ID: 1002648481

View in Genome Browser
Species Human (GRCh38)
Location 5:180674069-180674091
Sequence GGGCGCGCCTGGGCCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002648459_1002648481 25 Left 1002648459 5:180674021-180674043 CCCCGCGCCCCTCTGGCTCCTGT No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648463_1002648481 18 Left 1002648463 5:180674028-180674050 CCCCTCTGGCTCCTGTTCCCGGG No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648474_1002648481 0 Left 1002648474 5:180674046-180674068 CCGGGCGCGGGGAGAAGGCGGCG No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648465_1002648481 17 Left 1002648465 5:180674029-180674051 CCCTCTGGCTCCTGTTCCCGGGC No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648461_1002648481 23 Left 1002648461 5:180674023-180674045 CCGCGCCCCTCTGGCTCCTGTTC No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648466_1002648481 16 Left 1002648466 5:180674030-180674052 CCTCTGGCTCCTGTTCCCGGGCG No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648470_1002648481 7 Left 1002648470 5:180674039-180674061 CCTGTTCCCGGGCGCGGGGAGAA No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648460_1002648481 24 Left 1002648460 5:180674022-180674044 CCCGCGCCCCTCTGGCTCCTGTT No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data
1002648473_1002648481 1 Left 1002648473 5:180674045-180674067 CCCGGGCGCGGGGAGAAGGCGGC No data
Right 1002648481 5:180674069-180674091 GGGCGCGCCTGGGCCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002648481 Original CRISPR GGGCGCGCCTGGGCCCGCGC GGG Intergenic