CAGTCTCCTTCCAGAGGTCGGGG + Intergenic
1173827342 20:46056412-46056434 CAGGCTCCTCCCCTGGGGACGGG - Exonic
1174204516 20:48828607-48828629 CATGTTCCTTCCCAAGGTCGTGG - Intergenic
1175008732 20:55712719-55712741 CATGCAGCTTCCCTGGGTCATGG + Intergenic
1175874796 20:62224260-62224282 CACGCTCCTTCCCTGAGCCCTGG - Intergenic
1176113449 20:63421092-63421114 CATGCTCTTTCCCTGGGGTGGGG - Intronic
1177877960 21:26657809-26657831 CAGGCTCCCTCCCTGAGTGTTGG + Intergenic
1179230612 21:39500583-39500605 CAGGCTCCTTCCTTGGCGCCTGG - Intronic
1179396796 21:41047384-41047406 CAGCCTCCTTCACTGGGCTGTGG - Intergenic
1179568498 21:42263970-42263992 CAGGCTCCATTCCAGGTTCGCGG + Intronic
1179714078 21:43278891-43278913 CACGCTGCTTTCCTGGGTGGGGG - Intergenic
1180455719 22:15511575-15511597 CTGGCTCCTCCTGTGGGTCGTGG + Intergenic
1180913628 22:19470324-19470346 CAGGGTCCTTCCCAAGGTCTGGG - Intronic
1182735388 22:32529330-32529352 CTGGCCCCCTCCCAGGGTCGGGG + Intronic
1183186512 22:36294553-36294575 CAGCCTTCTGCCCTGGGTAGAGG + Intronic
1183708080 22:39487284-39487306 CAGGCTCCTTTCCTAGGAAGGGG - Intronic
1184089039 22:42282918-42282940 CGGGCTCCCTCCGTGGGTCTGGG + Intronic
1184201786 22:42974503-42974525 CAGGCTTCTTGTCTGGGTAGAGG + Intronic
951303564 3:21028570-21028592 CAGGCTCCTTCCCTGCATACGGG + Intergenic
954806247 3:53222546-53222568 CAGGCTCCTTCCCCTGCTCAGGG - Intergenic
954808749 3:53235234-53235256 CAGGCTCCTTGGATGGGTGGGGG - Intronic
957934178 3:86921165-86921187 CAGGCTCCTCCCATGGGAAGTGG - Intergenic
961402016 3:126654520-126654542 CAGGGTCCTAACCCGGGTCGAGG + Intronic
961594420 3:128005824-128005846 CAGGCTCCTTCCCAGGGAGTGGG + Intergenic
962253199 3:133852042-133852064 CACGCTCATTCCCTGTGACGAGG - Intronic
964443405 3:156735823-156735845 CAGACTCTATCCCTGGGTTGGGG - Intergenic
964636887 3:158867526-158867548 CTGTCTCTTTCCCTGGGTCAAGG + Intergenic
965329339 3:167351508-167351530 CTTACTCCTTCCCTGGGTCCAGG - Intronic
968090647 3:195896286-195896308 AGGGCACCTTCCCTGGGTTGGGG + Intronic
968262950 3:197339850-197339872 CAGTCTCCTTTCCTGGGAGGTGG + Intergenic
968377246 4:53704-53726 CCCGCACCTTCCCTGGGCCGCGG + Intronic
968680486 4:1915585-1915607 CTGGATGCTTCCCTGGGTCCAGG + Intronic
970272975 4:14367233-14367255 AAGGCTCATTCCTTGGGTCATGG + Intergenic
976388208 4:84483412-84483434 CAGGCTCCGTCCCTGGGACCCGG - Intergenic
976729092 4:88244513-88244535 CAGGTTCCTTCCGTGGGAAGGGG + Intergenic
980311022 4:131128865-131128887 CAGGCCCCTTCCCTGAGATGTGG + Intergenic
985622392 5:962452-962474 CAGGCTCCTTCCCTGGCATCTGG - Intergenic
985671187 5:1207417-1207439 CAGGCCCCTTCTCTGGGTGCTGG + Intronic
986444866 5:7812544-7812566 CAGCCTGCATCCCTGGGTCTTGG - Intronic
992358216 5:76007949-76007971 AAGGATCCTTGCCTGGGTCAAGG + Intergenic
994714431 5:103304846-103304868 CAGCCTCCATCCCTGGCTCCAGG - Intergenic
995372928 5:111439787-111439809 CAGCCTCCTTCCCTGGCTCCAGG - Intronic
999290475 5:150422243-150422265 AAGGCTCCTTCCCTGGGCGGTGG - Intergenic
999735032 5:154506549-154506571 CAGGCTCCGCCCCTGGGACTGGG - Intergenic
1001133089 5:169080433-169080455 CAGACTCCTTGCCTTGGCCGTGG - Intronic
1001639481 5:173234765-173234787 TAGGGTCCTTGGCTGGGTCGGGG + Exonic
1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG + Intronic
1002691812 5:181055149-181055171 CAGGCCTCTTCCCAGGGTTGGGG - Intronic
1006150312 6:31983504-31983526 CAGCCTGCTTCCCTGGGAAGAGG - Intronic
1006156613 6:32016242-32016264 CAGCCTGCTTCCCTGGGAAGAGG - Intronic
1006379403 6:33688823-33688845 CATGCTTCCTCCCTGGGTTGGGG + Intronic
1007533493 6:42564064-42564086 CTGTGTCCTTCCCTGGGTCAGGG + Exonic
1007669343 6:43538926-43538948 CAGTCTCCTTCCAGAGGTCGGGG + Intronic
1008975058 6:57416509-57416531 CAGGCTCATTCCCTTGTTAGGGG - Intronic
1009490122 6:64279728-64279750 CAGGCTGCTTCTCTGTGTGGTGG - Intronic
1011719535 6:90141189-90141211 AAGACTCCATCCCTGGGTGGGGG - Intronic
1015859945 6:137665353-137665375 GAGGCTGCTTCACTGGGTCAAGG + Intergenic
1017299264 6:152836375-152836397 CAGGTTCCTTCCTTGACTCGCGG + Intergenic
1018148883 6:160920340-160920362 CACACTCCTTCCCTGGCTGGAGG + Intergenic
1019061207 6:169259487-169259509 CAGGATCCTTCCCTGGAGAGGGG + Intergenic
1019269500 7:139187-139209 CAGGCCCCTCCTCTGGGTCTTGG - Intergenic
1019594481 7:1852094-1852116 CTGGGTCCTGCCCTGGGTCTCGG - Intronic
1019820415 7:3238841-3238863 CAGAGTCCTTCCCTGGGGCTGGG + Intergenic
1019998477 7:4740762-4740784 CACGCACCTTCCCTGGGTGTTGG + Intronic
1023040610 7:36169740-36169762 CAGGCTCCTTCCCAGATGCGGGG - Intronic
1023113834 7:36841072-36841094 CATCCTCCTTCCCTGGCTTGAGG - Intergenic
1023700578 7:42888542-42888564 CCGGCTCCTTGCCTGCGGCGCGG + Intergenic
1026228795 7:68465687-68465709 CTGGCTCCTTCCATGAGTGGGGG - Intergenic
1026905533 7:74060760-74060782 CCTGCTCCTTCCCTGGTTGGAGG - Intronic
1027814078 7:82946600-82946622 CAGACTCGTGCCCTGGGTGGGGG + Intronic
1028412078 7:90540701-90540723 CAGGCTACTTGCTTGGGTTGTGG - Intronic
1029302754 7:99598217-99598239 TGGGCTCCTCCCCCGGGTCGGGG + Intronic
1032549360 7:132770317-132770339 CAGGATTCATCCCTGGGTCTGGG + Intergenic
1033998617 7:147385176-147385198 CAGATTCCTTCCCTGACTCGTGG + Intronic
1034383968 7:150722527-150722549 AAGGATCCTTCCCTGGCTCGAGG - Exonic
1034404837 7:150896433-150896455 AAGGCTCCTACCCTGGGGAGGGG - Intergenic
1034832839 7:154324600-154324622 CAGGCTCCATGTCTGGGTTGGGG + Intronic
1035238955 7:157517658-157517680 CAGGCTTCCTCCCTGGGGTGTGG + Intergenic
1035751646 8:2001219-2001241 CGGGCTCAGTCCCTGGGTAGAGG - Exonic
1037471416 8:19215155-19215177 CAGCCTCCTTCCCACGGTGGTGG - Intergenic
1037723795 8:21466893-21466915 CAGGATCCTTCCCCAGCTCGAGG + Intergenic
1040323116 8:46328399-46328421 CAGGGGCGTTCCCTGGGTCAGGG - Intergenic
1040548350 8:48419671-48419693 CAGGCTCCGGCCCAAGGTCGAGG + Intergenic
1041779685 8:61564047-61564069 CAGTCACCTTCCCAGGGCCGAGG + Intronic
1042218831 8:66453418-66453440 CAGGCTTCTTCCCTGGGGCAAGG + Intronic
1044971426 8:97624307-97624329 CAGTCTCCTTCCAGAGGTCGGGG + Intergenic
1046632829 8:116638716-116638738 CAGGCTCATTCCTTGAGTAGAGG - Intergenic
1047213672 8:122859677-122859699 CAGGCTCCTCACCTGTGTCAGGG - Intronic
1048956626 8:139542869-139542891 CAAGCCCCTGCCCTGGGTCTGGG - Intergenic
1049213252 8:141396285-141396307 TAGGGTCCTTCCCTGGCTCTAGG - Intronic
1049674377 8:143883260-143883282 CTGGCCCCTTCCCTGTGGCGTGG - Intergenic
1050525274 9:6541167-6541189 CAGGCTTCTTCTCTAGGTCCAGG + Intronic
1052249780 9:26384238-26384260 CAGGCTCCTTCCCTGTCTTTGGG - Intergenic
1055998186 9:82184781-82184803 CAGGCCACTTCCTTGGGTAGTGG + Intergenic
1056715115 9:89022166-89022188 CAGGTTCCTGCCCTGGGTCTTGG - Intronic
1056725093 9:89107322-89107344 TGGGCTCCTTTCCTGGGTTGTGG + Intronic
1059550246 9:115221960-115221982 CAGGCTGCTACCCTGGGTGAGGG + Intronic
1059677030 9:116549476-116549498 CAGGCTCCAGCCCTGGGCCTGGG - Intronic
1060153271 9:121301995-121302017 CAGGCTCCTTCCCTGCCTTGAGG - Exonic
1060220830 9:121763296-121763318 TAGGCTCCTACCCTGGCTGGGGG + Intronic
1060597218 9:124855835-124855857 CAGGCACCAGCCCGGGGTCGGGG - Intronic
1061940750 9:133882588-133882610 CACGCTCCTTCCAGAGGTCGCGG - Intronic
1062176913 9:135168471-135168493 CAGGGCCCTTCCCTGGGCTGAGG - Intergenic
1203571990 Un_KI270744v1:140542-140564 CCCGCACCTTCCCTGGGCCGTGG - Intergenic
1185877747 X:3713727-3713749 CCGGCTCCTGGGCTGGGTCGGGG - Intergenic
1185894294 X:3843985-3844007 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1185899413 X:3882409-3882431 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1185904530 X:3920838-3920860 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1189429596 X:40935086-40935108 CAGTCTCCTTCCAGAGGTCGGGG + Intergenic
1191006694 X:55717602-55717624 CAGGCTCCGCCCCTCGGGCGGGG - Intergenic
1192264673 X:69530275-69530297 CAGCCTCCTTCCCTGGGGTCAGG - Exonic
1194010522 X:88554947-88554969 CATGCTCATTACCTGGGTCATGG - Intergenic
1196684192 X:118496348-118496370 GAGGCTCCCACCCAGGGTCGGGG + Intronic
1198660783 X:138965741-138965763 CAGGATCCTTCCATGTGTGGTGG + Intronic